ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast69b11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC124577.5| Mus musculus BAC clone RP23-162P10 from 9, comple... 42 0.27
2dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 1.0
3gb|AC129181.4| Mus musculus chromosome UL clone RP23-325P17, com... 40 1.0
4dbj|AP004645.3| Oryza sativa (japonica cultivar-group) genomic D... 40 1.0
5gb|AE014835.1| Plasmodium falciparum 3D7 chromosome 10 section 7... 38 4.1
6emb|CR759954.9| Human DNA sequence from clone DAAP-101P24 on chr... 38 4.1
7ref|XM_447528.1| Candida glabrata CBS138 hypothetical protein (C... 38 4.1
8emb|CR936876.2| Human DNA sequence from clone DAMC-279M23 on chr... 38 4.1
9ref|XM_719352.1| Plasmodium yoelii yoelii str. 17XNL oxysterol-b... 38 4.1
10gb|AC004028.2| Homo sapiens PAC clone RP4-800B9 from 7, complete... 38 4.1
11emb|Z84474.1|HS111M5 Human DNA sequence from clone RP1-111M5 on ... 38 4.1
12emb|BX119924.8| Human DNA sequence from clone DASS-46L4 on chrom... 38 4.1
13emb|AL844539.5| Human DNA sequence from clone DAQB-239N17 on chr... 38 4.1
14emb|AL662871.9| Human DNA sequence from clone XXbac-322C17 on ch... 38 4.1
15emb|AL662859.5| Human DNA sequence from clone XXbac-196D17 on ch... 38 4.1
16emb|AL590550.8| Human DNA sequence from clone RP11-398B19 on chr... 38 4.1
17emb|AL445667.4| Human DNA sequence from clone RP11-489A10 on chr... 38 4.1
18emb|AL356241.8| Human DNA sequence from clone RP11-58K5 on chrom... 38 4.1
19emb|AL162456.14| Human DNA sequence from clone RP11-95C14 on chr... 38 4.1
20gb|AC131602.4| Rattus norvegicus 2 BAC CH230-33J10 (Children's H... 38 4.1
21emb|CR628337.1| Legionella pneumophila str. Lens complete genome 38 4.1
22emb|CR380955.1| Candida glabrata strain CBS138 chromosome I comp... 38 4.1
23emb|CR759942.12| Human DNA sequence from clone DAAP-182E11 on ch... 38 4.1
24gb|AC092296.2| Homo sapiens chromosome 19 clone CTD-3162L10, com... 38 4.1
25gb|AC021035.8| Homo sapiens chromosome 10 clone RP11-381K7, comp... 38 4.1
26gb|AF338039.1|AF338039 Candida glabrata vacuolar sorting protein... 38 4.1
27emb|BX908720.10| Human DNA sequence from clone DAMA-184I15 on ch... 38 4.1
28gb|AC105399.3| Homo sapiens BAC clone RP11-715P7 from 2, complet... 38 4.1
29dbj|AB072289.1| Ipomoea nil transposon Tpn122 DNA, complete sequ... 38 4.1
30dbj|AB072272.1| Ipomoea nil transposon Tpn102 DNA, complete sequ... 38 4.1
31dbj|AB072271.1| Ipomoea nil transposon Tpn101 DNA, complete sequ... 38 4.1
32dbj|AB006186.1| Ipomoea nil Tin6 transposon DNA, partial sequence 38 4.1
33emb|AL732636.1| Tetraodon DNA sequence from clone XX-C0AA050BF02... 38 4.1

>gb|AC124577.5| Mus musculus BAC clone RP23-162P10 from 9, complete sequence
          Length = 218248

 Score = 42.1 bits (21), Expect = 0.27
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 74    ttttatagggaaggaaatcta 94
             |||||||||||||||||||||
Sbjct: 97022 ttttatagggaaggaaatcta 97002



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 6        ttactcataccaggacatca 25
                ||||||||||||||||||||
Sbjct: 15564302 ttactcataccaggacatca 15564283



to top

>gb|AC129181.4| Mus musculus chromosome UL clone RP23-325P17, complete sequence
          Length = 204520

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 72     tattttatagggaaggaaat 91
              ||||||||||||||||||||
Sbjct: 135056 tattttatagggaaggaaat 135075



to top

>dbj|AP004645.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1119_B10
          Length = 148508

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 6      ttactcataccaggacatca 25
              ||||||||||||||||||||
Sbjct: 112060 ttactcataccaggacatca 112041



to top

>gb|AE014835.1| Plasmodium falciparum 3D7 chromosome 10 section 7 of 7 of the
            complete sequence
          Length = 180450

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 55   aaaagagtgcgcattattatttt 77
            ||||||||||| |||||||||||
Sbjct: 4697 aaaagagtgcgaattattatttt 4719



to top

>emb|CR759954.9| Human DNA sequence from clone DAAP-101P24 on chromosome 6, complete
             sequence
          Length = 94061

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    cattattattttataggga 84
             |||||||||||||||||||
Sbjct: 94008 cattattattttataggga 94026



to top

>ref|XM_447528.1| Candida glabrata CBS138 hypothetical protein (CAGL0I06380g) partial
           mRNA
          Length = 3591

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 13  taccaggacatcatcacta 31
           |||||||||||||||||||
Sbjct: 769 taccaggacatcatcacta 787



to top

>emb|CR936876.2| Human DNA sequence from clone DAMC-279M23 on chromosome 6, complete
            sequence
          Length = 41386

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 66   cattattattttataggga 84
            |||||||||||||||||||
Sbjct: 2291 cattattattttataggga 2309



to top

>ref|XM_719352.1| Plasmodium yoelii yoelii str. 17XNL oxysterol-binding protein-related
            protein 2 (PY04188) partial mRNA
          Length = 3471

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 21   catcatcactactacttat 39
            |||||||||||||||||||
Sbjct: 1693 catcatcactactacttat 1675



to top

>gb|AC004028.2| Homo sapiens PAC clone RP4-800B9 from 7, complete sequence
          Length = 112392

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 73    attttatagggaaggaaat 91
             |||||||||||||||||||
Sbjct: 70909 attttatagggaaggaaat 70927



to top

>emb|Z84474.1|HS111M5 Human DNA sequence from clone RP1-111M5 on chromosome 6p21.3 Contains
             an RPL13 (60S Ribosomal protein L13, BBC1) pseudogene, a
             zinc finger protein pseudogene, the 3' end of the RFP gene
             for ret finger protein, four CpG islands, ESTs, STSs and
             GSSs, complete sequence
          Length = 107526

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    cattattattttataggga 84
             |||||||||||||||||||
Sbjct: 61296 cattattattttataggga 61314



to top

>emb|BX119924.8| Human DNA sequence from clone DASS-46L4 on chromosome 6, complete
             sequence
          Length = 92058

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    cattattattttataggga 84
             |||||||||||||||||||
Sbjct: 37687 cattattattttataggga 37705



to top

>emb|AL844539.5| Human DNA sequence from clone DAQB-239N17 on chromosome 6 Contains the
             NOL5BP pseudogene for nucleolar protein 5B, the RPL13P
             pseudogene for ribosomal protein L13 and 3 CpG islands,
             complete sequence
          Length = 98145

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    cattattattttataggga 84
             |||||||||||||||||||
Sbjct: 94279 cattattattttataggga 94297



to top

>emb|AL662871.9| Human DNA sequence from clone XXbac-322C17 on chromosome 6 contains
            the RFP gene for ret finger protein gene, a zinc finger
            protein pseudogene, a novel protein and three CpG
            islands, complete sequence
          Length = 103158

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 66   cattattattttataggga 84
            |||||||||||||||||||
Sbjct: 5044 cattattattttataggga 5062



to top

>emb|AL662859.5| Human DNA sequence from clone XXbac-196D17 on chromosome 6 contains a
            zinc finger protein pseudogene, the RFP gene for ret
            finger protein and three CpG islands, complete sequence
          Length = 61233

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 66   cattattattttataggga 84
            |||||||||||||||||||
Sbjct: 3050 cattattattttataggga 3068



to top

>emb|AL590550.8| Human DNA sequence from clone RP11-398B19 on chromosome 6, complete
             sequence
          Length = 60406

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 70    attattttatagggaaggaaatc 92
             ||||||||||||||||| |||||
Sbjct: 11267 attattttatagggaagaaaatc 11289



to top

>emb|AL445667.4| Human DNA sequence from clone RP11-489A10 on chromosome 20 Contains
             STSs and GSSs, complete sequence
          Length = 43977

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 68    ttattattttatagggaag 86
             |||||||||||||||||||
Sbjct: 33584 ttattattttatagggaag 33566



to top

>emb|AL356241.8| Human DNA sequence from clone RP11-58K5 on chromosome 13, complete
             sequence
          Length = 171068

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 71    ttattttatagggaaggaa 89
             |||||||||||||||||||
Sbjct: 29610 ttattttatagggaaggaa 29628



to top

>emb|AL162456.14| Human DNA sequence from clone RP11-95C14 on chromosome 13 Contains part
              of the GPC5 gene for glypican 5, complete sequence
          Length = 165100

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 21     catcatcactactacttat 39
              |||||||||||||||||||
Sbjct: 134683 catcatcactactacttat 134701



to top

>gb|AC131602.4| Rattus norvegicus 2 BAC CH230-33J10 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 216155

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 72    tattttatagggaaggaaa 90
             |||||||||||||||||||
Sbjct: 52376 tattttatagggaaggaaa 52394



to top

>emb|CR628337.1| Legionella pneumophila str. Lens complete genome
          Length = 3345687

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 73      attttatagggaaggaaat 91
               |||||||||||||||||||
Sbjct: 3114925 attttatagggaaggaaat 3114943



to top

>emb|CR380955.1| Candida glabrata strain CBS138 chromosome I complete sequence
          Length = 1089401

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 13     taccaggacatcatcacta 31
              |||||||||||||||||||
Sbjct: 618766 taccaggacatcatcacta 618748



to top

>emb|CR759942.12| Human DNA sequence from clone DAAP-182E11 on chromosome 6, complete
            sequence
          Length = 69422

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 66   cattattattttataggga 84
            |||||||||||||||||||
Sbjct: 1947 cattattattttataggga 1965



to top

>gb|AC092296.2| Homo sapiens chromosome 19 clone CTD-3162L10, complete sequence
          Length = 150222

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 72    tattttatagggaaggaaa 90
             |||||||||||||||||||
Sbjct: 95052 tattttatagggaaggaaa 95034



to top

>gb|AC021035.8| Homo sapiens chromosome 10 clone RP11-381K7, complete sequence
          Length = 173791

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                        
Query: 51    aagaaaaagagtgcgcattattatttt 77
             ||||||||||||  |||||||||||||
Sbjct: 37243 aagaaaaagagtaagcattattatttt 37217



to top

>gb|AF338039.1|AF338039 Candida glabrata vacuolar sorting protein 4 (VPS4) gene, partial cds;
            and mitochondrial RNase P precursor (RPM2) gene, complete
            cds, nuclear gene for mitochondrial product
          Length = 6033

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 13   taccaggacatcatcacta 31
            |||||||||||||||||||
Sbjct: 2146 taccaggacatcatcacta 2164



to top

>emb|BX908720.10| Human DNA sequence from clone DAMA-184I15 on chromosome 6, complete
              sequence
          Length = 132528

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 66     cattattattttataggga 84
              |||||||||||||||||||
Sbjct: 127008 cattattattttataggga 127026



to top

>gb|AC105399.3| Homo sapiens BAC clone RP11-715P7 from 2, complete sequence
          Length = 172435

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 68    ttattattttatagggaaggaaa 90
             ||||||||||| |||||||||||
Sbjct: 95817 ttattattttaaagggaaggaaa 95839



to top

>dbj|AB072289.1| Ipomoea nil transposon Tpn122 DNA, complete sequence
          Length = 6363

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 62  tgcgcattattattttata 80
           |||||||||||||||||||
Sbjct: 463 tgcgcattattattttata 481



to top

>dbj|AB072272.1| Ipomoea nil transposon Tpn102 DNA, complete sequence
          Length = 5571

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 62  tgcgcattattattttata 80
           |||||||||||||||||||
Sbjct: 476 tgcgcattattattttata 494



to top

>dbj|AB072271.1| Ipomoea nil transposon Tpn101 DNA, complete sequence
          Length = 7478

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 62  tgcgcattattattttata 80
           |||||||||||||||||||
Sbjct: 472 tgcgcattattattttata 490



to top

>dbj|AB006186.1| Ipomoea nil Tin6 transposon DNA, partial sequence
          Length = 500

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 62  tgcgcattattattttata 80
           |||||||||||||||||||
Sbjct: 464 tgcgcattattattttata 482



to top

>emb|AL732636.1| Tetraodon DNA sequence from clone XX-C0AA050BF02, complete sequence
          Length = 133117

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    cattattattttataggga 84
             |||||||||||||||||||
Sbjct: 52484 cattattattttataggga 52466


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,896,077
Number of Sequences: 3902068
Number of extensions: 1896077
Number of successful extensions: 148171
Number of sequences better than 10.0: 34
Number of HSP's better than 10.0 without gapping: 34
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 148011
Number of HSP's gapped (non-prelim): 160
length of query: 95
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 74
effective length of database: 17,151,101,840
effective search space: 1269181536160
effective search space used: 1269181536160
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top