ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast64d11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|M36658.1|MZEH3A Corn histone H3 (H3C3) gene, complete cds 266 4e-68
2ref|NM_185612.1| Oryza sativa (japonica cultivar-group), predic... 252 6e-64
3dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 252 6e-64
4dbj|AP005828.2| Oryza sativa (japonica cultivar-group) genomic D... 252 6e-64
5dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic D... 252 6e-64
6gb|BT017805.1| Zea mays clone EL01N0506E02.c mRNA sequence 250 2e-63
7ref|NM_185609.1| Oryza sativa (japonica cultivar-group), predic... 244 1e-61
8emb|X13679.1|OSHIS3PS Oryza sativa H3 histone pseudogene H3R-12 244 1e-61
9gb|AC134048.3| Oryza sativa (japonica cultivar-group) chromosome... 240 2e-60
10gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome... 240 2e-60
11emb|X13680.1|OSHIS321 Oryza sativa H3 histone H3R-21 clone RH3-2 240 2e-60
12dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 240 2e-60
13gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 240 2e-60
14gb|U77296.1|OSU77296 Oryza sativa histone 3 mRNA, complete cds 240 2e-60
15ref|XM_475315.1| Oryza sativa (japonica cultivar-group), predic... 238 9e-60
16gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome... 238 9e-60
17emb|X00937.1|TAHI02 Wheat histone H3 gene 238 9e-60
18dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 238 9e-60
19dbj|AK120955.1| Oryza sativa (japonica cultivar-group) cDNA clon... 238 9e-60
20emb|X13678.1|OSHIS311 Oryza sativa H3 histone gene H3R-11 234 1e-58
21ref|NM_185607.1| Oryza sativa (japonica cultivar-group), predic... 232 5e-58
22ref|NM_190750.1| Oryza sativa (japonica cultivar-group), predic... 230 2e-57
23dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 230 2e-57
24dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic D... 230 2e-57
25dbj|AK108078.1| Oryza sativa (japonica cultivar-group) cDNA clon... 230 2e-57
26gb|M34928.1|BLYHISH3PA Barley histone H3 mRNA, 3' end 230 2e-57
27gb|U25664.1|OSU25664 Oryza sativa histone H3 gene, complete cds 228 8e-57
28gb|M35388.1|MZEHISH3A Zea mays histone H3 gene, complete cds 228 8e-57
29gb|M15664.1|RICHIS3 Rice histone 3 gene, complete cds 228 8e-57
30gb|M13378.1|MZEH3C2 Maize (Zea mays) histone H3 gene (H3C2), com... 228 8e-57
31ref|NM_185613.1| Oryza sativa (japonica cultivar-group), predic... 224 1e-55
32ref|XM_472456.1| Oryza sativa (japonica cultivar-group), predic... 220 2e-54
33dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 220 2e-54
34emb|AL606618.4|OSJN00062 Oryza sativa genomic DNA, chromosome 4,... 220 2e-54
35emb|X79714.1|LTMRHIS3 L.temulentum mRNA for histone H3 216 3e-53
36gb|BT018930.1| Zea mays clone Contig60.F mRNA sequence 214 1e-52
37emb|X84377.1|ZMHIS3DNA Z.mays histone H3 gene 214 1e-52
38gb|BT018179.1| Zea mays clone EL01N0557G06.c mRNA sequence 212 5e-52
39dbj|AB205017.1| Lolium multiflorum gene for replacement histone ... 204 1e-49
40ref|XM_493701.1| Oryza sativa (japonica cultivar-group), mRNA 200 2e-48
41dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic D... 200 2e-48
42gb|AF093633.1|AF093633 Oryza sativa histone H3 mRNA, complete cds 200 2e-48
43ref|XM_425464.1| PREDICTED: Gallus gallus similar to histone pro... 196 3e-47
44ref|XM_416198.1| PREDICTED: Gallus gallus similar to GLP_39_8822... 196 3e-47
45ref|XM_416190.1| PREDICTED: Gallus gallus similar to GLP_39_8822... 196 3e-47
46ref|XM_416186.1| PREDICTED: Gallus gallus similar to GLP_39_8822... 196 3e-47
47gb|U37579.1|GGU37579 Gallus gallus histone H3-VIII gene, complet... 196 3e-47
48gb|U37578.1|GGU37578 Gallus gallus histone H3-VII gene, complete... 196 3e-47
49gb|U37577.1|GGU37577 Gallus gallus histone H3-VI gene, complete cds 196 3e-47
50emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes 188 7e-45
51emb|CR390239.1| Gallus gallus finished cDNA, clone ChEST932d15 188 7e-45
52emb|X62291.1|GGHISH3IV G.gallus gene for histone H3-IV 188 7e-45
53emb|X62292.1|GGHISH3V G.gallus gene for histone H3-V 188 7e-45
54gb|AF140033.1|AF140033 Phreatamoeba balamuthi histone H3 mRNA, c... 188 7e-45
55emb|Y08528.1|OSHISTON3 Oryza sativa mRNA for histone 3 188 7e-45
56gb|M61155.1|CHKH3AB Chicken histone H3 gene, complete cds 188 7e-45
57gb|M61154.1|CHKH3AA Chicken histone H3 gene, complete cds 188 7e-45
58gb|M13379.1|MZEH3C4 Maize (Zea mays) histone H3 gene (H3C4), com... 188 7e-45
59gb|BT018950.1| Zea mays clone Contig110.F mRNA sequence 186 3e-44
60ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro... 182 4e-43
61emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4... 182 4e-43
62ref|XM_845651.1| PREDICTED: Canis familiaris similar to CG31613-... 176 3e-41
63gb|BT017332.1| Zea mays clone EL01N0320H03.c mRNA sequence 174 1e-40
64gb|BT016934.1| Zea mays clone E04912703G10.c mRNA sequence 174 1e-40
65gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, comple... 168 7e-39
66gb|AY181030.1| Toxoplasma gondii histone H3 mRNA, complete cds 167 3e-38
67ref|XM_540290.1| PREDICTED: Canis familiaris similar to H3 histo... 163 4e-37
68ref|XM_540285.1| PREDICTED: Canis familiaris similar to H3 histo... 163 4e-37
69gb|DQ393956.1| Cydia pomonella clone Cp4.140 microsatellite sequ... 163 4e-37
70gb|DQ393939.1| Cydia pomonella clone Cp4.P microsatellite sequence 163 4e-37
71gb|DQ393935.1| Cydia pomonella clone Cp4.118 microsatellite sequ... 163 4e-37
72gb|DQ393934.1| Cydia pomonella clone Cp4.100 microsatellite sequ... 163 4e-37
73gb|U38422.1|TAU38422 Triticum aestivum histone H3 gene, partial ... 163 4e-37
74ref|XM_849194.1| PREDICTED: Canis familiaris similar to histone ... 159 6e-36
75ref|XM_545420.2| PREDICTED: Canis familiaris similar to histone ... 159 6e-36
76ref|XM_545399.1| PREDICTED: Canis familiaris similar to histone ... 159 6e-36
77ref|XM_545397.2| PREDICTED: Canis familiaris similar to histone ... 159 6e-36
78ref|XM_848810.1| PREDICTED: Canis familiaris similar to histone ... 159 6e-36
79ref|XM_848782.1| PREDICTED: Canis familiaris similar to histone ... 159 6e-36
80ref|XM_545429.1| PREDICTED: Canis familiaris similar to histone ... 159 6e-36
81ref|XM_545385.1| PREDICTED: Canis familiaris similar to histone ... 159 6e-36
82ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone ... 159 6e-36
83ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone ... 159 6e-36
84dbj|AB185026.1| Conocephalum conicum H3 gene for histone 3, comp... 159 6e-36
85dbj|AB185023.1| Conocephalum conicum H3 gene for histone 3, comp... 159 6e-36
86gb|U38423.1|TAU38423 Triticum aestivum histone H3 gene, partial ... 159 6e-36
87ref|XM_545428.1| PREDICTED: Canis familiaris similar to histone ... 157 3e-35
88gb|DQ393931.1| Cydia pomonella clone Cp4.61 microsatellite sequence 155 1e-34
89gb|M14396.1|CIIHISH3A Duck H3.4 variant histone gene 155 1e-34
90gb|AY125229.1| Argia vivida histone 3 gene, partial cds 153 4e-34
91gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I... 153 4e-34
92ref|NM_178206.2| Mus musculus histone 1, H3h (Hist1h3h), mRNA 151 2e-33
93emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr... 151 2e-33
94gb|AY158944.1| Mus musculus histone protein Hist1h3h gene, compl... 151 2e-33
95gb|M32462.1|MUSHIS3D Mouse histone H3 (H3.1-291) gene, complete cds 151 2e-33
96gb|AC151366.3| Aotus nancymaae clone CH258-105B22, complete sequ... 149 6e-33
97gb|AF520775.1| Hypocrea jecorina histone H3 gene, complete cds 149 6e-33
98ref|XM_870218.1| PREDICTED: Bos taurus similar to histone 1, H2a... 147 2e-32
99ref|XM_684297.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 147 2e-32
100emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 ... 147 2e-32
101ref|NM_178216.1| Mus musculus histone 2, H3c1 (Hist2h3c1), trans... 145 1e-31
102gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339 145 1e-31
103ref|XM_603864.2| PREDICTED: Bos taurus similar to histone 1, H2a... 145 1e-31
104ref|XM_599846.2| PREDICTED: Bos taurus similar to histone 1, H2a... 145 1e-31
105ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h... 145 1e-31
106gb|AY125231.1| Melanoplus sp. OR18 histone 3 gene, partial cds 145 1e-31
107emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 a... 145 1e-31
108dbj|AK134918.1| Mus musculus adult male olfactory brain cDNA, RI... 145 1e-31
109ref|XM_693458.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 145 1e-31
110gb|U62675.1|MMU62675 Mus musculus histone H3.2-616 (H3-616), and... 145 1e-31
111gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), ... 145 1e-31
112ref|NG_002616.1| Homo sapiens histone 2, H3b (HIST2H3B) pseudoge... 145 1e-31
113gb|BC094041.1| Mus musculus histone 2, H3c1, mRNA (cDNA clone MG... 145 1e-31
114gb|AF531306.1| Homo sapiens histone H3 (HIST2H3B) pseudogene, co... 145 1e-31
115ref|XM_227461.2| PREDICTED: Rattus norvegicus similar to histone... 145 1e-31
116gb|AY158955.1| Mus musculus histone protein Hist2h3b gene, compl... 145 1e-31
117gb|AY158954.1| Mus musculus histone protein Hist2h3c1 gene, comp... 145 1e-31
118gb|AY158941.1| Mus musculus histone protein Hist2h2bb gene, comp... 145 1e-31
119gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, comp... 145 1e-31
120gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, comple... 145 1e-31
121ref|NM_178215.1| Mus musculus histone 2, H3b (Hist2h3b), mRNA 145 1e-31
122gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I... 145 1e-31
123gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I... 145 1e-31
124gb|AY749753.1| Diphlebia coerulescens histone H3 (H3) gene, part... 145 1e-31
125gb|M32461.1|MUSHIS3C Mouse histone H3 (H3.2-614) gene, complete cds 145 1e-31
126ref|NM_145073.2| Mus musculus histone 1, H3g (Hist1h3g), mRNA 143 4e-31
127gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co... 143 4e-31
128ref|XM_782287.1| PREDICTED: Strongylocentrotus purpuratus simila... 143 4e-31
129emb|X80325.1|MPMPH315 M.pahari mpH315 gene 143 4e-31
130emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr... 143 4e-31
131ref|XM_686806.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 143 4e-31
132ref|XM_694120.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 143 4e-31
133ref|XM_694149.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 143 4e-31
134dbj|AB185075.1| Conocephalum conicum H3 gene for histone 3, comp... 143 4e-31
135dbj|AB185072.1| Conocephalum conicum H3 gene for histone 3, comp... 143 4e-31
136ref|XM_227460.3| PREDICTED: Rattus norvegicus histone 2, H3c2 (p... 143 4e-31
137gb|AY158946.1| Mus musculus histone protein Hist1h3g gene, compl... 143 4e-31
138emb|X01684.1|MMHISH31 Mouse gene (H3.1) for histone H3 143 4e-31
139gb|M32460.1|MUSHIS3B Mouse histone H3 (H3.1-221) gene, complete cds 143 4e-31
140gb|BC107285.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMA... 139 6e-30
141ref|NM_178205.1| Mus musculus histone 1, H3e (Hist1h3e), mRNA 139 6e-30
142ref|NM_178203.1| Mus musculus histone 1, H3b (Hist1h3b), mRNA 139 6e-30
143emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr... 139 6e-30
144ref|XM_684517.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 139 6e-30
145ref|XM_683134.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 139 6e-30
146ref|XM_687893.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 139 6e-30
147gb|U62671.1|MMU62671 Mus musculus histone H3.2-B (H3-B) gene, co... 139 6e-30
148gb|AY158951.1| Mus musculus histone protein Hist1h3b gene, compl... 139 6e-30
149gb|AY158948.1| Mus musculus histone protein Hist1h3e gene, compl... 139 6e-30
150gb|U38420.1|HVU38420 Hordeum vulgare histone H3 gene, partial cd... 139 6e-30
151ref|NM_019469.1| Mus musculus histone 2, H3c1 (Hist2h3c1), trans... 137 2e-29
152ref|XM_871261.1| PREDICTED: Bos taurus similar to histone 1, H2a... 137 2e-29
153ref|XM_870476.1| PREDICTED: Bos taurus similar to histone 1, H2a... 137 2e-29
154ref|XM_591827.2| PREDICTED: Bos taurus similar to histone 1, H2a... 137 2e-29
155ref|XM_601510.2| PREDICTED: Bos taurus similar to histone 1, H2a... 137 2e-29
156gb|BC015270.1| Mus musculus histone 2, H3c2, mRNA (cDNA clone MG... 137 2e-29
157ref|NM_054045.2| Mus musculus histone 2, H3c2 (Hist2h3c2), mRNA 137 2e-29
158emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23 137 2e-29
159emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes 137 2e-29
160emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A... 137 2e-29
161emb|X85102.1|OSRNAHIS3 O.sativa mRNA for histone H3 137 2e-29
162emb|CR760429.2| Xenopus tropicalis finished cDNA, clone TNeu057j11 137 2e-29
163gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo... 137 2e-29
164gb|AY749755.1| Griseargiolestes albescens histone H3 (H3) gene, ... 137 2e-29
165gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene... 137 2e-29
166gb|AY725673.1| Cylindrocladium multiphialidicum strain CBS 11267... 135 9e-29
167ref|NM_175653.1| Mus musculus histone1, H3c (Hist1h3c), mRNA 135 9e-29
168ref|XM_848995.1| PREDICTED: Canis familiaris similar to histone ... 135 9e-29
169ref|XM_780065.1| PREDICTED: Strongylocentrotus purpuratus simila... 135 9e-29
170emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, his... 135 9e-29
171emb|X80324.1|MPMPH3110 M.pahari mpH3110 gene 135 9e-29
172emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143 135 9e-29
173emb|X80326.1|MPMPH312 M.pahari mpH312 gene 135 9e-29
174emb|X53330.1|PDHISTCL P.dumerilii histone gene cluster for core ... 135 9e-29
175ref|XM_684015.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 135 9e-29
176ref|XM_694088.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 135 9e-29
177emb|CR541858.1| Homo sapiens full open reading frame cDNA clone ... 135 9e-29
178dbj|AK006742.1| Mus musculus adult male testis cDNA, RIKEN full-... 135 9e-29
179gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and hist... 135 9e-29
180dbj|AB185074.1| Conocephalum conicum H3 gene for histone 3, comp... 135 9e-29
181dbj|AB185035.1| Conocephalum supradecompositum H3 gene for histo... 135 9e-29
182gb|AF404631.1| Lewia infectoria isolate CR31 histone gene, parti... 135 9e-29
183gb|AY158952.1| Mus musculus histone protein Hist1h3a gene, compl... 135 9e-29
184gb|AY158950.1| Mus musculus histone protein Hist1h3c gene, compl... 135 9e-29
185emb|Z46261.1|HSHISH3A H.sapiens DNA for histone H3a 135 9e-29
186emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for hist... 133 4e-28
187ref|XM_780236.1| PREDICTED: Strongylocentrotus purpuratus simila... 133 4e-28
188ref|XM_777897.1| PREDICTED: Strongylocentrotus purpuratus simila... 133 4e-28
189ref|XM_781054.1| PREDICTED: Strongylocentrotus purpuratus simila... 133 4e-28
190gb|BC097059.1| Danio rerio zgc:113983, mRNA (cDNA clone MGC:1139... 133 4e-28
191ref|NM_001025171.1| Danio rerio zgc:113983 (zgc:113983), mRNA 133 4e-28
192ref|NM_074632.1| Caenorhabditis elegans HIStone family member (h... 133 4e-28
193emb|Z93388.1|CET10C6 Caenorhabditis elegans Cosmid T10C6, comple... 133 4e-28
194ref|NM_013548.2| Mus musculus histone 1, H3f (Hist1h3f), mRNA 131 1e-27
195ref|XM_527253.1| PREDICTED: Pan troglodytes similar to histone 1... 131 1e-27
196gb|BC103549.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC... 131 1e-27
197emb|Z30939.1|MDH3HIST Mus domesticus partial mRNA for histone H3... 131 1e-27
198gb|DQ284053.1| Boophis tephraeomystax histone H3a gene, partial cds 131 1e-27
199dbj|AK010121.1| Mus musculus adult male tongue cDNA, RIKEN full-... 131 1e-27
200gb|AY158947.1| Mus musculus histone protein Hist1h3f gene, compl... 131 1e-27
201gb|AY662892.1| Etroplus maculatus histone H3a gene, partial cds 131 1e-27
202gb|BC101955.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC... 131 1e-27
203gb|BC101956.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC... 131 1e-27
204gb|BC101954.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC... 131 1e-27
205emb|X01685.1|MMHISH32 Mouse gene (H3.2) for histone H3 131 1e-27
206gb|M33989.1|MUSH2AX1X Mouse histone H3.2 gene, complete cds 131 1e-27
207gb|M32459.1|MUSHIS3A Mouse histone H3 (H3.2-221) gene, complete cds 131 1e-27
208gb|J01175.1|SULHISL34 Sea urchin (L.pictus) late-stage histone H... 131 1e-27
209ref|XM_524859.1| PREDICTED: Pan troglodytes LOC469476 (LOC469476... 129 6e-27
210gb|BC062305.1| Homo sapiens cDNA clone IMAGE:3162462 129 6e-27
211gb|BC007518.2| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC... 129 6e-27
212ref|XM_590015.2| PREDICTED: Bos taurus similar to histone 1, H2a... 129 6e-27
213ref|XM_868935.1| PREDICTED: Bos taurus similar to histone 1, H2a... 129 6e-27
214ref|XM_868913.1| PREDICTED: Bos taurus similar to histone 1, H2a... 129 6e-27
215ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@... 129 6e-27
216ref|NM_003536.2| Homo sapiens histone 1, H3h (HIST1H3H), mRNA 129 6e-27
217ref|XM_747656.1| Aspergillus fumigatus Af293 histone H3 (Afu1g13... 129 6e-27
218gb|AF531281.1| Homo sapiens histone H3 (HIST1H3H) gene, complete... 129 6e-27
219emb|CR716243.2|CNS0GFLO Tetraodon nigroviridis full-length cDNA 129 6e-27
220gb|AY125232.1| Pterophylla camellifolia histone 3 gene, partial cds 129 6e-27
221emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch... 129 6e-27
222emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 o... 129 6e-27
223emb|BX649607.1| Aspergillus fumigatus BAC pilot project supercon... 129 6e-27
224gb|BC096130.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC... 129 6e-27
225gb|BC096128.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC... 129 6e-27
226gb|BC096129.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC... 129 6e-27
227emb|Z83735.1|HSZ83735 H.sapiens hH3/k gene 129 6e-27
228ref|XM_683485.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 129 6e-27
229ref|XM_497711.2| PREDICTED: Homo sapiens similar to H3 histone, ... 129 6e-27
230gb|AY749743.1| Ichthybotus hudsoni histone H3 (H3) gene, partial... 129 6e-27
231gb|AY749709.1| Mystaxiops venatoris histone H3 (H3) gene, partia... 129 6e-27
232gb|AY749705.1| Choroterpes sp. EP024 histone H3 (H3) gene, parti... 129 6e-27
233ref|NM_013550.3| Mus musculus histone 1, H3a (Hist1h3a), mRNA 127 2e-26
234gb|BC107287.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMA... 127 2e-26
235gb|DQ079682.1| Lysmata wurdemanni voucher MLP120 histone H3 (H3)... 127 2e-26
236gb|BC069303.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 127 2e-26
237gb|BC067490.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 127 2e-26
238gb|BC067491.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 127 2e-26
239gb|BC054666.1| Danio rerio zgc:66241, mRNA (cDNA clone MGC:66241... 127 2e-26
240ref|NG_001335.1| Homo sapiens genomic large histone family clust... 127 2e-26
241ref|NM_003529.2| Homo sapiens histone 1, H3a (HIST1H3A), mRNA 127 2e-26
242gb|AY788897.1| Mnais nawai histone 3 gene, partial cds 127 2e-26
243gb|AF531274.1| Homo sapiens histone H3 (HIST1H3A) gene, complete... 127 2e-26
244emb|X58895.1|UCHISTO U.caupo gene for H2A, H2B, H3, and H4 histones 127 2e-26
245emb|X00593.1|LPH3H4 Lytechinus pictus H3 and H4 gene 127 2e-26
246gb|AY521718.1| Romalea sp. BYU_ACOR015 histone H3 (H3) gene, par... 127 2e-26
247ref|NM_199745.1| Danio rerio zgc:66241 (zgc:66241), mRNA 127 2e-26
248dbj|AK155722.1| Mus musculus B6-derived CD11 +ve dendritic cells... 127 2e-26
249gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, h... 127 2e-26
250gb|U62670.1|MMU62670 Mus musculus histone H3.1-I (H3-I) gene, co... 127 2e-26
251dbj|AK018952.1| Mus musculus adult male testis cDNA, RIKEN full-... 127 2e-26
252gb|AY158945.1| Mus musculus histone protein Hist1h3i gene, compl... 127 2e-26
253gb|AY923964.1| Phenacolepas osculans isolate PHE1 histone H3 (H3... 127 2e-26
254emb|Z61129.1|HS45E8R H.sapiens CpG island DNA genomic Mse1 fragm... 127 2e-26
255gb|BC066246.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 127 2e-26
256gb|BC066245.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 127 2e-26
257gb|BC066247.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 127 2e-26
258ref|NM_178207.2| Mus musculus histone 1, H3i (Hist1h3i), mRNA 127 2e-26
259gb|AY338636.1| Calopteryx aequabilis histone 3 gene, partial cds 127 2e-26
260ref|XM_527604.1| PREDICTED: Pan troglodytes similar to histone 1... 125 9e-26
261gb|BC067492.1| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC... 125 9e-26
262gb|AF531279.1| Homo sapiens histone H3 (HIST1H3F) gene, complete... 125 9e-26
263emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 o... 125 9e-26
264ref|XM_789723.1| PREDICTED: Strongylocentrotus purpuratus simila... 125 9e-26
265gb|BC096131.1| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC... 125 9e-26
266gb|AF348241.1| Cylindrocladium pseudospathiphylli strain 1623 hi... 125 9e-26
267gb|AF348237.1| Cylindrocladium spathiphylli strain STE-U2188 his... 125 9e-26
268gb|AF348235.1| Calonectria kyotensis strain CBS413.67 histone 3-... 125 9e-26
269gb|AF348234.1| Calonectria kyotensis strain ATCC 18882 histone 3... 125 9e-26
270gb|AF348231.1| Calonectria kyotensis strain ATCC 18443 histone 3... 125 9e-26
271gb|AF348230.1| Cylindrocladium spathiphylli strain ATCC 44730 hi... 125 9e-26
272gb|AF348227.1| Calonectria kyotensis strain STE-U500 histone 3-l... 125 9e-26
273ref|NM_021018.2| Homo sapiens histone 1, H3f (HIST1H3F), mRNA 125 9e-26
274emb|CR542011.1| Homo sapiens full open reading frame cDNA clone ... 125 9e-26
275emb|CR541983.1| Homo sapiens full open reading frame cDNA clone ... 125 9e-26
276dbj|AB185067.1| Conocephalum conicum H3 gene for histone 3, comp... 125 9e-26
277gb|BC069818.1| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC... 125 9e-26
278emb|Z80786.1|HSH3I H.sapiens H3/i gene 125 9e-26
279gb|DQ079694.1| Pachygrapsus marmoratus voucher KCpama histone H3... 123 4e-25
280ref|NM_178204.1| Mus musculus histone1, H3d (Hist1h3d), mRNA 123 4e-25
281gb|L19706.1| Rattus norvegicus H3 histone gene, complete cds 123 4e-25
282gb|DQ284242.1| Batrachylodes vertebralis histone H3a gene, parti... 123 4e-25
283gb|DQ284054.1| Boophis albilabris histone H3a gene, partial cds 123 4e-25
284gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016 123 4e-25
285gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108 123 4e-25
286gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone... 123 4e-25
287ref|NM_067207.3| Caenorhabditis elegans HIStone family member (h... 123 4e-25
288ref|NM_001013056.1| Rattus norvegicus histone 1, H2ai (predicted... 123 4e-25
289gb|AY158949.1| Mus musculus histone protein Hist1h3d gene, compl... 123 4e-25
290gb|AY662912.1| Paratilapia sp. 'Ifasy' histone H3a gene, partial... 123 4e-25
291gb|AY662890.1| Etroplus canarensis histone H3a gene, partial cds 123 4e-25
292ref|XM_518299.1| PREDICTED: Pan troglodytes similar to Histone H... 121 1e-24
293ref|NM_021059.2| Homo sapiens histone 2, H3c (HIST2H3C), mRNA 121 1e-24
294gb|AY648851.1| Homo sapiens histone H3/o gene, complete cds 121 1e-24
295gb|BC084311.1| Xenopus laevis cDNA clone IMAGE:6865011 121 1e-24
296ref|XM_871299.1| PREDICTED: Bos taurus similar to histone 1, H2a... 121 1e-24
297ref|XM_865002.1| PREDICTED: Bos taurus similar to histone 1, H2a... 121 1e-24
298emb|Z98866.1|CEY49E10 Caenorhabditis elegans YAC Y49E10, complet... 121 1e-24
299gb|BC063540.1| Homo sapiens cDNA clone IMAGE:4523373, **** WARNI... 121 1e-24
300gb|BC015544.1| Homo sapiens histone 2, H3c, mRNA (cDNA clone IMA... 121 1e-24
301emb|X01064.1|SGHIS2A3 Rainbow trout histone H2A and H3 genes 121 1e-24
302emb|AJ556872.1|XLA556872 Expression vector pET3-H3 H3 gene for X... 121 1e-24
303ref|XM_928391.1| PREDICTED: Homo sapiens similar to CG31613-PA (... 121 1e-24
304ref|NG_002617.1| Homo sapiens histone 2, H3a (HIST2H3A) pseudoge... 121 1e-24
305ref|NM_001005464.1| Homo sapiens histone H3/o (H3/o), mRNA 121 1e-24
306gb|BC074969.2| Homo sapiens histone H3/o, mRNA (cDNA clone IMAGE... 121 1e-24
307gb|AF404640.1| Alternaria alternata s.l. STE-U4267 isolate CR26 ... 121 1e-24
308gb|AF404639.1| Alternaria arborescens isolate CR3 histone gene, ... 121 1e-24
309gb|AF404638.1| Alternaria alternata s.l. STE-U4257 isolate CR16 ... 121 1e-24
310gb|AF404637.1| Alternaria alternata s.l. STE-U4258 isolate CR17 ... 121 1e-24
311gb|AF404635.1| Alternaria arborescens isolate MA22 histone gene,... 121 1e-24
312gb|AF404634.1| Alternaria tenuissima isolate MA6 histone gene, p... 121 1e-24
313gb|AF404633.1| Alternaria tenuissima isolate MA1 histone gene, p... 121 1e-24
314gb|AF404632.1| Alternaria alternata s.l. STE-U4262 isolate CR21 ... 121 1e-24
315gb|AF404630.1| Alternaria arborescens isolate CR5 histone gene, ... 121 1e-24
316gb|AF404628.1| Alternaria alternata s.l. STE-U4266 isolate CR25 ... 121 1e-24
317gb|AF404627.1| Alternaria alternata s.l. STE-U4263 isolate CR22 ... 121 1e-24
318gb|AF404626.1| Alternaria alternata s.l. STE-U4249 isolate CR8 h... 121 1e-24
319gb|AF404625.1| Alternaria alternata s.l. STE-U4259 isolate CR18 ... 121 1e-24
320gb|AF404624.1| Alternaria alternata s.l. STE-U4265 isolate CR24 ... 121 1e-24
321gb|AF404622.1| Alternaria tenuissima isolate CR27 histone gene, ... 121 1e-24
322gb|AF404621.1| Alternaria sp. STE-U4255 isolate CR14 histone gen... 121 1e-24
323gb|AF404620.1| Alternaria alternata s.l. STE-U4242 isolate CR1 h... 121 1e-24
324gb|AF404619.1| Alternaria sp. STE-U4264 isolate CR23 histone gen... 121 1e-24
325gb|AF404618.1| Alternaria sp. STE-U4247 isolate CR6 histone gene... 121 1e-24
326gb|AF404617.1| Alternaria alternata s.l. STE-U4248 isolate CR7 h... 121 1e-24
327gb|AF404616.1| Alternaria alternata s.l. STE-U4260 isolate CR19 ... 121 1e-24
328gb|AF404615.1| Alternaria alternata s.l. STE-U4261 isolate CR20 ... 121 1e-24
329gb|AF404614.1| Alternaria alternata s.l. STE-U4349 isolate MA26 ... 121 1e-24
330gb|AF404613.1| Alternaria alternata s.l. STE-U4328 isolate MA5 h... 121 1e-24
331gb|AF404612.1| Alternaria alternata s.l. STE-U4327 isolate MA4 h... 121 1e-24
332gb|AF404611.1| Alternaria alternata s.l. STE-U4326 isolate MA3 h... 121 1e-24
333gb|AF404610.1| Alternaria alternata s.l. STE-U4325 isolate MA2 h... 121 1e-24
334gb|AF404609.1| Alternaria alternata s.l. STE-U4348 isolate MA25 ... 121 1e-24
335gb|AF404608.1| Alternaria alternata s.l. STE-U4344 isolate MA21 ... 121 1e-24
336gb|AF404607.1| Alternaria alternata s.l. STE-U4342 isolate MA19 ... 121 1e-24
337gb|AF404606.1| Alternaria alternata s.l. STE-U4341 isolate MA18 ... 121 1e-24
338gb|AF404605.1| Alternaria alternata s.l. STE-U4340 isolate MA17 ... 121 1e-24
339gb|AF404604.1| Alternaria alternata s.l. STE-U4339 isolate MA16 ... 121 1e-24
340gb|AF404603.1| Alternaria alternata s.l. STE-U4338 isolate MA15 ... 121 1e-24
341gb|AF404602.1| Alternaria alternata s.l. STE-U4337 isolate MA14 ... 121 1e-24
342gb|AF404601.1| Alternaria alternata s.l. STE-U4336 isolate MA13 ... 121 1e-24
343gb|AF404600.1| Alternaria alternata s.l. STE-U4332 isolate MA9 h... 121 1e-24
344gb|AF404599.1| Alternaria alternata s.l. STE-U4346 isolate MA23 ... 121 1e-24
345gb|AF404598.1| Alternaria alternata s.l. STE-U4335 isolate MA12 ... 121 1e-24
346gb|AF404597.1| Alternaria alternata s.l. STE-U4333 isolate MA10 ... 121 1e-24
347gb|AF404596.1| Alternaria alternata s.l. STE-U4330 isolate MA7 h... 121 1e-24
348gb|AF404595.1| Alternaria alternata s.l. STE-U4347 isolate MA24 ... 121 1e-24
349gb|AF404594.1| Alternaria alternata s.l. STE-U4343 isolate MA20 ... 121 1e-24
350gb|AF404593.1| Alternaria alternata s.l. STE-U4334 isolate MA11 ... 121 1e-24
351gb|AF404592.1| Alternaria alternata s.l. STE-U4331 isolate MA8 h... 121 1e-24
352gb|AF404591.1| Alternaria arborescens isolate CR2 histone gene, ... 121 1e-24
353gb|AF531307.1| Homo sapiens histone H3 (HIST2H3C) gene, complete... 121 1e-24
354gb|AF531305.1| Homo sapiens histone H3 (HIST2H3A) pseudogene, co... 121 1e-24
355emb|Z56112.1|HS89C12R H.sapiens CpG island DNA genomic Mse1 frag... 121 1e-24
356emb|Z56111.1|HS89C12F H.sapiens CpG island DNA genomic Mse1 frag... 121 1e-24
357emb|Z63365.1|HS81H7R H.sapiens CpG island DNA genomic Mse1 fragm... 121 1e-24
358gb|AY338626.1| Coloburiscus humeralis histone 3 gene, partial cds 121 1e-24
359gb|AY749744.1| Dipteromimus sp. EP150 histone H3 (H3) gene, part... 121 1e-24
360gb|AY749737.1| Platybaetis probus histone H3 (H3) gene, partial cds 121 1e-24
361gb|AY749718.1| Siphlonurus sp. EP084 histone H3 (H3) gene, parti... 121 1e-24
362gb|AY749708.1| Baetis tricaudatus histone H3 (H3) gene, partial cds 121 1e-24
363gb|AY749702.1| Thraulodes sp. EP014 histone H3 (H3) gene, partia... 121 1e-24
364gb|DQ079703.1| Uroptychus parvulus voucher KCurpa histone H3 (H3... 119 5e-24
365gb|AY377764.1| Helicoradomenia sp. AO-2003 histone H3 gene, part... 119 5e-24
366gb|AY125219.1| Echinosoma sp. DM11 histone 3 gene, partial cds 119 5e-24
367gb|AF517884.1| Griffithsia japonica isolate Gj475 histone H3.3 p... 119 5e-24
368ref|NM_001016636.3| Xenopus tropicalis histone 2, H3c (hist1h3g)... 119 5e-24
369gb|AY521731.1| Hydropsyche sp. BYU_ACTR020 histone H3 (H3) gene,... 119 5e-24
370gb|AY521721.1| Gryllotalpidae sp. BYU_ACOR020 histone H3 (H3) ge... 119 5e-24
371gb|DQ284421.1| Pachytriton brevipes histone H3a gene, partial cds 119 5e-24
372dbj|AB226293.1| Aspergillus oryzae cDNA, contig sequence: AoEST3155 119 5e-24
373dbj|AP007161.1| Aspergillus oryzae RIB40 genomic DNA, SC012 119 5e-24
374ref|XM_694212.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 119 5e-24
375ref|XM_688339.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 119 5e-24
376ref|XM_688063.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 119 5e-24
377gb|AF370817.1|AF370817 Locusta migratoria histone H3 gene, parti... 119 5e-24
378dbj|AB185045.1| Conocephalum supradecompositum H3 gene for histo... 119 5e-24
379dbj|AB185037.1| Conocephalum supradecompositum H3 gene for histo... 119 5e-24
380gb|AF404641.1| Lewia infectoria isolate CR28 histone gene, parti... 119 5e-24
381gb|AF404623.1| Lewia infectoria isolate CR15 histone gene, parti... 119 5e-24
382ref|XM_560604.1| Anopheles gambiae str. PEST ENSANGP00000025641 ... 119 5e-24
383ref|XM_318362.1| Anopheles gambiae str. PEST ENSANGP00000016005 ... 119 5e-24
384ref|XM_307081.1| Anopheles gambiae str. PEST ENSANGP00000001387 ... 119 5e-24
385ref|XM_305996.1| Anopheles gambiae str. PEST ENSANGP00000012784 ... 119 5e-24
386gb|AY435465.1| Acremonium strictum strain AS5147 histone H3 gene... 119 5e-24
387gb|AY435464.1| Acremonium strictum strain AS5144 histone H3 gene... 119 5e-24
388emb|CR855729.2| Xenopus tropicalis finished cDNA, clone TGas081o10 119 5e-24
389gb|AY662911.1| Paratilapia sp. 'East' histone H3a gene, partial cds 119 5e-24
390gb|AY662908.1| Paratilapia cf. bleekeri JSS-2004 histone H3a gen... 119 5e-24
391gb|AY338619.1| Baetis sp. Eph11 histone 3 gene, partial cds 119 5e-24
392gb|J00984.1|XELHIS3LB x.laevis histone gene h3 and flanks 119 5e-24
393gb|AY725671.1| Cylindrocladium malesianum strain CBS 112710 hist... 117 2e-23
394gb|AC024696.1| Caenorhabditis elegans cosmid F07B7, complete seq... 117 2e-23
395ref|XM_653245.1| Aspergillus nidulans FGSC A4 histone H3 (AN0733... 117 2e-23
396gb|U64843.2| Caenorhabditis elegans cosmid K06C4, complete sequence 117 2e-23
397gb|AY125218.1| Doru spiculiferum histone 3 gene, partial cds 117 2e-23
398ref|XM_779415.1| PREDICTED: Strongylocentrotus purpuratus simila... 117 2e-23
399emb|X82257.1|DMH33A D.melanogaster mRNA for histone H3.3 variant 117 2e-23
400emb|X55548.1|ANH3GENE A.nidulans gene for core histone for H3 117 2e-23
401gb|U64845.1| Caenorhabditis elegans cosmid F45F2, complete sequence 117 2e-23
402gb|AY119629.1| Drosophila melanogaster RE21618 full insert cDNA 117 2e-23
403gb|AF361949.1| Eimeria tenella histone 3 (H3) mRNA, complete cds 117 2e-23
404ref|NM_078755.2| Drosophila melanogaster Histone H3.3A CG5825-RA... 117 2e-23
405gb|AY071057.1| Drosophila melanogaster RE14004 full length cDNA 117 2e-23
406ref|NM_072891.1| Caenorhabditis elegans HIStone family member (h... 117 2e-23
407ref|NM_072896.2| Caenorhabditis elegans HIStone family member (h... 117 2e-23
408ref|NM_072798.1| Caenorhabditis elegans HIStone family member (h... 117 2e-23
409ref|NM_072875.1| Caenorhabditis elegans HIStone family member (h... 117 2e-23
410gb|AC008233.3|AC008233 Drosophila melanogaster, chromosome 2L, r... 117 2e-23
411gb|AF280091.1|AF280091 Ajellomyces capsulatus histone H3 gene, c... 117 2e-23
412gb|AE003608.5| Drosophila melanogaster chromosome 2L, section 17... 117 2e-23
413gb|DQ275319.1| Graphoderus zonatus voucher BYU KBMGrzo66 histone... 117 2e-23
414gb|U12630.1|ENU12630 Emericella nidulans R153 core histone H3 (H... 117 2e-23
415emb|X06964.1|VCHIS34A Volvox carteri H3-II and H4-II genes for h... 115 9e-23
416gb|AY521728.1| Aphanicerca capensis voucher BYU_ACPL028 histone ... 115 9e-23
417gb|DQ284417.1| Triturus cristatus histone H3a gene, partial cds 115 9e-23
418gb|DQ284405.1| Arthroleptis tanneri histone H3a gene, partial cds 115 9e-23
419gb|DQ284386.1| Elachistocleis ovalis histone H3a gene, partial cds 115 9e-23
420gb|DQ284377.1| Rana guentheri histone H3a gene, partial cds 115 9e-23
421gb|DQ284287.1| Rana guentheri histone H3a gene, partial cds 115 9e-23
422gb|DQ284245.1| Rana johnsi histone H3a gene, partial cds 115 9e-23
423gb|DQ284223.1| Rana aurora histone H3a gene, partial cds 115 9e-23
424gb|DQ284219.1| Rana clamitans histone H3a gene, partial cds 115 9e-23
425gb|DQ284185.1| Chaperina fusca histone H3a gene, partial cds 115 9e-23
426gb|DQ284180.1| Staurois tuberilinguis histone H3a gene, partial cds 115 9e-23
427gb|DQ284177.1| Rana japonica histone H3a gene, partial cds 115 9e-23
428gb|DQ284168.1| Pseudoamolops sauteri histone H3a gene, partial cds 115 9e-23
429dbj|AK020421.1| Mus musculus 12 days embryo embryonic body betwe... 115 9e-23
430ref|XM_344595.2| PREDICTED: Rattus norvegicus histone 1, H4a (pr... 115 9e-23
431gb|AY662925.1| Apistogramma sp. JSS-2004 histone H3a gene, parti... 115 9e-23
432gb|AY662910.1| Paratilapia polleni 'Ravelobe' histone H3a gene, ... 115 9e-23
433gb|AY662905.1| Paretroplus sp. 'Kamoro' histone H3a gene, partia... 115 9e-23
434gb|AY662903.1| Paretroplus polyactis 'South' histone H3a gene, p... 115 9e-23
435gb|AY662898.1| Paretroplus cf. kieneri 'Amboaboa' histone H3a ge... 115 9e-23
436gb|AY662897.1| Paretroplus cf. kieneri 'Ravelobe' histone H3a ge... 115 9e-23
437gb|AY662895.1| Paretroplus kieneri 'Kinkony' histone H3a gene, p... 115 9e-23
438gb|AY662891.1| Etroplus suratensis histone H3a gene, partial cds 115 9e-23
439gb|AY539218.1| Hoplichthys citrinus histone H3 gene, partial cds 115 9e-23
440gb|AY749703.1| Callibaetis sp. EP020 histone H3 (H3) gene, parti... 115 9e-23
441ref|XM_472667.1| Oryza sativa (japonica cultivar-group), predic... 113 3e-22
442gb|AY230984.1| Nesticus sp. X132 histone H3A (H3A) gene, partial... 113 3e-22
443gb|AY525328.1| Oryza sativa (japonica cultivar-group) putative h... 113 3e-22
444gb|BC090320.1| Rattus norvegicus tripartite motif protein 17, mR... 113 3e-22
445gb|AY125233.1| Isoperla davisi histone 3 gene, partial cds 113 3e-22
446emb|AL606615.4|OSJN00048 Oryza sativa genomic DNA, chromosome 4,... 113 3e-22
447gb|DQ096858.1| Xenopus laevis h3r mRNA, complete sequence 113 3e-22
448gb|AY707431.1| Anisolabididae sp. DM22 histone 3 gene, partial cds 113 3e-22
449gb|DQ284260.1| Bufo andrewsi histone H3a gene, partial cds 113 3e-22
450gb|DQ284222.1| Bufo woodhousii histone H3a gene, partial cds 113 3e-22
451gb|DQ284205.1| Bufo haematiticus histone H3a gene, partial cds 113 3e-22
452gb|DQ284196.1| Bufo terrestris histone H3a gene, partial cds 113 3e-22
453gb|DQ284171.1| Epicrionops sp. RAN 26114 histone H3a gene, parti... 113 3e-22
454gb|AF281810.1| Cryphonectria cubensis isolate CRY_268 histone H3... 113 3e-22
455gb|AF281809.1| Cryphonectria cubensis isolate CRY_500 histone H3... 113 3e-22
456gb|AF281808.1| Cryphonectria cubensis isolate CRY_138 histone H3... 113 3e-22
457gb|AF281807.1| Cryphonectria cubensis isolate CRY_144 histone H3... 113 3e-22
458gb|AF281806.1| Cryphonectria cubensis isolate CRY_98 histone H3 ... 113 3e-22
459gb|AF281805.1| Cryphonectria cubensis isolate CRY_0140 histone H... 113 3e-22
460gb|AF404629.1| Lewia infectoria isolate CR30 histone gene, parti... 113 3e-22
461gb|AY923977.1| Gibbula zonata isolate T25 histone H3 (H3) gene, ... 113 3e-22
462gb|AY923976.1| Trochus niloticus isolate T12 histone H3 (H3) gen... 113 3e-22
463gb|AY923962.1| Cyathermia naticoides isolate N1 histone H3 (H3) ... 113 3e-22
464gb|AY435461.1| Harpophora maydis strain CM1A histone H3 gene, pa... 113 3e-22
465gb|AY435460.1| Harpophora maydis strain CM884 histone H3 gene, p... 113 3e-22
466gb|AY435459.1| Harpophora maydis strain CM3B histone H3 gene, pa... 113 3e-22
467gb|AY435458.1| Harpophora maydis strain CM2A1 histone H3 gene, p... 113 3e-22
468dbj|AK100960.1| Oryza sativa (japonica cultivar-group) cDNA clon... 113 3e-22
469gb|AY435476.1| Gaeumannomyces graminis var. tritici strain GGT19... 113 3e-22
470gb|DQ275318.1| Graphoderus fascicollis voucher BYU KBMGrfa65 his... 113 3e-22
471gb|AY662880.1| Monocirrhus polyacanthus histone H3a gene, partia... 113 3e-22
472gb|AY338635.1| Chaquihua sp. EP080 histone 3 gene, partial cds 113 3e-22
473gb|AY749736.1| Atopopus sp. EP134 histone H3 (H3) gene, partial cds 113 3e-22
474gb|AY749729.1| Edmundsius agilis histone H3 (H3) gene, partial cds 113 3e-22
475gb|AY749723.1| Siphlaenigma janae histone H3 (H3) gene, partial cds 113 3e-22
476gb|AY725699.1| Cylindrocladiella lageniformis strain CPC 5607 hi... 111 1e-21
477gb|AY725667.1| Cylindrocladium hongkongense strain CBS 114828 hi... 111 1e-21
478gb|AY725666.1| Cylindrocladium hongkongense strain CBS 114711 hi... 111 1e-21
479gb|AY725665.1| Calonectria kyotensis strain CBS 114552 histone H... 111 1e-21
480gb|AY655576.1| Marosatherina ladigesi histone H3a gene, partial cds 111 1e-21
481gb|DQ079688.1| Munida subrugosa voucher KCmusu histone H3 (H3) g... 111 1e-21
482gb|DQ079679.1| Lithodes santolla voucher KClisa histone H3 (H3) ... 111 1e-21
483gb|AF047656.1| Caenorhabditis elegans cosmid F17E9, complete seq... 111 1e-21
484gb|AY669068.1| Chaetomium globosum histone H3 mRNA, complete cds 111 1e-21
485ref|XM_950910.1| Neurospora crassa OR74A HISTONE H3 (NCU01635.1)... 111 1e-21
486ref|XM_328073.1| Neurospora crassa OR74A HISTONE H3 (NCU01635.1)... 111 1e-21
487ref|XM_356549.3| PREDICTED: Mus musculus similar to histone 1, H... 111 1e-21
488ref|XM_384466.1| Gibberella zeae PH-1 chromosome 2 H3_NEUCR Hist... 111 1e-21
489gb|BC107980.1| Danio rerio zgc:123334, mRNA (cDNA clone MGC:1233... 111 1e-21
490ref|NM_001040004.1| Danio rerio zgc:123334 (zgc:123334), mRNA 111 1e-21
491emb|X72949.1|XLH3HIS X.laevis H3r gene for histone H3 111 1e-21
492emb|AL670001.1|NCB14H13 Neurospora crassa DNA linkage group II B... 111 1e-21
493emb|AL670543.1|NCB7K22 Neurospora crassa DNA linkage group II BA... 111 1e-21
494gb|DQ284352.1| Rana chapaensis histone H3a gene, partial cds 111 1e-21
495gb|DQ284224.1| Rana muscosa histone H3a gene, partial cds 111 1e-21
496gb|AY062173.1| Neurospora crassa histone H3 (hh3) and histone H4... 111 1e-21
497ref|XM_686609.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 111 1e-21
498ref|NM_069006.2| Caenorhabditis elegans HIStone family member (h... 111 1e-21
499gb|DQ026791.1| Alternaria alternata histone gene, partial cds 111 1e-21
500dbj|AB185073.1| Conocephalum conicum H3 gene for histone 3, comp... 111 1e-21

>gb|M36658.1|MZEH3A Corn histone H3 (H3C3) gene, complete cds
          Length = 1177

 Score =  266 bits (134), Expect = 4e-68
 Identities = 164/174 (94%)
 Strand = Plus / Minus

                                                                       
Query: 137 cctaggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcga 196
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||
Sbjct: 957 cctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 898

                                                                       
Query: 197 cccgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcct 256
           | |||||||||||||||||||| ||||||||||||||||| || ||||||||||| ||||
Sbjct: 897 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaacaggccgacgaggtaggcct 838

                                                                 
Query: 257 cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||||||||||| ||||||| ||||||||||||||||||||||||||||||||
Sbjct: 837 cggcggcctcctgcagcgcggcgacggcggaggactggaagcggaggtcggtct 784



to top

>ref|NM_185612.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  252 bits (127), Expect = 6e-64
 Identities = 160/171 (93%)
 Strand = Plus / Minus

                                                                       
Query: 140 aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
           |||||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 409 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 350

                                                                       
Query: 200 gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
           ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
Sbjct: 349 gcttggcgtggatggcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccg 290

                                                              
Query: 260 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||||| ||||||| ||||||||||  ||||||||||||||||||||
Sbjct: 289 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtct 239



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  252 bits (127), Expect = 6e-64
 Identities = 160/171 (93%)
 Strand = Plus / Plus

                                                                           
Query: 140     aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
               |||||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 3054206 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 3054265

                                                                           
Query: 200     gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
               ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
Sbjct: 3054266 gcttggcgtggatggcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccg 3054325

                                                                  
Query: 260     cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
               |||||||||| ||||||| ||||||||||  ||||||||||||||||||||
Sbjct: 3054326 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtct 3054376



 Score =  244 bits (123), Expect = 1e-61
 Identities = 159/171 (92%)
 Strand = Plus / Plus

                                                                           
Query: 140     aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
               |||||||||| ||| |||| ||||| |||||||||||||||||||||||||| | ||| |
Sbjct: 3045559 aggcgcgctcaccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgc 3045618

                                                                           
Query: 200     gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
               ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 3045619 gcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcgg 3045678

                                                                  
Query: 260     cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
               |||||||||| ||||||| ||||||||||  ||||||||||||||||||||
Sbjct: 3045679 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtct 3045729



 Score =  234 bits (118), Expect = 1e-58
 Identities = 160/174 (91%)
 Strand = Plus / Plus

                                                                           
Query: 137     cctaggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcga 196
               |||| |||||||| ||| |||| ||||| |||||||||||||||||||||||||| | ||
Sbjct: 3039526 cctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtga 3039585

                                                                           
Query: 197     cccgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcct 256
               | ||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||
Sbjct: 3039586 cgcgcttggcgtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcct 3039645

                                                                     
Query: 257     cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
               ||||||||||||| ||||||| ||||||||||  ||||||||||||||||||||
Sbjct: 3039646 cggcggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtct 3039699



 Score =  226 bits (114), Expect = 3e-56
 Identities = 159/174 (91%)
 Strand = Plus / Minus

                                                                           
Query: 137     cctaggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcga 196
               |||| |||||||| ||| |||| ||||| |||||||||||||||||||||||||| | ||
Sbjct: 3055574 cctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtga 3055515

                                                                           
Query: 197     cccgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcct 256
               | |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 3055514 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcct 3055455

                                                                     
Query: 257     cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
               | ||||||||||| || |||| ||||||||||  ||||||||||||||||||||
Sbjct: 3055454 ccgcggcctcctgcagggcggcgacggcggagctctggaagcggaggtcggtct 3055401



 Score =  200 bits (101), Expect = 2e-48
 Identities = 152/169 (89%)
 Strand = Plus / Plus

                                                                           
Query: 142     gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
               |||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||| |||
Sbjct: 1644700 gcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 1644759

                                                                           
Query: 202     ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
               ||||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 1644760 ttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcg 1644819

                                                                
Query: 262     gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
               ||||||||||| |||   || |||  |  ||||||||||||||||||||
Sbjct: 1644820 gcctcctggagggcgagcaccgcgtggctctggaagcggaggtcggtct 1644868



to top

>dbj|AP005828.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0702F05
          Length = 145018

 Score =  252 bits (127), Expect = 6e-64
 Identities = 160/171 (93%)
 Strand = Plus / Plus

                                                                          
Query: 140    aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
              |||||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 142155 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 142214

                                                                          
Query: 200    gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
              ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
Sbjct: 142215 gcttggcgtggatggcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccg 142274

                                                                 
Query: 260    cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
              |||||||||| ||||||| ||||||||||  ||||||||||||||||||||
Sbjct: 142275 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtct 142325



 Score =  244 bits (123), Expect = 1e-61
 Identities = 159/171 (92%)
 Strand = Plus / Plus

                                                                          
Query: 140    aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
              |||||||||| ||| |||| ||||| |||||||||||||||||||||||||| | ||| |
Sbjct: 133508 aggcgcgctcaccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgc 133567

                                                                          
Query: 200    gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
              ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 133568 gcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcgg 133627

                                                                 
Query: 260    cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
              |||||||||| ||||||| ||||||||||  ||||||||||||||||||||
Sbjct: 133628 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtct 133678



 Score =  234 bits (118), Expect = 1e-58
 Identities = 160/174 (91%)
 Strand = Plus / Plus

                                                                          
Query: 137    cctaggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcga 196
              |||| |||||||| ||| |||| ||||| |||||||||||||||||||||||||| | ||
Sbjct: 127475 cctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtga 127534

                                                                          
Query: 197    cccgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcct 256
              | ||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||
Sbjct: 127535 cgcgcttggcgtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcct 127594

                                                                    
Query: 257    cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
              ||||||||||||| ||||||| ||||||||||  ||||||||||||||||||||
Sbjct: 127595 cggcggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtct 127648



 Score =  226 bits (114), Expect = 3e-56
 Identities = 159/174 (91%)
 Strand = Plus / Minus

                                                                          
Query: 137    cctaggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcga 196
              |||| |||||||| ||| |||| ||||| |||||||||||||||||||||||||| | ||
Sbjct: 143523 cctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtga 143464

                                                                          
Query: 197    cccgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcct 256
              | |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 143463 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcct 143404

                                                                    
Query: 257    cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
              | ||||||||||| || |||| ||||||||||  ||||||||||||||||||||
Sbjct: 143403 ccgcggcctcctgcagggcggcgacggcggagctctggaagcggaggtcggtct 143350



to top

>dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
            clone:P0681F10
          Length = 170371

 Score =  252 bits (127), Expect = 6e-64
 Identities = 160/171 (93%)
 Strand = Plus / Plus

                                                                        
Query: 140  aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
            |||||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 8391 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 8450

                                                                        
Query: 200  gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
            ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
Sbjct: 8451 gcttggcgtggatggcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccg 8510

                                                               
Query: 260  cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
            |||||||||| ||||||| ||||||||||  ||||||||||||||||||||
Sbjct: 8511 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtct 8561



 Score =  226 bits (114), Expect = 3e-56
 Identities = 159/174 (91%)
 Strand = Plus / Minus

                                                                        
Query: 137  cctaggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcga 196
            |||| |||||||| ||| |||| ||||| |||||||||||||||||||||||||| | ||
Sbjct: 9759 cctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtga 9700

                                                                        
Query: 197  cccgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcct 256
            | |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 9699 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcct 9640

                                                                  
Query: 257  cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
            | ||||||||||| || |||| ||||||||||  ||||||||||||||||||||
Sbjct: 9639 ccgcggcctcctgcagggcggcgacggcggagctctggaagcggaggtcggtct 9586



to top

>gb|BT017805.1| Zea mays clone EL01N0506E02.c mRNA sequence
          Length = 638

 Score =  250 bits (126), Expect = 2e-63
 Identities = 162/174 (93%)
 Strand = Plus / Minus

                                                                       
Query: 137 cctaggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcga 196
           |||| |||||||||||| ||||||||||||||||||| ||||||||||||||||| | ||
Sbjct: 354 cctaagcgcgctccccgcggatgcggcgggcgagctgaatgtccttgggcatgatggtga 295

                                                                       
Query: 197 cccgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcct 256
           | |||||||||||||||||||| |||||||||||||||||||| ||||||||||| ||||
Sbjct: 294 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcct 235

                                                                 
Query: 257 cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           | ||||||||||| ||||||| ||||||||||||||||||||||||||||||||
Sbjct: 234 ccgcggcctcctgcagcgcggcgacggcggaggactggaagcggaggtcggtct 181



to top

>ref|NM_185609.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 432

 Score =  244 bits (123), Expect = 1e-61
 Identities = 159/171 (92%)
 Strand = Plus / Minus

                                                                       
Query: 140 aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
           |||||||||| ||| |||| ||||| |||||||||||||||||||||||||| | ||| |
Sbjct: 430 aggcgcgctcaccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgc 371

                                                                       
Query: 200 gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
           ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 370 gcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcgg 311

                                                              
Query: 260 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||||| ||||||| ||||||||||  ||||||||||||||||||||
Sbjct: 310 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtct 260



to top

>emb|X13679.1|OSHIS3PS Oryza sativa H3 histone pseudogene H3R-12
          Length = 1920

 Score =  244 bits (123), Expect = 1e-61
 Identities = 159/171 (92%)
 Strand = Plus / Minus

                                                                        
Query: 140  aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
            |||||||||| ||| |||| ||||| |||||||||||||||||||||||||| | ||| |
Sbjct: 1529 aggcgcgctcaccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgc 1470

                                                                        
Query: 200  gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
            ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 1469 gcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcgg 1410

                                                               
Query: 260  cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
            |||||||||| ||||||| ||||||||||  ||||||||||||||||||||
Sbjct: 1409 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtct 1359



to top

>gb|AC134048.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0076K20,
              complete sequence
          Length = 127338

 Score =  240 bits (121), Expect = 2e-60
 Identities = 157/169 (92%)
 Strand = Plus / Minus

                                                                          
Query: 142    gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
              |||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||| |||
Sbjct: 118174 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 118115

                                                                          
Query: 202    ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
              ||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 118114 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 118055

                                                               
Query: 262    gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
              |||||||||||||||| ||||||||||  |||||| |||||||| ||||
Sbjct: 118054 gcctcctggagcgcggcgacggcggagctctggaaccggaggtccgtct 118006



to top

>gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0030I09 map C83B, complete sequence
          Length = 123477

 Score =  240 bits (121), Expect = 2e-60
 Identities = 157/169 (92%)
 Strand = Plus / Minus

                                                                         
Query: 142   gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
             |||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||| |||
Sbjct: 13780 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 13721

                                                                         
Query: 202   ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
             ||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 13720 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 13661

                                                              
Query: 262   gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             |||||||||||||||| ||||||||||  |||||| |||||||| ||||
Sbjct: 13660 gcctcctggagcgcggcgacggcggagctctggaaccggaggtccgtct 13612



to top

>emb|X13680.1|OSHIS321 Oryza sativa H3 histone H3R-21 clone RH3-2
          Length = 1200

 Score =  240 bits (121), Expect = 2e-60
 Identities = 157/169 (92%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||| |||
Sbjct: 807 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 748

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 747 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 688

                                                            
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||||||||||| ||||||||||  |||||| |||||||| ||||
Sbjct: 687 gcctcctggagcgcggcgacggcggagctctggaaccggaggtccgtct 639



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  240 bits (121), Expect = 2e-60
 Identities = 157/169 (92%)
 Strand = Plus / Plus

                                                                           
Query: 142     gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
               |||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||| |||
Sbjct: 2608624 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 2608683

                                                                           
Query: 202     ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
               ||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 2608684 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 2608743

                                                                
Query: 262     gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
               |||||||||||||||| ||||||||||  |||||| |||||||| ||||
Sbjct: 2608744 gcctcctggagcgcggcgacggcggagctctggaaccggaggtccgtct 2608792



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  240 bits (121), Expect = 2e-60
 Identities = 157/169 (92%)
 Strand = Plus / Plus

                                                                           
Query: 142     gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
               |||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||| |||
Sbjct: 2617655 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 2617714

                                                                           
Query: 202     ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
               ||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 2617715 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 2617774

                                                                
Query: 262     gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
               |||||||||||||||| ||||||||||  |||||| |||||||| ||||
Sbjct: 2617775 gcctcctggagcgcggcgacggcggagctctggaaccggaggtccgtct 2617823



to top

>gb|U77296.1|OSU77296 Oryza sativa histone 3 mRNA, complete cds
          Length = 642

 Score =  240 bits (121), Expect = 2e-60
 Identities = 157/169 (92%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||| |||
Sbjct: 478 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 419

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 418 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 359

                                                            
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||||||||||| ||||||||||  |||||| |||||||| ||||
Sbjct: 358 gcctcctggagcgcggcgacggcggagctctggaaccggaggtccgtct 310



to top

>ref|XM_475315.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  238 bits (120), Expect = 9e-60
 Identities = 147/156 (94%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 394 ggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatgg 335

                                                                       
Query: 215 cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
           |||| |||||||||||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 334 cgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgcagcg 275

                                               
Query: 275 cggagacggcggaggactggaagcggaggtcggtct 310
           ||| ||||||||||  ||||||||||||||||||||
Sbjct: 274 cggcgacggcggagctctggaagcggaggtcggtct 239



to top

>gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0042J17, complete sequence
          Length = 124139

 Score =  238 bits (120), Expect = 9e-60
 Identities = 147/156 (94%)
 Strand = Plus / Plus

                                                                         
Query: 155   ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
             ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 72778 ggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatgg 72837

                                                                         
Query: 215   cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
             |||| |||||||||||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 72838 cgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgcagcg 72897

                                                 
Query: 275   cggagacggcggaggactggaagcggaggtcggtct 310
             ||| ||||||||||  ||||||||||||||||||||
Sbjct: 72898 cggcgacggcggagctctggaagcggaggtcggtct 72933



to top

>emb|X00937.1|TAHI02 Wheat histone H3 gene
          Length = 811

 Score =  238 bits (120), Expect = 9e-60
 Identities = 147/156 (94%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 641 ggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatgg 582

                                                                       
Query: 215 cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
           |||| |||||||||||||||||||| || |||||||| ||||||||||||||||| || |
Sbjct: 581 cgcagaggttggtgtcctcgaagaggcccacgaggtaggcctcggcggcctcctgcaggg 522

                                               
Query: 275 cggagacggcggaggactggaagcggaggtcggtct 310
           ||||||||||||||||||||||||||||||||||||
Sbjct: 521 cggagacggcggaggactggaagcggaggtcggtct 486



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  238 bits (120), Expect = 9e-60
 Identities = 147/156 (94%)
 Strand = Plus / Plus

                                                                            
Query: 155      ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
                ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 21355456 ggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatgg 21355515

                                                                            
Query: 215      cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
                |||| |||||||||||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 21355516 cgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgcagcg 21355575

                                                    
Query: 275      cggagacggcggaggactggaagcggaggtcggtct 310
                ||| ||||||||||  ||||||||||||||||||||
Sbjct: 21355576 cggcgacggcggagctctggaagcggaggtcggtct 21355611



 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 267      ctggagcgcggagacggcggaggac 291
                ||||||||||| |||||||||||||
Sbjct: 22239243 ctggagcgcggtgacggcggaggac 22239267



to top

>dbj|AK120955.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023039F20, full
           insert sequence
          Length = 735

 Score =  238 bits (120), Expect = 9e-60
 Identities = 147/156 (94%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 479 ggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatgg 420

                                                                       
Query: 215 cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
           |||| |||||||||||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 419 cgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgcagcg 360

                                               
Query: 275 cggagacggcggaggactggaagcggaggtcggtct 310
           ||| ||||||||||  ||||||||||||||||||||
Sbjct: 359 cggcgacggcggagctctggaagcggaggtcggtct 324



to top

>emb|X13678.1|OSHIS311 Oryza sativa H3 histone gene H3R-11
          Length = 1200

 Score =  234 bits (118), Expect = 1e-58
 Identities = 160/174 (91%)
 Strand = Plus / Minus

                                                                       
Query: 137 cctaggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcga 196
           |||| |||||||| ||| |||| ||||| |||||||||||||||||||||||||| | ||
Sbjct: 812 cctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtga 753

                                                                       
Query: 197 cccgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcct 256
           | ||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||
Sbjct: 752 cgcgcttggcgtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcct 693

                                                                 
Query: 257 cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||||||||||| ||||||| ||||||||||  ||||||||||||||||||||
Sbjct: 692 cggcggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtct 639



to top

>ref|NM_185607.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  232 bits (117), Expect = 5e-58
 Identities = 156/169 (92%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||| ||| |||| ||||| |||||||||||||||||||||||||| | ||| |||
Sbjct: 407 gcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 347 ttggcgtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcg 288

                                                            
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||| ||||||| ||||||||||  ||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtct 239



to top

>ref|NM_190750.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  230 bits (116), Expect = 2e-57
 Identities = 146/156 (93%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 394 ggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatgg 335

                                                                       
Query: 215 cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
           |||| |||||||||||||||||||||||||||||||| |||||||| |||||||| ||||
Sbjct: 334 cgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggccgcctcctgcagcg 275

                                               
Query: 275 cggagacggcggaggactggaagcggaggtcggtct 310
           ||| ||||||||||  ||||||||||||||||||||
Sbjct: 274 cggcgacggcggagctctggaagcggaggtcggtct 239



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  230 bits (116), Expect = 2e-57
 Identities = 146/156 (93%)
 Strand = Plus / Minus

                                                                            
Query: 155      ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
                ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 37507549 ggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatgg 37507490

                                                                            
Query: 215      cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
                |||| |||||||||||||||||||||||||||||||| |||||||| |||||||| ||||
Sbjct: 37507489 cgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggccgcctcctgcagcg 37507430

                                                    
Query: 275      cggagacggcggaggactggaagcggaggtcggtct 310
                ||| ||||||||||  ||||||||||||||||||||
Sbjct: 37507429 cggcgacggcggagctctggaagcggaggtcggtct 37507394



to top

>dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0505D12
          Length = 146951

 Score =  230 bits (116), Expect = 2e-57
 Identities = 146/156 (93%)
 Strand = Plus / Minus

                                                                          
Query: 155    ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
              ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 102086 ggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatgg 102027

                                                                          
Query: 215    cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
              |||| |||||||||||||||||||||||||||||||| |||||||| |||||||| ||||
Sbjct: 102026 cgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggccgcctcctgcagcg 101967

                                                  
Query: 275    cggagacggcggaggactggaagcggaggtcggtct 310
              ||| ||||||||||  ||||||||||||||||||||
Sbjct: 101966 cggcgacggcggagctctggaagcggaggtcggtct 101931



to top

>dbj|AK108078.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-138-E03, full
           insert sequence
          Length = 1296

 Score =  230 bits (116), Expect = 2e-57
 Identities = 146/156 (93%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 472 ggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatgg 413

                                                                       
Query: 215 cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
           |||| |||||||||||||||||||||||||||||||| |||||||| |||||||| ||||
Sbjct: 412 cgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggccgcctcctgcagcg 353

                                               
Query: 275 cggagacggcggaggactggaagcggaggtcggtct 310
           ||| ||||||||||  ||||||||||||||||||||
Sbjct: 352 cggcgacggcggagctctggaagcggaggtcggtct 317



to top

>gb|M34928.1|BLYHISH3PA Barley histone H3 mRNA, 3' end
          Length = 505

 Score =  230 bits (116), Expect = 2e-57
 Identities = 158/172 (91%)
 Strand = Plus / Minus

                                                                       
Query: 139 taggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacc 198
           ||||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||| 
Sbjct: 242 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 183

                                                                       
Query: 199 cgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcg 258
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 182 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcg 123

                                                               
Query: 259 gcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||||||||| ||    ||||||  ||||||||| | |||||||||||
Sbjct: 122 gcggcctcctggagggccagcacggcgtgggactggaacctgaggtcggtct 71



to top

>gb|U25664.1|OSU25664 Oryza sativa histone H3 gene, complete cds
          Length = 711

 Score =  228 bits (115), Expect = 8e-57
 Identities = 157/171 (91%)
 Strand = Plus / Minus

                                                                       
Query: 140 aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
           |||||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 639 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 580

                                                                       
Query: 200 gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
           ||||||||||||||||||||||||| |||||||||||||||||||||||||||  ||| |
Sbjct: 579 gcttggcgtggatggcgcacaggttagtgtcctcgaagagcccgacgaggtaccgctccg 520

                                                              
Query: 260 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||||| ||||||  ||||||||| | ||||||||||||||||||||
Sbjct: 519 cggcctcctgcagcgcgcggacggcggacgtctggaagcggaggtcggtct 469



to top

>gb|M35388.1|MZEHISH3A Zea mays histone H3 gene, complete cds
          Length = 411

 Score =  228 bits (115), Expect = 8e-57
 Identities = 145/155 (93%)
 Strand = Plus / Minus

                                                                       
Query: 156 gatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggc 215
           ||||||||| |||||||||||||||||||||||||| | ||| |||||||||||||||||
Sbjct: 393 gatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 334

                                                                       
Query: 216 gcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgc 275
           ||| ||||||||||||||||||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 333 gcagaggttggtgtcctcgaagagccccacgaggtaggcctcggcggcctcctgcagcgc 274

                                              
Query: 276 ggagacggcggaggactggaagcggaggtcggtct 310
           || ||| ||||||||||||||||||||||||||||
Sbjct: 273 ggcgacagcggaggactggaagcggaggtcggtct 239



to top

>gb|M15664.1|RICHIS3 Rice histone 3 gene, complete cds
          Length = 568

 Score =  228 bits (115), Expect = 8e-57
 Identities = 157/171 (91%)
 Strand = Plus / Minus

                                                                       
Query: 140 aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
           |||||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 546 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 487

                                                                       
Query: 200 gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
           ||||||||||||||||||||||||| |||||||||||||||||||||||||||  ||| |
Sbjct: 486 gcttggcgtggatggcgcacaggttagtgtcctcgaagagcccgacgaggtaccgctccg 427

                                                              
Query: 260 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||||| ||||||  ||||||||| | ||||||||||||||||||||
Sbjct: 426 cggcctcctgcagcgcgcggacggcggacgtctggaagcggaggtcggtct 376



to top

>gb|M13378.1|MZEH3C2 Maize (Zea mays) histone H3 gene (H3C2), complete cds
          Length = 1001

 Score =  228 bits (115), Expect = 8e-57
 Identities = 145/155 (93%)
 Strand = Plus / Minus

                                                                       
Query: 156 gatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggc 215
           ||||||||| |||||||||||||||||||||||||| | ||| |||||||||||||||||
Sbjct: 814 gatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 755

                                                                       
Query: 216 gcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgc 275
           ||| ||||||||||||||||||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 754 gcagaggttggtgtcctcgaagagccccacgaggtaggcctcggcggcctcctgcagcgc 695

                                              
Query: 276 ggagacggcggaggactggaagcggaggtcggtct 310
           || ||| ||||||||||||||||||||||||||||
Sbjct: 694 ggcgacagcggaggactggaagcggaggtcggtct 660



to top

>ref|NM_185613.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  224 bits (113), Expect = 1e-55
 Identities = 155/169 (91%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||| ||| |||| ||||| |||||||||||||||||||||||||| | ||| |||
Sbjct: 407 gcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcg 288

                                                            
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||| || |||| ||||||||||  ||||||||||||||||||||
Sbjct: 287 gcctcctgcagggcggcgacggcggagctctggaagcggaggtcggtct 239



to top

>ref|XM_472456.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  220 bits (111), Expect = 2e-54
 Identities = 144/155 (92%)
 Strand = Plus / Minus

                                                                       
Query: 156 gatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggc 215
           |||||||||||||||||||||||||||||||||||| | ||| |||||||||||||||||
Sbjct: 393 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 334

                                                                       
Query: 216 gcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgc 275
           ||| |||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||
Sbjct: 333 gcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcggcctcctgcagcgc 274

                                              
Query: 276 ggagacggcggaggactggaagcggaggtcggtct 310
           || ||||||||| |||||||| |||||||| ||||
Sbjct: 273 ggcgacggcggacgactggaaccggaggtccgtct 239



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  220 bits (111), Expect = 2e-54
 Identities = 144/155 (92%)
 Strand = Plus / Minus

                                                                            
Query: 156      gatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggc 215
                |||||||||||||||||||||||||||||||||||| | ||| |||||||||||||||||
Sbjct: 20749045 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 20748986

                                                                            
Query: 216      gcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgc 275
                ||| |||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||
Sbjct: 20748985 gcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcggcctcctgcagcgc 20748926

                                                   
Query: 276      ggagacggcggaggactggaagcggaggtcggtct 310
                || ||||||||| |||||||| |||||||| ||||
Sbjct: 20748925 ggcgacggcggacgactggaaccggaggtccgtct 20748891



 Score =  113 bits (57), Expect = 3e-22
 Identities = 90/101 (89%)
 Strand = Plus / Minus

                                                                            
Query: 169      agctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtg 228
                ||||| ||||||||||||||||| |  || |||||||| |||||||||||||||||||||
Sbjct: 22438361 agctgaatgtccttgggcatgatggtcacacgcttggcatggatggcgcacaggttggtg 22438302

                                                         
Query: 229      tcctcgaagagcccgacgaggtacgcctcggcggcctcctg 269
                ||||||||||| || || |||||||||||||| || |||||
Sbjct: 22438301 tcctcgaagagacccaccaggtacgcctcggcagcttcctg 22438261



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 249      gtacgcctcggcggcctcct 268
                ||||||||||||||||||||
Sbjct: 25160884 gtacgcctcggcggcctcct 25160865



to top

>emb|AL606618.4|OSJN00062 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0108J11,
             complete sequence
          Length = 124629

 Score =  220 bits (111), Expect = 2e-54
 Identities = 144/155 (92%)
 Strand = Plus / Minus

                                                                         
Query: 156   gatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggc 215
             |||||||||||||||||||||||||||||||||||| | ||| |||||||||||||||||
Sbjct: 95196 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 95137

                                                                         
Query: 216   gcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgc 275
             ||| |||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||
Sbjct: 95136 gcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcggcctcctgcagcgc 95077

                                                
Query: 276   ggagacggcggaggactggaagcggaggtcggtct 310
             || ||||||||| |||||||| |||||||| ||||
Sbjct: 95076 ggcgacggcggacgactggaaccggaggtccgtct 95042



to top

>emb|X79714.1|LTMRHIS3 L.temulentum mRNA for histone H3
          Length = 657

 Score =  216 bits (109), Expect = 3e-53
 Identities = 130/137 (94%)
 Strand = Plus / Minus

                                                                       
Query: 139 taggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacc 198
           ||||||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||| 
Sbjct: 461 taggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 402

                                                                       
Query: 199 cgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcg 258
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 401 cgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtaggcctcg 342

                            
Query: 259 gcggcctcctggagcgc 275
           || ||||||||||||||
Sbjct: 341 gccgcctcctggagcgc 325



to top

>gb|BT018930.1| Zea mays clone Contig60.F mRNA sequence
          Length = 887

 Score =  214 bits (108), Expect = 1e-52
 Identities = 144/156 (92%)
 Strand = Plus / Plus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 239 ggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatgg 298

                                                                       
Query: 215 cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
           |||| |||||||||||||||||||| || |||||||| ||||||||||||||||| ||||
Sbjct: 299 cgcagaggttggtgtcctcgaagaggcccacgaggtaggcctcggcggcctcctgcagcg 358

                                               
Query: 275 cggagacggcggaggactggaagcggaggtcggtct 310
           |||  ||||||||||||||||| |||||||| ||||
Sbjct: 359 cggccacggcggaggactggaaccggaggtccgtct 394



to top

>emb|X84377.1|ZMHIS3DNA Z.mays histone H3 gene
          Length = 1119

 Score =  214 bits (108), Expect = 1e-52
 Identities = 144/156 (92%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 778 ggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatgg 719

                                                                       
Query: 215 cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
           |||| |||||||||||||||||||| || |||||||| ||||||||||||||||| ||||
Sbjct: 718 cgcagaggttggtgtcctcgaagaggcccacgaggtaggcctcggcggcctcctgcagcg 659

                                               
Query: 275 cggagacggcggaggactggaagcggaggtcggtct 310
           |||  ||||||||||||||||| |||||||| ||||
Sbjct: 658 cggccacggcggaggactggaaccggaggtccgtct 623



to top

>gb|BT018179.1| Zea mays clone EL01N0557G06.c mRNA sequence
          Length = 716

 Score =  212 bits (107), Expect = 5e-52
 Identities = 143/155 (92%)
 Strand = Plus / Minus

                                                                       
Query: 156 gatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggc 215
           ||||||||| |||||||||||||||||||||||||| | ||| |||||||||||||||||
Sbjct: 453 gatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 394

                                                                       
Query: 216 gcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgc 275
           ||||||| | |||||||| |||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 393 gcacagggtagtgtcctcaaagagccccacgaggtaggcctcggcggcctcctgcagcgc 334

                                              
Query: 276 ggagacggcggaggactggaagcggaggtcggtct 310
            |||||||||||||||||||||||||| |||||||
Sbjct: 333 agagacggcggaggactggaagcggagatcggtct 299



to top

>dbj|AB205017.1| Lolium multiflorum gene for replacement histone H3, exon 1-2,
           complete cds
          Length = 784

 Score =  204 bits (103), Expect = 1e-49
 Identities = 130/139 (93%)
 Strand = Plus / Minus

                                                                       
Query: 137 cctaggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcga 196
           ||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||
Sbjct: 576 cctaggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 517

                                                                       
Query: 197 cccgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcct 256
           | |||||||||||||||||||| |||||||||||||||||||| ||||||||||| ||||
Sbjct: 516 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcct 457

                              
Query: 257 cggcggcctcctggagcgc 275
           |||| ||||||||||||||
Sbjct: 456 cggccgcctcctggagcgc 438



to top

>ref|XM_493701.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 411

 Score =  200 bits (101), Expect = 2e-48
 Identities = 152/169 (89%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||| |||
Sbjct: 407 gcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcg 288

                                                            
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||||||||| |||   || |||  |  ||||||||||||||||||||
Sbjct: 287 gcctcctggagggcgagcaccgcgtggctctggaagcggaggtcggtct 239



to top

>dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
             clone:P0493C11
          Length = 143113

 Score =  200 bits (101), Expect = 2e-48
 Identities = 152/169 (89%)
 Strand = Plus / Plus

                                                                         
Query: 142   gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
             |||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||| |||
Sbjct: 47871 gcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 47930

                                                                         
Query: 202   ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
             ||||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 47931 ttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcg 47990

                                                              
Query: 262   gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             ||||||||||| |||   || |||  |  ||||||||||||||||||||
Sbjct: 47991 gcctcctggagggcgagcaccgcgtggctctggaagcggaggtcggtct 48039



to top

>gb|AF093633.1|AF093633 Oryza sativa histone H3 mRNA, complete cds
          Length = 793

 Score =  200 bits (101), Expect = 2e-48
 Identities = 152/169 (89%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||| |||
Sbjct: 495 gcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 436

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 435 ttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcg 376

                                                            
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||||||||| |||   || |||  |  ||||||||||||||||||||
Sbjct: 375 gcctcctggagggcgagcaccgcgtggctctggaagcggaggtcggtct 327



to top

>ref|XM_425464.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
           (LOC427890), mRNA
          Length = 600

 Score =  196 bits (99), Expect = 3e-47
 Identities = 153/171 (89%)
 Strand = Plus / Minus

                                                                       
Query: 140 aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
           |||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 598 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 539

                                                                       
Query: 200 gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
           ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 538 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 479

                                                              
Query: 260 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             |||||||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 478 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 428



to top

>ref|XM_416198.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417958),
           mRNA
          Length = 1512

 Score =  196 bits (99), Expect = 3e-47
 Identities = 153/171 (89%)
 Strand = Plus / Plus

                                                                       
Query: 140 aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
           |||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 570 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 629

                                                                       
Query: 200 gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
           ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 630 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 689

                                                              
Query: 260 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             |||||||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 690 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 740



to top

>ref|XM_416190.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417949),
           mRNA
          Length = 752

 Score =  196 bits (99), Expect = 3e-47
 Identities = 153/171 (89%)
 Strand = Plus / Plus

                                                                       
Query: 140 aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
           |||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 315 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 374

                                                                       
Query: 200 gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
           ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 375 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 434

                                                              
Query: 260 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             |||||||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 435 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 485



to top

>ref|XM_416186.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417945),
           mRNA
          Length = 972

 Score =  196 bits (99), Expect = 3e-47
 Identities = 153/171 (89%)
 Strand = Plus / Plus

                                                                       
Query: 140 aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
           |||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 378 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 437

                                                                       
Query: 200 gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
           ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 438 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 497

                                                              
Query: 260 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             |||||||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 498 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 548



to top

>gb|U37579.1|GGU37579 Gallus gallus histone H3-VIII gene, complete cds
          Length = 1809

 Score =  196 bits (99), Expect = 3e-47
 Identities = 153/171 (89%)
 Strand = Plus / Minus

                                                                       
Query: 140 aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
           |||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 880 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 821

                                                                       
Query: 200 gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
           ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 820 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 761

                                                              
Query: 260 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             |||||||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 760 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 710



to top

>gb|U37578.1|GGU37578 Gallus gallus histone H3-VII gene, complete cds
          Length = 1204

 Score =  196 bits (99), Expect = 3e-47
 Identities = 153/171 (89%)
 Strand = Plus / Minus

                                                                       
Query: 140 aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
           |||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 897 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 838

                                                                       
Query: 200 gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
           ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 837 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 778

                                                              
Query: 260 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             |||||||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 777 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 727



to top

>gb|U37577.1|GGU37577 Gallus gallus histone H3-VI gene, complete cds
          Length = 1271

 Score =  196 bits (99), Expect = 3e-47
 Identities = 153/171 (89%)
 Strand = Plus / Minus

                                                                       
Query: 140 aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
           |||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 693 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 634

                                                                       
Query: 200 gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
           ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 633 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 574

                                                              
Query: 260 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             |||||||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 573 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 523



to top

>emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes
          Length = 4717

 Score =  188 bits (95), Expect = 7e-45
 Identities = 152/171 (88%)
 Strand = Plus / Minus

                                                                        
Query: 140  aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
            |||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 3244 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 3185

                                                                        
Query: 200  gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
            ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 3184 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 3125

                                                               
Query: 260  cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
              |||||||| |||||    ||||| |||  ||||||||| ||||||||||
Sbjct: 3124 tcgcctcctgcagcgccatcacggccgagctctggaagcgcaggtcggtct 3074



 Score =  188 bits (95), Expect = 7e-45
 Identities = 152/171 (88%)
 Strand = Plus / Plus

                                                                        
Query: 140  aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
            |||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 1477 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 1536

                                                                        
Query: 200  gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
            ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 1537 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 1596

                                                               
Query: 260  cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
              |||||||| |||||    ||||| |||  ||||||||| ||||||||||
Sbjct: 1597 tcgcctcctgcagcgccatcacggccgagctctggaagcgcaggtcggtct 1647



to top

>emb|CR390239.1| Gallus gallus finished cDNA, clone ChEST932d15
          Length = 578

 Score =  188 bits (95), Expect = 7e-45
 Identities = 152/171 (88%)
 Strand = Plus / Plus

                                                                       
Query: 140 aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
           |||| ||||||||| ||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 134 aggcacgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 193

                                                                       
Query: 200 gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
           ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 194 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 253

                                                              
Query: 260 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             |||||||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 254 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 304



to top

>emb|X62291.1|GGHISH3IV G.gallus gene for histone H3-IV
          Length = 1094

 Score =  188 bits (95), Expect = 7e-45
 Identities = 152/171 (88%)
 Strand = Plus / Minus

                                                                       
Query: 140 aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
           |||| ||||||||| ||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 823 aggcacgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 764

                                                                       
Query: 200 gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
           ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 763 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 704

                                                              
Query: 260 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             |||||||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 703 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 653



to top

>emb|X62292.1|GGHISH3V G.gallus gene for histone H3-V
          Length = 1107

 Score =  188 bits (95), Expect = 7e-45
 Identities = 152/171 (88%)
 Strand = Plus / Minus

                                                                       
Query: 140 aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
           |||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 823 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 764

                                                                       
Query: 200 gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
           ||||||| ||||||||||||||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 763 gcttggcatggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 704

                                                              
Query: 260 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             |||||||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 703 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 653



to top

>gb|AF140033.1|AF140033 Phreatamoeba balamuthi histone H3 mRNA, complete cds
          Length = 626

 Score =  188 bits (95), Expect = 7e-45
 Identities = 128/139 (92%)
 Strand = Plus / Minus

                                                                       
Query: 137 cctaggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcga 196
           ||||||||||||| ||  ||||||||||||| ||||||||||||||||||||||| |  |
Sbjct: 423 cctaggcgcgctcgccacggatgcggcgggccagctggatgtccttgggcatgatcgtca 364

                                                                       
Query: 197 cccgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcct 256
           | |||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||
Sbjct: 363 cacgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtaggcct 304

                              
Query: 257 cggcggcctcctggagcgc 275
           ||||||||||||| |||||
Sbjct: 303 cggcggcctcctgcagcgc 285



to top

>emb|Y08528.1|OSHISTON3 Oryza sativa mRNA for histone 3
          Length = 529

 Score =  188 bits (95), Expect = 7e-45
 Identities = 146/164 (89%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||| |||
Sbjct: 479 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggagacgcgc 420

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||| |||||||| || |||||||||| |||||||||  | ||||||
Sbjct: 419 ttggcgtggatggcgcagaggttggtntcntcgaagagccngacgaggtagccttcggcg 360

                                                       
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcggaggtc 305
           || || |||||||||| ||||||||||  |||||| ||||||||
Sbjct: 359 gcttcttggagcgcggcgacggcggagctctggaaccggaggtc 316



to top

>gb|M61155.1|CHKH3AB Chicken histone H3 gene, complete cds
          Length = 1017

 Score =  188 bits (95), Expect = 7e-45
 Identities = 152/171 (88%)
 Strand = Plus / Minus

                                                                       
Query: 140 aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
           |||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 569 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 510

                                                                       
Query: 200 gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
           |||||||||| |||||||||||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 509 gcttggcgtgcatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 450

                                                              
Query: 260 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             |||||||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 449 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 399



to top

>gb|M61154.1|CHKH3AA Chicken histone H3 gene, complete cds
          Length = 784

 Score =  188 bits (95), Expect = 7e-45
 Identities = 152/171 (88%)
 Strand = Plus / Minus

                                                                       
Query: 140 aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
           |||| ||||||||| ||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 762 aggcacgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 703

                                                                       
Query: 200 gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
           ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 702 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 643

                                                              
Query: 260 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             |||||||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 642 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 592



to top

>gb|M13379.1|MZEH3C4 Maize (Zea mays) histone H3 gene (H3C4), complete cds
          Length = 1264

 Score =  188 bits (95), Expect = 7e-45
 Identities = 140/155 (90%)
 Strand = Plus / Minus

                                                                       
Query: 156 gatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggc 215
           ||||||||| |||||||| ||||||||||||||||| | ||| |||||||||||||||||
Sbjct: 918 gatgcggcgcgcgagctgaatgtccttgggcatgatggtgacgcgcttggcgtggatggc 859

                                                                       
Query: 216 gcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgc 275
           ||| ||||| |||||||| |||||||| || ||||| ||||||||||||||||| |||||
Sbjct: 858 gcagaggttagtgtcctcaaagagccccacaaggtaggcctcggcggcctcctgcagcgc 799

                                              
Query: 276 ggagacggcggaggactggaagcggaggtcggtct 310
            | |||||||||||||||||||||||| |||||||
Sbjct: 798 agcgacggcggaggactggaagcggagatcggtct 764



to top

>gb|BT018950.1| Zea mays clone Contig110.F mRNA sequence
          Length = 636

 Score =  186 bits (94), Expect = 3e-44
 Identities = 124/134 (92%)
 Strand = Plus / Plus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||| ||  ||||||||||||||||||||||||||||||||||||| | ||| |||
Sbjct: 137 gcgcgctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 196

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           || |||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 197 ttagcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcg 256

                         
Query: 262 gcctcctggagcgc 275
           ||||||||||||||
Sbjct: 257 gcctcctggagcgc 270



to top

>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
            (LOC417953), mRNA
          Length = 2271

 Score =  182 bits (92), Expect = 4e-43
 Identities = 146/164 (89%)
 Strand = Plus / Minus

                                                                        
Query: 147  ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
            ||||||| ||||||||||||||||||||||||||||||||||||| | ||| ||||||||
Sbjct: 2262 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 2203

                                                                        
Query: 207  gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
            |||||||||||||||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 2202 gtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctc 2143

                                                        
Query: 267  ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
            ||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 2142 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 2099



to top

>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene
          Length = 8384

 Score =  182 bits (92), Expect = 4e-43
 Identities = 146/164 (89%)
 Strand = Plus / Plus

                                                                        
Query: 147  ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
            ||||||| ||||||||||||||||||||||||||||||||||||| | ||| ||||||||
Sbjct: 3353 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 3412

                                                                        
Query: 207  gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
            |||||||||||||||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 3413 gtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctc 3472

                                                        
Query: 267  ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
            ||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 3473 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 3516



to top

>ref|XM_845651.1| PREDICTED: Canis familiaris similar to CG31613-PA (LOC608586), mRNA
          Length = 411

 Score =  176 bits (89), Expect = 3e-41
 Identities = 152/173 (87%)
 Strand = Plus / Minus

                                                                       
Query: 138 ctaggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgac 197
           |||||||||||||||| |||||||||| || ||||||||||||||||||||||| | |||
Sbjct: 411 ctaggcgcgctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 198 ccgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctc 257
            |||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 292

                                                                
Query: 258 ggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |   |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 291 gctcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 239



to top

>gb|BT017332.1| Zea mays clone EL01N0320H03.c mRNA sequence
          Length = 639

 Score =  174 bits (88), Expect = 1e-40
 Identities = 124/136 (91%)
 Strand = Plus / Minus

                                                                       
Query: 137 cctaggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcga 196
           |||| |||||||| ||| ||||||||||||||||||||||||| ||||||||||| | ||
Sbjct: 411 cctacgcgcgctcgccgcggatgcggcgggcgagctggatgtctttgggcatgatggtga 352

                                                                       
Query: 197 cccgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcct 256
           | |||||||||||||||||||| ||||||||||||||||| || ||||||||||| ||||
Sbjct: 351 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaacaggccgacgaggtaggcct 292

                           
Query: 257 cggcggcctcctggag 272
           ||||||| ||||||||
Sbjct: 291 cggcggcttcctggag 276



to top

>gb|BT016934.1| Zea mays clone E04912703G10.c mRNA sequence
          Length = 663

 Score =  174 bits (88), Expect = 1e-40
 Identities = 112/120 (93%)
 Strand = Plus / Plus

                                                                       
Query: 156 gatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggc 215
           |||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||
Sbjct: 168 gatgcggcgggcgagctggatgtccttgggcatgatggtgaccctcttggcgtggatggc 227

                                                                       
Query: 216 gcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgc 275
           ||| ||||||||||||||||||||||| || ||||||||||| ||||||||||| |||||
Sbjct: 228 gcagaggttggtgtcctcgaagagccccaccaggtacgcctccgcggcctcctgcagcgc 287



to top

>gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, complete sequence
          Length = 211945

 Score =  168 bits (85), Expect = 7e-39
 Identities = 151/173 (87%)
 Strand = Plus / Plus

                                                                          
Query: 138    ctaggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgac 197
              |||||| ||||||||| ||||||||||||| ||||||||||| ||||||||||| | |||
Sbjct: 102348 ctaggctcgctccccgcggatgcggcgggccagctggatgtctttgggcatgatggtgac 102407

                                                                          
Query: 198    ccgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctc 257
              ||||||||||||||||||||||||||||||||||||||| || || || ||||| |||||
Sbjct: 102408 ccgcttggcgtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaagcctc 102467

                                                                   
Query: 258    ggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
              |  || |||||| || ||   ||||||||||  ||||||||| ||||||||||
Sbjct: 102468 gctggactcctgcagggccatgacggcggagctctggaagcgcaggtcggtct 102520



to top

>gb|AY181030.1| Toxoplasma gondii histone H3 mRNA, complete cds
          Length = 411

 Score =  167 bits (84), Expect = 3e-38
 Identities = 138/156 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           |||||||||| |||||||| ||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 394 ggatgcggcgagcgagctgaatgtccttgggcatgatggtgacacgcttggcgtggatgg 335

                                                                       
Query: 215 cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
           |||||| |||||||||||||||||||||||||||||| ||||| ||||| |||||||| |
Sbjct: 334 cgcacaagttggtgtcctcgaagagcccgacgaggtaagcctcagcggcttcctggagag 275

                                               
Query: 275 cggagacggcggaggactggaagcggaggtcggtct 310
           |   ||| ||||| |||||||| || || |||||||
Sbjct: 274 caaggacagcggacgactggaaacgcagatcggtct 239



to top

>ref|XM_540290.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform
           2 (LOC483172), mRNA
          Length = 525

 Score =  163 bits (82), Expect = 4e-37
 Identities = 145/166 (87%)
 Strand = Plus / Minus

                                                                       
Query: 145 cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
           ||||||||| |||||||||| || ||||||||||||||||||||||| | ||| ||||||
Sbjct: 518 cgctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttg 459

                                                                       
Query: 205 gcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 264
           |||||||||||||||||||||||||||||||||||||| || ||||| ||||||   |||
Sbjct: 458 gcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcc 399

                                                         
Query: 265 tcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 398 tcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 353



to top

>ref|XM_540285.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform
           2 (LOC483167), mRNA
          Length = 525

 Score =  163 bits (82), Expect = 4e-37
 Identities = 145/166 (87%)
 Strand = Plus / Minus

                                                                       
Query: 145 cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
           ||||||||| |||||||||| || ||||||||||||||||||||||| | ||| ||||||
Sbjct: 518 cgctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttg 459

                                                                       
Query: 205 gcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 264
           |||||||||||||||||||||||||||||||||||||| || ||||| ||||||   |||
Sbjct: 458 gcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcc 399

                                                         
Query: 265 tcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 398 tcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 353



to top

>gb|DQ393956.1| Cydia pomonella clone Cp4.140 microsatellite sequence
          Length = 517

 Score =  163 bits (82), Expect = 4e-37
 Identities = 127/142 (89%)
 Strand = Plus / Plus

                                                                       
Query: 169 agctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtg 228
           ||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||
Sbjct: 147 agctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacaggttggtg 206

                                                                       
Query: 229 tcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggag 288
           ||||||||||| ||||||||||| ||||||  |||||||||||| ||    |||||||||
Sbjct: 207 tcctcgaagagaccgacgaggtaagcctcgctggcctcctggagagccataacggcggag 266

                                 
Query: 289 gactggaagcggaggtcggtct 310
             ||||||||| ||||||||||
Sbjct: 267 ctctggaagcgcaggtcggtct 288



to top

>gb|DQ393939.1| Cydia pomonella clone Cp4.P microsatellite sequence
          Length = 517

 Score =  163 bits (82), Expect = 4e-37
 Identities = 127/142 (89%)
 Strand = Plus / Minus

                                                                       
Query: 169 agctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtg 228
           ||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||
Sbjct: 371 agctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacaggttggtg 312

                                                                       
Query: 229 tcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggag 288
           ||||||||||| ||||||||||| ||||||  |||||||||||| ||    |||||||||
Sbjct: 311 tcctcgaagagaccgacgaggtaagcctcgctggcctcctggagagccataacggcggag 252

                                 
Query: 289 gactggaagcggaggtcggtct 310
             ||||||||| ||||||||||
Sbjct: 251 ctctggaagcgcaggtcggtct 230



to top

>gb|DQ393935.1| Cydia pomonella clone Cp4.118 microsatellite sequence
          Length = 438

 Score =  163 bits (82), Expect = 4e-37
 Identities = 127/142 (89%)
 Strand = Plus / Plus

                                                                       
Query: 169 agctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtg 228
           ||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||
Sbjct: 68  agctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacaggttggtg 127

                                                                       
Query: 229 tcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggag 288
           ||||||||||| ||||||||||| ||||||  |||||||||||| ||    |||||||||
Sbjct: 128 tcctcgaagagaccgacgaggtaagcctcgctggcctcctggagagccataacggcggag 187

                                 
Query: 289 gactggaagcggaggtcggtct 310
             ||||||||| ||||||||||
Sbjct: 188 ctctggaagcgcaggtcggtct 209



to top

>gb|DQ393934.1| Cydia pomonella clone Cp4.100 microsatellite sequence
          Length = 490

 Score =  163 bits (82), Expect = 4e-37
 Identities = 127/142 (89%)
 Strand = Plus / Plus

                                                                       
Query: 169 agctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtg 228
           ||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||
Sbjct: 121 agctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacaggttggtg 180

                                                                       
Query: 229 tcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggag 288
           ||||||||||| ||||||||||| ||||||  |||||||||||| ||    |||||||||
Sbjct: 181 tcctcgaagagaccgacgaggtaagcctcgctggcctcctggagagccataacggcggag 240

                                 
Query: 289 gactggaagcggaggtcggtct 310
             ||||||||| ||||||||||
Sbjct: 241 ctctggaagcgcaggtcggtct 262



to top

>gb|U38422.1|TAU38422 Triticum aestivum histone H3 gene, partial cds, clone W1
          Length = 479

 Score =  163 bits (82), Expect = 4e-37
 Identities = 127/142 (89%)
 Strand = Plus / Minus

                                                                       
Query: 169 agctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtg 228
           ||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||
Sbjct: 479 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 420

                                                                       
Query: 229 tcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggag 288
           |||||||| ||||| || |||||||||||||| ||||||||||| ||    ||||||  |
Sbjct: 419 tcctcgaacagccccaccaggtacgcctcggccgcctcctggagggccagcacggcgtgg 360

                                 
Query: 289 gactggaagcggaggtcggtct 310
           ||||||||||||||||| ||||
Sbjct: 359 gactggaagcggaggtccgtct 338



to top

>ref|XM_849194.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611519), mRNA
          Length = 471

 Score =  159 bits (80), Expect = 6e-36
 Identities = 143/164 (87%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| |||||||||| || ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 462 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 403

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           |||||||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 402 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 343

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 342 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 299



to top

>ref|XM_545420.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488298), mRNA
          Length = 411

 Score =  159 bits (80), Expect = 6e-36
 Identities = 143/164 (87%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| |||||||||| || ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           |||||||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 239



to top

>ref|XM_545399.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488277), mRNA
          Length = 411

 Score =  159 bits (80), Expect = 6e-36
 Identities = 143/164 (87%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| |||||||||| || ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           |||||||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 239



to top

>ref|XM_545397.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488275), mRNA
          Length = 459

 Score =  159 bits (80), Expect = 6e-36
 Identities = 143/164 (87%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| |||||||||| || ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 450 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 391

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           |||||||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 390 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 331

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 330 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 287



to top

>ref|XM_848810.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611167), mRNA
          Length = 504

 Score =  159 bits (80), Expect = 6e-36
 Identities = 143/164 (87%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| |||||||||| || ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 495 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 436

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           |||||||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 435 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 376

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 375 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 332



to top

>ref|XM_848782.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611138), mRNA
          Length = 411

 Score =  159 bits (80), Expect = 6e-36
 Identities = 143/164 (87%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| |||||||||| || ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           |||||||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 239



to top

>ref|XM_545429.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488307), mRNA
          Length = 411

 Score =  159 bits (80), Expect = 6e-36
 Identities = 143/164 (87%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| |||||||||| || ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           |||||||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 239



to top

>ref|XM_545385.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488263), mRNA
          Length = 411

 Score =  159 bits (80), Expect = 6e-36
 Identities = 143/164 (87%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| |||||||||| || ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           |||||||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 239



to top

>ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 3 (LOC480760), mRNA
          Length = 862

 Score =  159 bits (80), Expect = 6e-36
 Identities = 143/164 (87%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| |||||||||| || ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           |||||||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 239



to top

>ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 1 (LOC480760), mRNA
          Length = 1422

 Score =  159 bits (80), Expect = 6e-36
 Identities = 143/164 (87%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| |||||||||| || ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           |||||||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtct 239



to top

>dbj|AB185026.1| Conocephalum conicum H3 gene for histone 3, complete cds, clone:
           T135
          Length = 473

 Score =  159 bits (80), Expect = 6e-36
 Identities = 137/156 (87%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||| ||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 456 ggatgcggcgggccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatgg 397

                                                                       
Query: 215 cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
           |||| |||||||||||||||||||| ||||| ||||| ||||| |  |||||||| || |
Sbjct: 396 cgcagaggttggtgtcctcgaagaggccgaccaggtaggcctcagacgcctcctgcaggg 337

                                               
Query: 275 cggagacggcggaggactggaagcggaggtcggtct 310
           |    ||||| |||||||||||||| ||||||||||
Sbjct: 336 ccagcacggccgaggactggaagcgcaggtcggtct 301



to top

>dbj|AB185023.1| Conocephalum conicum H3 gene for histone 3, complete cds, clone:
           T117
          Length = 474

 Score =  159 bits (80), Expect = 6e-36
 Identities = 137/156 (87%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||| ||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 457 ggatgcggcgggccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatgg 398

                                                                       
Query: 215 cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
           |||| |||||||||||||||||||| ||||| ||||| ||||| |  |||||||| || |
Sbjct: 397 cgcagaggttggtgtcctcgaagaggccgaccaggtaggcctcagacgcctcctgcaggg 338

                                               
Query: 275 cggagacggcggaggactggaagcggaggtcggtct 310
           |    ||||| |||||||||||||| ||||||||||
Sbjct: 337 ccagcacggccgaggactggaagcgcaggtcggtct 302



to top

>gb|U38423.1|TAU38423 Triticum aestivum histone H3 gene, partial cds, clone W2
          Length = 486

 Score =  159 bits (80), Expect = 6e-36
 Identities = 98/104 (94%)
 Strand = Plus / Minus

                                                                       
Query: 169 agctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtg 228
           ||||||||||||||||||||||| | ||| |||||||| |||||||||||  ||||||||
Sbjct: 486 agctggatgtccttgggcatgatggtgacgcgcttggcatggatggcgcaggggttggtg 427

                                                       
Query: 229 tcctcgaagagcccgacgaggtacgcctcggcggcctcctggag 272
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 426 tcctcgaagagcccgacgaggtacgcctcggcggcctcctggag 383



to top

>ref|XM_545428.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488306), mRNA
          Length = 411

 Score =  157 bits (79), Expect = 3e-35
 Identities = 142/163 (87%)
 Strand = Plus / Minus

                                                                       
Query: 148 tccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcg 207
           |||||| |||||||||| || ||||||||||||||||||||||| | ||| |||||||||
Sbjct: 401 tccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcg 342

                                                                       
Query: 208 tggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcc 267
           ||||||||||| ||||||||||||||||||||||| || ||||| ||||||   ||||||
Sbjct: 341 tggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctcc 282

                                                      
Query: 268 tggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           || |||||   |||||| |||  ||||||||| ||||||||||
Sbjct: 281 tgcagcgccatgacggccgagctctggaagcgcaggtcggtct 239



to top

>gb|DQ393931.1| Cydia pomonella clone Cp4.61 microsatellite sequence
          Length = 517

 Score =  155 bits (78), Expect = 1e-34
 Identities = 126/142 (88%)
 Strand = Plus / Minus

                                                                       
Query: 169 agctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtg 228
           ||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||
Sbjct: 370 agctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacaggttggtg 311

                                                                       
Query: 229 tcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggag 288
           ||||||||| | ||||||||||| ||||||  |||||||||||| ||    |||||||||
Sbjct: 310 tcctcgaagggaccgacgaggtaagcctcgctggcctcctggagagccataacggcggag 251

                                 
Query: 289 gactggaagcggaggtcggtct 310
             ||||||||| ||||||||||
Sbjct: 250 ctctggaagcgcaggtcggtct 229



to top

>gb|M14396.1|CIIHISH3A Duck H3.4 variant histone gene
          Length = 921

 Score =  155 bits (78), Expect = 1e-34
 Identities = 117/130 (90%)
 Strand = Plus / Minus

                                                                       
Query: 140 aggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgaccc 199
           |||||||||||||| |||||||||||| |||||||||||||||||||||||| | ||| |
Sbjct: 749 aggcgcgctccccgcggatgcggcgggtgagctggatgtccttgggcatgatggagacgc 690

                                                                       
Query: 200 gcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 259
           ||||||| ||||||||||| |||||||||||||| |||||||| || ||||| |||||| 
Sbjct: 689 gcttggcatggatggcgcagaggttggtgtcctcaaagagccccaccaggtaggcctcgc 630

                     
Query: 260 cggcctcctg 269
            |||||||||
Sbjct: 629 tggcctcctg 620



to top

>gb|AY125229.1| Argia vivida histone 3 gene, partial cds
          Length = 372

 Score =  153 bits (77), Expect = 4e-34
 Identities = 119/133 (89%)
 Strand = Plus / Minus

                                                                       
Query: 178 tccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtgtcctcgaag 237
           |||||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 309

                                                                       
Query: 238 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 297
           || ||||||||||| |||||||  |||||||| || ||   ||||||||||  |||||||
Sbjct: 308 agaccgacgaggtaggcctcggacgcctcctgcagagccatgacggcggagctctggaag 249

                        
Query: 298 cggaggtcggtct 310
           |||||||||||||
Sbjct: 248 cggaggtcggtct 236



to top

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
           histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
           complete cds
          Length = 3777

 Score =  153 bits (77), Expect = 4e-34
 Identities = 110/121 (90%)
 Strand = Plus / Plus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||| ||||||||||||||||||||||| |  || ||||||||||||||||
Sbjct: 261 ggatgcggcgggccagctggatgtccttgggcatgatcgtcacacgcttggcgtggatgg 320

                                                                       
Query: 215 cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
           |||||||||||||||||||||| || || || ||||| ||||||||||||||||| ||||
Sbjct: 321 cgcacaggttggtgtcctcgaacaggcccaccaggtaggcctcggcggcctcctgtagcg 380

            
Query: 275 c 275
           |
Sbjct: 381 c 381



to top

>ref|NM_178206.2| Mus musculus histone 1, H3h (Hist1h3h), mRNA
          Length = 488

 Score =  151 bits (76), Expect = 2e-33
 Identities = 142/164 (86%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| ||||||||||||| ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 433 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 374

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||||||||||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 373 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 314

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 313 ctgcagagccatgacggccgagctctggaagcgcaggtcggtct 270



to top

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score =  151 bits (76), Expect = 2e-33
 Identities = 142/164 (86%)
 Strand = Plus / Minus

                                                                          
Query: 147    ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
              ||||||| ||||||||||||| ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 139050 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 138991

                                                                          
Query: 207    gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
              ||||||||||||||||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 138990 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 138931

                                                          
Query: 267    ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
              ||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 138930 ctgcagagccatgacggccgagctctggaagcgcaggtcggtct 138887



 Score =  127 bits (64), Expect = 2e-26
 Identities = 139/164 (84%)
 Strand = Plus / Plus

                                                                          
Query: 147    ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
              ||||||| | ||||| ||||| ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 203959 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 204018

                                                                          
Query: 207    gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
              ||||||||||||||||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 204019 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 204078

                                                          
Query: 267    ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
              ||| || ||   ||| || |||  ||||||||| ||||||||||
Sbjct: 204079 ctgcagagccatgacagccgagctctggaagcgcaggtcggtct 204122



to top

>gb|AY158944.1| Mus musculus histone protein Hist1h3h gene, complete cds
          Length = 1408

 Score =  151 bits (76), Expect = 2e-33
 Identities = 142/164 (86%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| ||||||||||||| ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 902 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 843

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||||||||||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 842 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 783

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 782 ctgcagagccatgacggccgagctctggaagcgcaggtcggtct 739



to top

>gb|M32462.1|MUSHIS3D Mouse histone H3 (H3.1-291) gene, complete cds
          Length = 927

 Score =  151 bits (76), Expect = 2e-33
 Identities = 142/164 (86%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| ||||||||||||| ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 740 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 681

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||||||||||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 680 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 621

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 620 ctgcagagccatgacggccgagctctggaagcgcaggtcggtct 577



to top

>gb|AC151366.3| Aotus nancymaae clone CH258-105B22, complete sequence
          Length = 188026

 Score =  149 bits (75), Expect = 6e-33
 Identities = 123/139 (88%)
 Strand = Plus / Plus

                                                                          
Query: 137    cctaggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcga 196
              ||||||| ||||||||| ||||||||||||| ||||||||||||||||||||||| |  |
Sbjct: 183192 cctaggcccgctccccgcggatgcggcgggccagctggatgtccttgggcatgatagtca 183251

                                                                          
Query: 197    cccgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcct 256
              | |||||||||||||||||||||||||| ||||| ||||| ||||| || ||||| ||||
Sbjct: 183252 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 183311

                                 
Query: 257    cggcggcctcctggagcgc 275
              ||  ||||||||| |||||
Sbjct: 183312 cgctggcctcctgcagcgc 183330



to top

>gb|AF520775.1| Hypocrea jecorina histone H3 gene, complete cds
          Length = 497

 Score =  149 bits (75), Expect = 6e-33
 Identities = 141/163 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 gcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgctt 203
           |||||| ||| ||| |||||||||||||||||||||||||| |  ||| | ||| |||||
Sbjct: 491 gcgctcaccgcggaggcggcgggcgagctggatgtccttggactggatggtgacacgctt 432

                                                                       
Query: 204 ggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggc 263
           ||||||||||||||||||||||||||||||||||||   ||||||||| | |||| | | 
Sbjct: 431 ggcgtggatggcgcacaggttggtgtcctcgaagagggagacgaggtaggactcgacaga 372

                                                      
Query: 264 ctcctggagcgcggagacggcggaggactggaagcggaggtcg 306
           ||||||||| |||  || |||||| ||||||||||||||||||
Sbjct: 371 ctcctggagggcgccgatggcggacgactggaagcggaggtcg 329



to top

>ref|XM_870218.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC617888), mRNA
          Length = 714

 Score =  147 bits (74), Expect = 2e-32
 Identities = 122/138 (88%)
 Strand = Plus / Minus

                                                                       
Query: 138 ctaggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgac 197
           |||||| | ||||||| ||||||||||||| ||||||||||||||||||||||| | |||
Sbjct: 714 ctaggccctctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgac 655

                                                                       
Query: 198 ccgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctc 257
            ||||||||||||||||| ||||||||||||||||||||||| || || ||||| |||||
Sbjct: 654 gcgcttggcgtggatggcacacaggttggtgtcctcgaagagtcccaccaggtaggcctc 595

                             
Query: 258 ggcggcctcctggagcgc 275
           |   |||||||| |||||
Sbjct: 594 gcacgcctcctgcagcgc 577



to top

>ref|XM_684297.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC560897), mRNA
          Length = 471

 Score =  147 bits (74), Expect = 2e-32
 Identities = 137/158 (86%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||| ||| ||||||||||||| ||||||||||||||||||||||| | ||||| |
Sbjct: 467 gcgcgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctc 408

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||||||||||||||||||||| || ||||| || || ||||||  |
Sbjct: 407 ttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctg 348

                                                 
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcg 299
           | |||||| || ||   ||||||||||  |||||||||
Sbjct: 347 gactcctgaagagccatgacggcggagctctggaagcg 310



to top

>emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 in linkage group 25,
             complete sequence
          Length = 167326

 Score =  147 bits (74), Expect = 2e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                         
Query: 142   gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
             |||||||| ||| ||||||||||||| ||||||||||||||||||||||| | ||||| |
Sbjct: 79273 gcgcgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctc 79332

                                                                         
Query: 202   ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
             ||||||||||||||||||||||||||||||||||| || ||||| || || ||||||  |
Sbjct: 79333 ttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctg 79392

                                                   
Query: 262   gcctcctggagcgcggagacggcggaggactggaagcg 299
             | |||||| || ||   ||||||||||  |||||||||
Sbjct: 79393 gactcctgaagagccatgacggcggagctctggaagcg 79430



 Score =  139 bits (70), Expect = 6e-30
 Identities = 136/158 (86%)
 Strand = Plus / Plus

                                                                          
Query: 142    gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
              |||||||| ||| ||||||||||||| ||||||||||| ||||||||||| | ||||| |
Sbjct: 116388 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 116447

                                                                          
Query: 202    ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
              ||||||||||||||||||||||||||||||||||| || ||||| || || ||||||   
Sbjct: 116448 ttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctt 116507

                                                    
Query: 262    gcctcctggagcgcggagacggcggaggactggaagcg 299
              |||||||| || ||   ||||||||||  |||||||||
Sbjct: 116508 gcctcctgaagagccatgacggcggagctctggaagcg 116545



 Score =  139 bits (70), Expect = 6e-30
 Identities = 136/158 (86%)
 Strand = Plus / Minus

                                                                         
Query: 142   gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
             |||||||| ||| ||||||||||||| ||||||||||| ||||||||||| | ||||| |
Sbjct: 63682 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 63623

                                                                         
Query: 202   ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
             ||||||||||||||||||||||||||||||||||| || ||||| || || ||||||  |
Sbjct: 63622 ttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctg 63563

                                                   
Query: 262   gcctcctggagcgcggagacggcggaggactggaagcg 299
             | |||||| || ||   ||||||||||  |||||||||
Sbjct: 63562 gactcctgaagagccatgacggcggagctctggaagcg 63525



 Score =  135 bits (68), Expect = 9e-29
 Identities = 95/104 (91%)
 Strand = Plus / Plus

                                                                         
Query: 142   gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
             |||||||| ||| ||||||||||||| ||||||||||| ||||||||||| | ||||| |
Sbjct: 85972 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 86031

                                                         
Query: 202   ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgac 245
             ||||||||||||||||||||||||||||||||||| || |||||
Sbjct: 86032 ttggcgtggatggcgcacaggttggtgtcctcgaacagaccgac 86075



 Score =  133 bits (67), Expect = 4e-28
 Identities = 100/111 (90%)
 Strand = Plus / Plus

                                                                         
Query: 135   aacctaggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgc 194
             |||||| || ||||| ||| ||||||||||||| ||||||||||||||||||||||| | 
Sbjct: 99217 aacctaagcacgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggt 99276

                                                                
Query: 195   gacccgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgac 245
             ||||| |||||||||||||||||||||||| ||||||||||| || |||||
Sbjct: 99277 gaccctcttggcgtggatggcgcacaggttagtgtcctcgaacagaccgac 99327



to top

>ref|NM_178216.1| Mus musculus histone 2, H3c1 (Hist2h3c1), transcript variant 2,
           mRNA
          Length = 546

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 542 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 483

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 482 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 423

                                                            
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 422 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 374



to top

>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339
          Length = 2972

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Minus

                                                                        
Query: 142  gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
            |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 1739 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 1680

                                                                        
Query: 202  ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
            ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 1679 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 1620

                                                             
Query: 262  gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
            |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 1619 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 1571



to top

>ref|XM_603864.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC525511), mRNA
          Length = 448

 Score =  145 bits (73), Expect = 1e-31
 Identities = 115/129 (89%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| ||||||||||||| ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 402 ctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||| ||||||||||||||||| |||||||| || ||||| ||||||   |||||
Sbjct: 342 gtggatggcacacaggttggtgtcctcaaagagccccaccaggtaggcctcgcacgcctc 283

                    
Query: 267 ctggagcgc 275
           ||| |||||
Sbjct: 282 ctgcagcgc 274



to top

>ref|XM_599846.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC521581), mRNA
          Length = 411

 Score =  145 bits (73), Expect = 1e-31
 Identities = 115/129 (89%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| ||||||||||||| ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 402 ctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||| || ||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 342 gtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                    
Query: 267 ctggagcgc 275
           ||| |||||
Sbjct: 282 ctgcagcgc 274



to top

>ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h3c1), mRNA
          Length = 2956

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Minus

                                                                        
Query: 142  gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
            |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 1739 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 1680

                                                                        
Query: 202  ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
            ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 1679 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 1620

                                                             
Query: 262  gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
            |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 1619 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 1571



to top

>gb|AY125231.1| Melanoplus sp. OR18 histone 3 gene, partial cds
          Length = 372

 Score =  145 bits (73), Expect = 1e-31
 Identities = 118/133 (88%)
 Strand = Plus / Minus

                                                                       
Query: 178 tccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtgtcctcgaag 237
           |||||||||||||| | ||| |||||||||||||||||||| ||||||||||||||||||
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 309

                                                                       
Query: 238 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 297
           || ||||||||||| ||||||  ||||||||| |||||   ||||||||||  |||||||
Sbjct: 308 aggccgacgaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaag 249

                        
Query: 298 cggaggtcggtct 310
           || ||||||||||
Sbjct: 248 cgcaggtcggtct 236



to top

>emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 and H3.2
          Length = 2927

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Minus

                                                                        
Query: 142  gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
            |||||||||||| ||||||| ||||| | ||||||||||||||||||||| | ||| |||
Sbjct: 2762 gcgcgctccccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacgcgc 2703

                                                                        
Query: 202  ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
            ||||||||||||||||||||||||||||||||||| || || || ||||| ||||||   
Sbjct: 2702 ttggcgtggatggcgcacaggttggtgtcctcgaacagacccaccaggtaggcctcgctc 2643

                                                             
Query: 262  gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
            |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 2642 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 2594



to top

>dbj|AK134918.1| Mus musculus adult male olfactory brain cDNA, RIKEN full-length
            enriched library, clone:6430517B15
            product:unclassifiable, full insert sequence
          Length = 3217

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Plus

                                                                        
Query: 142  gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
            |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 1191 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 1250

                                                                        
Query: 202  ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
            ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 1251 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 1310

                                                             
Query: 262  gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
            |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 1311 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 1359



to top

>ref|XM_693458.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570028), mRNA
          Length = 725

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||| ||| ||||||||||||| ||||||||||||||||||||||| | ||||| |
Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctc 348

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||||||||| ||||||||||| || ||||| || || ||||||  |
Sbjct: 347 ttggcgtggatggcgcacaggtttgtgtcctcgaaaaggccgaccagataagcctcgctg 288

                                                            
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           | |||||| || ||   ||||||||||  ||||||||| ||||| ||||
Sbjct: 287 gactcctgcagggccatgacggcggagctctggaagcgcaggtcagtct 239



to top

>gb|U62675.1|MMU62675 Mus musculus histone H3.2-616 (H3-616), and histone H2b-616
           (H2b-616) genes, complete cds
          Length = 2371

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 987 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 928

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 927 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 868

                                                            
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 867 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 819



to top

>gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615),  and histone H3.2-615
            (H3-615) genes, complete cds
          Length = 2997

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Minus

                                                                        
Query: 142  gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
            |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 2722 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 2663

                                                                        
Query: 202  ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
            ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 2662 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 2603

                                                             
Query: 262  gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
            |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 2602 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 2554



to top

>ref|NG_002616.1| Homo sapiens histone 2, H3b (HIST2H3B) pseudogene on chromosome 1
          Length = 1411

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 907 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 848

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 788

                                                            
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 787 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 739



to top

>gb|BC094041.1| Mus musculus histone 2, H3c1, mRNA (cDNA clone MGC:102454
           IMAGE:5099464), complete cds
          Length = 1831

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 608 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 549

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 548 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 489

                                                            
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 488 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 440



to top

>gb|AF531306.1| Homo sapiens histone H3 (HIST2H3B) pseudogene, complete sequence
          Length = 1411

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 907 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 848

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 788

                                                            
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 787 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 739



to top

>ref|XM_227461.2| PREDICTED: Rattus norvegicus similar to histone protein Hist2h3c1
           (LOC310679), mRNA
          Length = 573

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||||||| ||||||| ||||| | ||||||||||||||||||||| | ||| |||
Sbjct: 569 gcgcgctccccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacgcgc 510

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||||||||||||||||||||| || || || ||||| ||||||   
Sbjct: 509 ttggcgtggatggcgcacaggttggtgtcctcgaacagacccaccaggtaggcctcgctc 450

                                                            
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 449 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 401



to top

>gb|AY158955.1| Mus musculus histone protein Hist2h3b gene, complete cds
          Length = 1411

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 907 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 848

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 788

                                                            
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 787 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 739



to top

>gb|AY158954.1| Mus musculus histone protein Hist2h3c1 gene, complete cds
          Length = 1675

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Minus

                                                                        
Query: 142  gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
            |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 1093 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 1034

                                                                        
Query: 202  ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
            ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 1033 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 974

                                                             
Query: 262  gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
            |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 973  gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 925



to top

>gb|AY158941.1| Mus musculus histone protein Hist2h2bb gene, complete cds
          Length = 1500

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Plus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 514 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 573

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 574 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 633

                                                            
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 634 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 682



to top

>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence
          Length = 200326

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Minus

                                                                         
Query: 142   gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
             |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 93739 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 93680

                                                                         
Query: 202   ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
             ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 93679 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 93620

                                                              
Query: 262   gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 93619 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 93571



 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Minus

                                                                         
Query: 142   gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
             |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 71931 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 71872

                                                                         
Query: 202   ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
             ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 71871 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 71812

                                                              
Query: 262   gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 71811 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 71763



 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Plus

                                                                         
Query: 142   gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
             |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 63174 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 63233

                                                                         
Query: 202   ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
             ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 63234 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 63293

                                                              
Query: 262   gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 63294 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 63342



to top

>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence
          Length = 166720

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Minus

                                                                         
Query: 142   gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
             |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 37519 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 37460

                                                                         
Query: 202   ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
             ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 37459 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 37400

                                                              
Query: 262   gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 37399 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 37351



 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Plus

                                                                         
Query: 142   gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
             |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 28762 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 28821

                                                                         
Query: 202   ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
             ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 28822 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 28881

                                                              
Query: 262   gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 28882 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 28930



 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Plus

                                                                        
Query: 142  gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
            |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 6954 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 7013

                                                                        
Query: 202  ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
            ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 7014 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 7073

                                                             
Query: 262  gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
            |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 7074 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 7122



to top

>ref|NM_178215.1| Mus musculus histone 2, H3b (Hist2h3b), mRNA
          Length = 411

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 407 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 348

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 288

                                                            
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 239



to top

>gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I) and histone H4 (ch4-I)
           genes, complete cds
          Length = 1338

 Score =  145 bits (73), Expect = 1e-31
 Identities = 121/137 (88%)
 Strand = Plus / Plus

                                                                       
Query: 139 taggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacc 198
           ||||||||||| ||  ||||||||||||| ||||||||||||||||||||||| |  || 
Sbjct: 201 taggcgcgctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcaca 260

                                                                       
Query: 199 cgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcg 258
           |||||||||||||||||||||||||| ||||||||||| || || || ||||| ||||| 
Sbjct: 261 cgcttggcgtggatggcgcacaggttcgtgtcctcgaacaggcccaccaggtaggcctca 320

                            
Query: 259 gcggcctcctggagcgc 275
           ||||||||||| |||||
Sbjct: 321 gcggcctcctgcagcgc 337



to top

>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4
           (ch4-III), histone H2B (ch2b-III) and histone H2A
           (ch2a-III) genes, complete cds
          Length = 4582

 Score =  145 bits (73), Expect = 1e-31
 Identities = 109/121 (90%)
 Strand = Plus / Plus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||| ||||||||||||||||||||||| |  || ||||||||||||||||
Sbjct: 481 ggatgcggcgggccagctggatgtccttgggcatgatggtcacacgcttggcgtggatgg 540

                                                                       
Query: 215 cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
           |||||||||||||||||||||| || || || ||||| ||||| ||||||||||| ||||
Sbjct: 541 cgcacaggttggtgtcctcgaacaggcccaccaggtaggcctcagcggcctcctgcagcg 600

            
Query: 275 c 275
           |
Sbjct: 601 c 601



to top

>gb|AY749753.1| Diphlebia coerulescens histone H3 (H3) gene, partial cds
          Length = 373

 Score =  145 bits (73), Expect = 1e-31
 Identities = 118/133 (88%)
 Strand = Plus / Minus

                                                                       
Query: 178 tccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtgtcctcgaag 237
           |||||||||||||| | ||| |||||||||||||||||||| ||||||||||||||||||
Sbjct: 370 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 311

                                                                       
Query: 238 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 297
           || || |||||||| ||||||  |||||||||||| ||   ||||||||||  |||||||
Sbjct: 310 agacccacgaggtaagcctcgctggcctcctggagtgccatgacggcggagctctggaag 251

                        
Query: 298 cggaggtcggtct 310
           |||||||||||||
Sbjct: 250 cggaggtcggtct 238



to top

>gb|M32461.1|MUSHIS3C Mouse histone H3 (H3.2-614) gene, complete cds
          Length = 1110

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 746 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 687

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 686 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 627

                                                            
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 626 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 578



to top

>ref|NM_145073.2| Mus musculus histone 1, H3g (Hist1h3g), mRNA
          Length = 492

 Score =  143 bits (72), Expect = 4e-31
 Identities = 141/164 (85%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| ||||||| ||||| ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 430 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 371

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||||||||||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 370 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 311

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 310 ctgcagagccatgacggccgagctctggaagcgcaggtcggtct 267



to top

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score =  143 bits (72), Expect = 4e-31
 Identities = 141/164 (85%)
 Strand = Plus / Plus

                                                                         
Query: 147   ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
             ||||||| ||||||| ||||| ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 99531 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 99590

                                                                         
Query: 207   gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
             ||||||||||||||||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 99591 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 99650

                                                         
Query: 267   ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             ||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 99651 ctgcagagccatgacggccgagctctggaagcgcaggtcggtct 99694



 Score =  139 bits (70), Expect = 6e-30
 Identities = 142/166 (85%)
 Strand = Plus / Minus

                                                                         
Query: 145   cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
             ||||| ||| |||| |||||||| ||||||||||||||||||||||| | ||| ||||||
Sbjct: 73416 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 73357

                                                                         
Query: 205   gcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 264
             ||||||||||||||||||||||||||||| || || || |||||||| ||||||   |||
Sbjct: 73356 gcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcc 73297

                                                           
Query: 265   tcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             ||||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 73296 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtct 73251



 Score =  131 bits (66), Expect = 1e-27
 Identities = 141/166 (84%)
 Strand = Plus / Plus

                                                                         
Query: 145   cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
             ||||| ||| |||| |||||||| ||||||||||||||||||||||| | ||| ||||||
Sbjct: 90490 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 90549

                                                                         
Query: 205   gcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 264
             ||||||||||||||||||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 90550 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 90609

                                                           
Query: 265   tcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             ||||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 90610 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtct 90655



 Score =  123 bits (62), Expect = 4e-25
 Identities = 131/154 (85%)
 Strand = Plus / Plus

                                                                         
Query: 157   atgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcg 216
             ||||| ||||| ||||||||||||||||||||||| | ||| ||||||||||||||||| 
Sbjct: 59185 atgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatggca 59244

                                                                         
Query: 217   cacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcg 276
             ||||||||||||||||| || || || |||||||| ||||||   |||||||| || || 
Sbjct: 59245 cacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcctcctgcagagcc 59304

                                               
Query: 277   gagacggcggaggactggaagcggaggtcggtct 310
               |||||| |||  ||||||||| ||||||||||
Sbjct: 59305 atgacggccgagctctggaagcgcaggtcggtct 59338



to top

>ref|XM_782287.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC582332), mRNA
          Length = 411

 Score =  143 bits (72), Expect = 4e-31
 Identities = 135/156 (86%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           |||| |||||||| ||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 394 ggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatgg 335

                                                                       
Query: 215 cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
           ||||||||||||||||||||||||| ||||| | ||| ||||||  ||||||||| || |
Sbjct: 334 cgcacaggttggtgtcctcgaagagaccgaccaagtatgcctcgctggcctcctgaagag 275

                                               
Query: 275 cggagacggcggaggactggaagcggaggtcggtct 310
           |   ||| ||||||  |||||| ||||| |||||||
Sbjct: 274 ccatgactgcggagctctggaatcggagctcggtct 239



to top

>emb|X80325.1|MPMPH315 M.pahari mpH315 gene
          Length = 974

 Score =  143 bits (72), Expect = 4e-31
 Identities = 141/164 (85%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| ||||||||||||| ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 583 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 524

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||||||||||||||||||||| || || || || ||||| |||||   ||||||
Sbjct: 523 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 464

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 463 ctgcagagccatgacggccgagctctggaagcgcaggtcggtct 420



to top

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
             novel gene, the genes for three H1, four H2a, five H2b,
             four H3 and four H4 histone family members, the 3' end of
             a variant of the Hfe gene for hemochromatosis protein
             (Mr2) and ten CpG islands, complete sequence
          Length = 184730

 Score =  143 bits (72), Expect = 4e-31
 Identities = 141/164 (85%)
 Strand = Plus / Minus

                                                                         
Query: 147   ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
             ||||||| ||||||| ||||| ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 16449 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 16390

                                                                         
Query: 207   gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
             ||||||||||||||||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 16389 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 16330

                                                         
Query: 267   ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             ||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 16329 ctgcagagccatgacggccgagctctggaagcgcaggtcggtct 16286



 Score =  139 bits (70), Expect = 6e-30
 Identities = 142/166 (85%)
 Strand = Plus / Plus

                                                                         
Query: 145   cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
             ||||| ||| |||| |||||||| ||||||||||||||||||||||| | ||| ||||||
Sbjct: 42568 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 42627

                                                                         
Query: 205   gcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 264
             ||||||||||||||||||||||||||||| || || || |||||||| ||||||   |||
Sbjct: 42628 gcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcc 42687

                                                           
Query: 265   tcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             ||||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 42688 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtct 42733



 Score =  131 bits (66), Expect = 1e-27
 Identities = 141/166 (84%)
 Strand = Plus / Minus

                                                                         
Query: 145   cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
             ||||| ||| |||| |||||||| ||||||||||||||||||||||| | ||| ||||||
Sbjct: 25490 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 25431

                                                                         
Query: 205   gcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 264
             ||||||||||||||||||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 25430 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 25371

                                                           
Query: 265   tcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             ||||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 25370 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtct 25325



 Score =  123 bits (62), Expect = 4e-25
 Identities = 131/154 (85%)
 Strand = Plus / Minus

                                                                         
Query: 157   atgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcg 216
             ||||| ||||| ||||||||||||||||||||||| | ||| ||||||||||||||||| 
Sbjct: 56799 atgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatggca 56740

                                                                         
Query: 217   cacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcg 276
             ||||||||||||||||| || || || |||||||| ||||||   |||||||| || || 
Sbjct: 56739 cacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcctcctgcagagcc 56680

                                               
Query: 277   gagacggcggaggactggaagcggaggtcggtct 310
               |||||| |||  ||||||||| ||||||||||
Sbjct: 56679 atgacggccgagctctggaagcgcaggtcggtct 56646



to top

>ref|XM_686806.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC563445), mRNA
          Length = 444

 Score =  143 bits (72), Expect = 4e-31
 Identities = 114/128 (89%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||| ||| ||||||||||||| ||||||||||||||||||||||| | ||||| |
Sbjct: 440 gcgcgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctc 381

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||||||||||||||||||||| || || || || || ||||||  |
Sbjct: 380 ttggcgtggatggcgcacaggttggtgtcctcgaacagaccaaccagataagcctcgctg 321

                   
Query: 262 gcctcctg 269
           ||||||||
Sbjct: 320 gcctcctg 313



to top

>ref|XM_694120.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570618), mRNA
          Length = 411

 Score =  143 bits (72), Expect = 4e-31
 Identities = 147/172 (85%)
 Strand = Plus / Minus

                                                                       
Query: 139 taggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacc 198
           ||||||||||| ||  |||||||||| || ||||||||||||||||||||||| | ||||
Sbjct: 410 taggcgcgctctccacggatgcggcgagccagctggatgtccttgggcatgatggtgacc 351

                                                                       
Query: 199 cgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcg 258
           | |||||||||||||||||||||||||||||||||||| || ||||| || || ||||||
Sbjct: 350 ctcttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcg 291

                                                               
Query: 259 gcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             ||||||||| || ||   ||||||||||  |||||| || || |||||||
Sbjct: 290 ctggcctcctgcagagccatgacggcggagctctggaaacgcagatcggtct 239



to top

>ref|XM_694149.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570644), mRNA
          Length = 411

 Score =  143 bits (72), Expect = 4e-31
 Identities = 114/128 (89%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||| ||| ||||||||||||| ||||||||||| ||||||||||| | ||||| |
Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 348

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||||||||||||||||||||| || ||||| || || ||||||  |
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctg 288

                   
Query: 262 gcctcctg 269
           ||||||||
Sbjct: 287 gcctcctg 280



to top

>dbj|AB185075.1| Conocephalum conicum H3 gene for histone 3, complete cds, clone:
           YFS47
          Length = 500

 Score =  143 bits (72), Expect = 4e-31
 Identities = 129/148 (87%)
 Strand = Plus / Minus

                                                                       
Query: 159 gcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgca 218
           |||||||||||||||||||||||||| |  ||| | ||| ||||||||||||||||||||
Sbjct: 479 gcggcgggcgagctggatgtccttggactggatggtgacacgcttggcgtggatggcgca 420

                                                                       
Query: 219 caggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcgga 278
           |||||||||||||||||||||   ||||||||| | |||| ||| ||||||||| ||   
Sbjct: 419 caggttggtgtcctcgaagagggagacgaggtaagactcgacggactcctggagagcacc 360

                                       
Query: 279 gacggcggaggactggaagcggaggtcg 306
           || |||||| ||||||||||||||||||
Sbjct: 359 gatggcggaagactggaagcggaggtcg 332



to top

>dbj|AB185072.1| Conocephalum conicum H3 gene for histone 3, complete cds, clone:
           YFS410
          Length = 500

 Score =  143 bits (72), Expect = 4e-31
 Identities = 129/148 (87%)
 Strand = Plus / Minus

                                                                       
Query: 159 gcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgca 218
           |||||||||||||||||||||||||| |  ||| | ||| ||||||||||||||||||||
Sbjct: 479 gcggcgggcgagctggatgtccttggactggatggtgacacgcttggcgtggatggcgca 420

                                                                       
Query: 219 caggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcgga 278
           |||||||||||||||||||||   ||||||||| | |||| ||| ||||||||| ||   
Sbjct: 419 caggttggtgtcctcgaagagggagacgaggtaagactcgacggactcctggagagcacc 360

                                       
Query: 279 gacggcggaggactggaagcggaggtcg 306
           || |||||| ||||||||||||||||||
Sbjct: 359 gatggcggaagactggaagcggaggtcg 332



to top

>ref|XM_227460.3| PREDICTED: Rattus norvegicus histone 2, H3c2 (predicted)
           (Hist2h3c2_predicted), mRNA
          Length = 411

 Score =  143 bits (72), Expect = 4e-31
 Identities = 147/172 (85%)
 Strand = Plus / Minus

                                                                       
Query: 139 taggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacc 198
           ||||||||||||||| ||||||| ||||| | ||||||||||||||||||||| | ||| 
Sbjct: 410 taggcgcgctccccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacg 351

                                                                       
Query: 199 cgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcg 258
           || ||||||||||||||||||||||||||||||||||| || || || ||||| ||||||
Sbjct: 350 cgtttggcgtggatggcgcacaggttggtgtcctcgaacagacccaccaggtaggcctcg 291

                                                               
Query: 259 gcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
              |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 290 ctcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 239



to top

>gb|AY158946.1| Mus musculus histone protein Hist1h3g gene, complete cds
          Length = 1405

 Score =  143 bits (72), Expect = 4e-31
 Identities = 141/164 (85%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| ||||||| ||||| ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 899 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 840

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||||||||||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 839 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 780

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 779 ctgcagagccatgacggccgagctctggaagcgcaggtcggtct 736



to top

>emb|X01684.1|MMHISH31 Mouse gene (H3.1) for histone H3
          Length = 1244

 Score =  143 bits (72), Expect = 4e-31
 Identities = 141/164 (85%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| ||||||| ||||| ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 754 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 695

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||||||||||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 694 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 635

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 634 ctgcagagccatgacggccgagctctggaagcgcaggtcggtct 591



to top

>gb|M32460.1|MUSHIS3B Mouse histone H3 (H3.1-221) gene, complete cds
          Length = 1125

 Score =  143 bits (72), Expect = 4e-31
 Identities = 141/164 (85%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| ||||||| ||||| ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 754 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 695

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||||||||||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 694 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 635

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 634 ctgcagagccatgacggccgagctctggaagcgcaggtcggtct 591



to top

>gb|BC107285.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMAGE:40053006),
           partial cds
          Length = 417

 Score =  139 bits (70), Expect = 6e-30
 Identities = 142/166 (85%)
 Strand = Plus / Minus

                                                                       
Query: 145 cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
           ||||| ||| |||| |||||||| ||||||||||||||||||||||| | ||| ||||||
Sbjct: 402 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 343

                                                                       
Query: 205 gcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 264
           ||||||||||||||||||||||||||||| || || || |||||||| |||||   ||||
Sbjct: 342 gcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcc 283

                                                         
Query: 265 tcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 282 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtct 237



to top

>ref|NM_178205.1| Mus musculus histone 1, H3e (Hist1h3e), mRNA
          Length = 411

 Score =  139 bits (70), Expect = 6e-30
 Identities = 142/166 (85%)
 Strand = Plus / Minus

                                                                       
Query: 145 cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
           ||||| ||| |||| |||||||| ||||||||||||||||||||||| | ||| ||||||
Sbjct: 404 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 345

                                                                       
Query: 205 gcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 264
           ||||||||||||||||||||||||||||| || || || |||||||| ||||||   |||
Sbjct: 344 gcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcc 285

                                                         
Query: 265 tcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 284 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtct 239



to top

>ref|NM_178203.1| Mus musculus histone 1, H3b (Hist1h3b), mRNA
          Length = 411

 Score =  139 bits (70), Expect = 6e-30
 Identities = 133/154 (86%)
 Strand = Plus / Minus

                                                                       
Query: 157 atgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcg 216
           ||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||||
Sbjct: 392 atgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggcgtggatggcg 333

                                                                       
Query: 217 cacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcg 276
           ||||||||||||||||| || || || || ||||| ||||||   |||||||| || || 
Sbjct: 332 cacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgcagagcc 273

                                             
Query: 277 gagacggcggaggactggaagcggaggtcggtct 310
             |||||| |||  ||||||||| ||||||||||
Sbjct: 272 atgacggccgagctctggaagcgcaggtcggtct 239



to top

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score =  139 bits (70), Expect = 6e-30
 Identities = 133/154 (86%)
 Strand = Plus / Plus

                                                                          
Query: 157    atgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcg 216
              ||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||||
Sbjct: 135607 atgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggcgtggatggcg 135666

                                                                          
Query: 217    cacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcg 276
              ||||||||||||||||| || || || || ||||| ||||||   |||||||| || || 
Sbjct: 135667 cacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgcagagcc 135726

                                                
Query: 277    gagacggcggaggactggaagcggaggtcggtct 310
                |||||| |||  ||||||||| ||||||||||
Sbjct: 135727 atgacggccgagctctggaagcgcaggtcggtct 135760



 Score =  135 bits (68), Expect = 9e-29
 Identities = 95/104 (91%)
 Strand = Plus / Minus

                                                                          
Query: 155    ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
              ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 143274 ggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggcgtggatgg 143215

                                                          
Query: 215    cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcg 258
              ||||||||||||||||||| || || || || ||||| ||||||
Sbjct: 143214 cgcacaggttggtgtcctcaaacagacccacaaggtaggcctcg 143171



 Score =  135 bits (68), Expect = 9e-29
 Identities = 140/164 (85%)
 Strand = Plus / Minus

                                                                          
Query: 147    ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
              ||||||| ||||||||||||| || |||||||||||||||||||| | ||| ||||||||
Sbjct: 126426 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 126367

                                                                          
Query: 207    gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
              ||||||||||||||||||||||||||| || || || || ||||| |||||   ||||||
Sbjct: 126366 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 126307

                                                          
Query: 267    ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
              ||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 126306 ctgcagagccatgacggccgagctctggaagcgcaggtcggtct 126263



to top

>ref|XM_684517.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC561114), mRNA
          Length = 411

 Score =  139 bits (70), Expect = 6e-30
 Identities = 136/158 (86%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||| ||| ||||||||||||| ||||||||||| ||||||||||| | ||||| |
Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 348

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||||||||||||||||||||| || ||||| || || ||||||  |
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctg 288

                                                 
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcg 299
           | |||||| || ||   ||||||||||  |||||||||
Sbjct: 287 gactcctgaagagccatgacggcggagctctggaagcg 250



to top

>ref|XM_683134.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC559765), mRNA
          Length = 411

 Score =  139 bits (70), Expect = 6e-30
 Identities = 136/158 (86%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||| ||| ||||||||||||| ||||||||||| ||||||||||| | ||||| |
Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 348

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||||||||||||||||||||| || ||||| || || ||||||   
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctt 288

                                                 
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcg 299
           |||||||| || ||   ||||||||||  |||||||||
Sbjct: 287 gcctcctgaagagccatgacggcggagctctggaagcg 250



to top

>ref|XM_687893.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC564560), mRNA
          Length = 411

 Score =  139 bits (70), Expect = 6e-30
 Identities = 142/166 (85%)
 Strand = Plus / Minus

                                                                       
Query: 145 cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
           ||||| ||| ||||||||||||| ||||||||||| ||||||||||| | ||||| ||||
Sbjct: 404 cgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttg 345

                                                                       
Query: 205 gcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 264
           |||||||||||||||||||||||||||||||| || ||||| || || ||||||  || |
Sbjct: 344 gcgtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctggac 285

                                                         
Query: 265 tcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||| || ||   ||||||||||  ||||||||| || |||||||
Sbjct: 284 tcctgaagagccatgacggcggagctctggaagcgcagatcggtct 239



to top

>gb|U62671.1|MMU62671 Mus musculus histone H3.2-B (H3-B) gene, complete cds
          Length = 1100

 Score =  139 bits (70), Expect = 6e-30
 Identities = 142/166 (85%)
 Strand = Plus / Minus

                                                                       
Query: 145 cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
           ||||| ||| |||| |||||||| ||||||||||||||||||||||| | ||| ||||||
Sbjct: 890 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 831

                                                                       
Query: 205 gcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 264
           ||||||||||||||||||||||||||||| || || || |||||||| ||||||   |||
Sbjct: 830 gcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcc 771

                                                         
Query: 265 tcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 770 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtct 725



to top

>gb|AY158951.1| Mus musculus histone protein Hist1h3b gene, complete cds
          Length = 1411

 Score =  139 bits (70), Expect = 6e-30
 Identities = 133/154 (86%)
 Strand = Plus / Minus

                                                                       
Query: 157 atgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcg 216
           ||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||||
Sbjct: 892 atgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggcgtggatggcg 833

                                                                       
Query: 217 cacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcg 276
           ||||||||||||||||| || || || || ||||| ||||||   |||||||| || || 
Sbjct: 832 cacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgcagagcc 773

                                             
Query: 277 gagacggcggaggactggaagcggaggtcggtct 310
             |||||| |||  ||||||||| ||||||||||
Sbjct: 772 atgacggccgagctctggaagcgcaggtcggtct 739



to top

>gb|AY158948.1| Mus musculus histone protein Hist1h3e gene, complete cds
          Length = 1408

 Score =  139 bits (70), Expect = 6e-30
 Identities = 142/166 (85%)
 Strand = Plus / Minus

                                                                       
Query: 145 cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
           ||||| ||| |||| |||||||| ||||||||||||||||||||||| | ||| ||||||
Sbjct: 904 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 845

                                                                       
Query: 205 gcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 264
           ||||||||||||||||||||||||||||| || || || |||||||| ||||||   |||
Sbjct: 844 gcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcc 785

                                                         
Query: 265 tcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 784 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtct 739



to top

>gb|U38420.1|HVU38420 Hordeum vulgare histone H3 gene, partial cds, clone B1
          Length = 494

 Score =  139 bits (70), Expect = 6e-30
 Identities = 124/142 (87%)
 Strand = Plus / Minus

                                                                       
Query: 169 agctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtg 228
           ||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||
Sbjct: 494 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 435

                                                                       
Query: 229 tcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggag 288
           |||||||| ||||||   ||||| |||||||| ||||||||||| ||    ||||||  |
Sbjct: 434 tcctcgaacagcccgcgaaggtatgcctcggcagcctcctggagggccagcacggcgtgg 375

                                 
Query: 289 gactggaagcggaggtcggtct 310
           |||||||| | |||||||||||
Sbjct: 374 gactggaacctgaggtcggtct 353



to top

>ref|NM_019469.1| Mus musculus histone 2, H3c1 (Hist2h3c1), transcript variant 1,
           mRNA
          Length = 411

 Score =  137 bits (69), Expect = 2e-29
 Identities = 144/169 (85%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 407 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 348

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           |||||||| |||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 347 ttggcgtgcatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 288

                                                            
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 239



to top

>ref|XM_871261.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618948), mRNA
          Length = 484

 Score =  137 bits (69), Expect = 2e-29
 Identities = 114/129 (88%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| | ||||||||||| ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 402 ctccccgcgaatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||| || ||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 342 gtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                    
Query: 267 ctggagcgc 275
           ||| |||||
Sbjct: 282 ctgcagcgc 274



to top

>ref|XM_870476.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618149), mRNA
          Length = 411

 Score =  137 bits (69), Expect = 2e-29
 Identities = 114/129 (88%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| |||| |||||||| ||||||||||| ||||||||||| | ||| ||||||||
Sbjct: 402 ctccccgcggatccggcgggcaagctggatgtctttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||| |||||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 342 gtggatggcacacaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                    
Query: 267 ctggagcgc 275
           ||| |||||
Sbjct: 282 ctgcagcgc 274



to top

>ref|XM_591827.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC540148), mRNA
          Length = 484

 Score =  137 bits (69), Expect = 2e-29
 Identities = 114/129 (88%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| | ||||||||||| ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 402 ctccccgcgaatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||| || ||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 342 gtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                    
Query: 267 ctggagcgc 275
           ||| |||||
Sbjct: 282 ctgcagcgc 274



to top

>ref|XM_601510.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC523214), mRNA
          Length = 1459

 Score =  137 bits (69), Expect = 2e-29
 Identities = 108/121 (89%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||| ||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 914 ggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggcgtggatgg 855

                                                                       
Query: 215 cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
           | || ||||||||||||||||||||||| || ||||| ||||||   |||||||| ||||
Sbjct: 854 cacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctcctgcagcg 795

            
Query: 275 c 275
           |
Sbjct: 794 c 794



to top

>gb|BC015270.1| Mus musculus histone 2, H3c2, mRNA (cDNA clone MGC:18559
           IMAGE:4240748), complete cds
          Length = 1124

 Score =  137 bits (69), Expect = 2e-29
 Identities = 144/169 (85%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 593 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 534

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||||||||||||||||||||| ||||| || || || ||||||   
Sbjct: 533 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccagataggcctcgctc 474

                                                            
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 473 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 425



to top

>ref|NM_054045.2| Mus musculus histone 2, H3c2 (Hist2h3c2), mRNA
          Length = 1124

 Score =  137 bits (69), Expect = 2e-29
 Identities = 144/169 (85%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 593 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 534

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||||||||||||||||||||| ||||| || || || ||||||   
Sbjct: 533 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccagataggcctcgctc 474

                                                            
Query: 262 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 473 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 425



to top

>emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23
          Length = 2724

 Score =  137 bits (69), Expect = 2e-29
 Identities = 144/169 (85%)
 Strand = Plus / Minus

                                                                        
Query: 142  gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
            |||||||| ||  ||||||||||| | | ||||||||||||||||||||| | ||| |||
Sbjct: 2548 gcgcgctcaccacggatgcggcggaccaactggatgtccttgggcatgatggtgacgcgc 2489

                                                                        
Query: 202  ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
            ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 2488 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 2429

                                                             
Query: 262  gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
            |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 2428 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 2380



to top

>emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes
          Length = 3098

 Score =  137 bits (69), Expect = 2e-29
 Identities = 144/169 (85%)
 Strand = Plus / Minus

                                                                        
Query: 142  gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
            |||||||||||  ||||||||||||| | ||||||||||||||||||||| | ||| || 
Sbjct: 2579 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 2520

                                                                        
Query: 202  ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
            |||||||| |||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 2519 ttggcgtgcatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 2460

                                                             
Query: 262  gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
            |||||||| |||||   |||||| |||  ||||||||| ||||| ||||
Sbjct: 2459 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtct 2411



to top

>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3
            and H4
          Length = 8592

 Score =  137 bits (69), Expect = 2e-29
 Identities = 129/149 (86%)
 Strand = Plus / Plus

                                                                        
Query: 162  gcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacag 221
            |||||| ||||||||||||||||||||||| | ||| | |||||||||||||||||||||
Sbjct: 5576 gcgggccagctggatgtccttgggcatgatggtgactctcttggcgtggatggcgcacag 5635

                                                                        
Query: 222  gttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagac 281
            ||||||||||||||||||||| || || || ||||||  ||||||||| || ||   |||
Sbjct: 5636 gttggtgtcctcgaagagccccaccagataagcctcgctggcctcctgcagagccatgac 5695

                                         
Query: 282  ggcggaggactggaagcggaggtcggtct 310
            ||| |||  |||||||||||| |||||||
Sbjct: 5696 ggctgagctctggaagcggagatcggtct 5724



to top

>emb|X85102.1|OSRNAHIS3 O.sativa mRNA for histone H3
          Length = 274

 Score =  137 bits (69), Expect = 2e-29
 Identities = 92/100 (92%)
 Strand = Plus / Minus

                                                                       
Query: 137 cctaggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcga 196
           |||| ||| |||| ||| |||| |||||||||||||||||||||||||||||||| | ||
Sbjct: 100 cctaagcgngctcgccgcggatccggcgggcgagctggatgtccttgggcatgatggtga 41

                                                   
Query: 197 cccgcttggcgtggatggcgcacaggttggtgtcctcgaa 236
           | ||||||||||||||||||||||||||||||||||||||
Sbjct: 40  cgcgcttggcgtggatggcgcacaggttggtgtcctcgaa 1



to top

>emb|CR760429.2| Xenopus tropicalis finished cDNA, clone TNeu057j11
          Length = 538

 Score =  137 bits (69), Expect = 2e-29
 Identities = 129/149 (86%)
 Strand = Plus / Minus

                                                                       
Query: 162 gcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacag 221
           |||||| ||||||||||||||||||||||| | ||||| |||||||||||||||||||||
Sbjct: 405 gcgggccagctggatgtccttgggcatgatggtgaccctcttggcgtggatggcgcacag 346

                                                                       
Query: 222 gttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagac 281
           |||||||||||| ||||| ||||| || || ||||||  ||||||||| || ||   |||
Sbjct: 345 gttggtgtcctcaaagagaccgaccagataagcctcgctggcctcctgcagagccatgac 286

                                        
Query: 282 ggcggaggactggaagcggaggtcggtct 310
           ||| |||  ||||||||| ||||||||||
Sbjct: 285 ggctgagctctggaagcgcaggtcggtct 257



to top

>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and
           histone H2A genes, complete cds
          Length = 4358

 Score =  137 bits (69), Expect = 2e-29
 Identities = 120/137 (87%)
 Strand = Plus / Plus

                                                                       
Query: 139 taggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacc 198
           ||||||||||| ||  ||||||||||||| ||||||||||||||||||||||| |  || 
Sbjct: 267 taggcgcgctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcaca 326

                                                                       
Query: 199 cgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcg 258
           |||||||||  ||||||||||||||||||||||||||| || || || ||||| ||||| 
Sbjct: 327 cgcttggcggtgatggcgcacaggttggtgtcctcgaacaggcccaccaggtaagcctca 386

                            
Query: 259 gcggcctcctggagcgc 275
           ||||||||||| |||||
Sbjct: 387 gcggcctcctgcagcgc 403



to top

>gb|AY749755.1| Griseargiolestes albescens histone H3 (H3) gene, partial cds
          Length = 361

 Score =  137 bits (69), Expect = 2e-29
 Identities = 114/129 (88%)
 Strand = Plus / Minus

                                                                       
Query: 182 tgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtgtcctcgaagagcc 241
           |||||||||| | ||| ||||| |||||||| |||||||||||||||||||||||||| |
Sbjct: 361 tgggcatgatggtgacgcgcttagcgtggattgcgcacaggttggtgtcctcgaagagac 302

                                                                       
Query: 242 cgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaagcgga 301
           |||||||||| ||||||  |||||||||||| ||   ||||||||||  |||||||||||
Sbjct: 301 cgacgaggtaagcctcgctggcctcctggagtgccatgacggcggagctctggaagcgga 242

                    
Query: 302 ggtcggtct 310
           |||||||||
Sbjct: 241 ggtcggtct 233



to top

>gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and
            histone H3 gene, 3' end, gene cluster X1h3
          Length = 8608

 Score =  137 bits (69), Expect = 2e-29
 Identities = 129/149 (86%)
 Strand = Plus / Plus

                                                                        
Query: 162  gcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacag 221
            |||||| ||||||||||||||||||||||| | ||| | |||||||||||||||||||||
Sbjct: 5593 gcgggccagctggatgtccttgggcatgatggtgactctcttggcgtggatggcgcacag 5652

                                                                        
Query: 222  gttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagac 281
            ||||||||||||||||||||| || || || ||||||  ||||||||| || ||   |||
Sbjct: 5653 gttggtgtcctcgaagagccccaccagataagcctcgctggcctcctgcagagccatgac 5712

                                         
Query: 282  ggcggaggactggaagcggaggtcggtct 310
            ||| |||  |||||||||||| |||||||
Sbjct: 5713 ggctgagctctggaagcggagatcggtct 5741



to top

>gb|AY725673.1| Cylindrocladium multiphialidicum strain CBS 112678 histone H3 gene,
           exons 1 through 3 and partial cds
          Length = 488

 Score =  135 bits (68), Expect = 9e-29
 Identities = 125/144 (86%)
 Strand = Plus / Minus

                                                                       
Query: 163 cgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacagg 222
           |||||||||||||||||||||| |  ||| | ||| |||||||||||||||||||| |||
Sbjct: 488 cgggcgagctggatgtccttggactggatggtgacacgcttggcgtggatggcgcagagg 429

                                                                       
Query: 223 ttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagacg 282
           |||||||||||||||||   ||||||||| | |||| ||| ||||||||| ||   || |
Sbjct: 428 ttggtgtcctcgaagagggagacgaggtaggactcgacggactcctggagagcaccgatg 369

                                   
Query: 283 gcggaggactggaagcggaggtcg 306
           ||||||||||||||||||||||||
Sbjct: 368 gcggaggactggaagcggaggtcg 345



to top

>ref|NM_175653.1| Mus musculus histone1, H3c (Hist1h3c), mRNA
          Length = 480

 Score =  135 bits (68), Expect = 9e-29
 Identities = 95/104 (91%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 418 ggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggcgtggatgg 359

                                                       
Query: 215 cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcg 258
           ||||||||||||||||||| || || || || ||||| ||||||
Sbjct: 358 cgcacaggttggtgtcctcaaacagacccacaaggtaggcctcg 315



to top

>ref|XM_848995.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611340), mRNA
          Length = 573

 Score =  135 bits (68), Expect = 9e-29
 Identities = 122/140 (87%)
 Strand = Plus / Minus

                                                                       
Query: 171 ctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtgtc 230
           ||||||||||||||||||||| | ||| |||||||||||||||||||| |||||||||||
Sbjct: 450 ctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtc 391

                                                                       
Query: 231 ctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggagga 290
           |||||||||||| || ||||| ||||||   |||||||| |||||   |||||| |||  
Sbjct: 390 ctcgaagagccccaccaggtaggcctcgcacgcctcctgcagcgccatgacggccgagct 331

                               
Query: 291 ctggaagcggaggtcggtct 310
           ||||||||| ||||||||||
Sbjct: 330 ctggaagcgcaggtcggtct 311



to top

>ref|XM_780065.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC579977), mRNA
          Length = 411

 Score =  135 bits (68), Expect = 9e-29
 Identities = 134/156 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||| ||||| ||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 394 ggatgcgacgggcaagctggatgtccttgggcatgatggtgacacgcttggcgtggatgg 335

                                                                       
Query: 215 cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
           ||||||||||||||||||||||||| ||||| | ||| || |||  ||||||||| || |
Sbjct: 334 cgcacaggttggtgtcctcgaagagaccgaccaagtatgcttcgctggcctcctgaagag 275

                                               
Query: 275 cggagacggcggaggactggaagcggaggtcggtct 310
           |   ||| ||||||  |||||| ||||| |||||||
Sbjct: 274 ccatgactgcggagctctggaatcggagctcggtct 239



to top

>emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, histone H3 and histone H1.1
          Length = 5597

 Score =  135 bits (68), Expect = 9e-29
 Identities = 140/164 (85%)
 Strand = Plus / Plus

                                                                        
Query: 147  ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
            ||||||| ||||||||||||| || |||||||||||||||||||| | ||| ||||||||
Sbjct: 2135 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 2194

                                                                        
Query: 207  gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
            ||||||||||||||||||||||||||| || || || || ||||| |||||   ||||||
Sbjct: 2195 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 2254

                                                        
Query: 267  ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
            ||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 2255 ctgcagagccatgacggccgagctctggaagcgcaggtcggtct 2298



to top

>emb|X80324.1|MPMPH3110 M.pahari mpH3110 gene
          Length = 990

 Score =  135 bits (68), Expect = 9e-29
 Identities = 140/164 (85%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| ||||||||||||| |||||||||||||| |||||||| | ||| ||||||||
Sbjct: 842 ctccccgcggatgcggcgggccagctggatgtccttaggcatgatggtgacacgcttggc 783

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||||||||||||||||||||| || || || || ||||| |||||   ||||||
Sbjct: 782 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 723

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 722 ctgcagagccatgacggccgagctctggaagcgcaggtcggtct 679



to top

>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143
          Length = 3210

 Score =  135 bits (68), Expect = 9e-29
 Identities = 95/104 (91%)
 Strand = Plus / Minus

                                                                        
Query: 155  ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
            ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 3028 ggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggcgtggatgg 2969

                                                        
Query: 215  cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcg 258
            ||||||||||||||||||| || || || || ||||| ||||||
Sbjct: 2968 cgcacaggttggtgtcctcaaacagacccacaaggtaggcctcg 2925



to top

>emb|X80326.1|MPMPH312 M.pahari mpH312 gene
          Length = 580

 Score =  135 bits (68), Expect = 9e-29
 Identities = 134/156 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||| ||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 439 ggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatgg 380

                                                                       
Query: 215 cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
           ||||||||||||||||||| || || || || ||||| ||||||   |||||||| || |
Sbjct: 379 cgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgcagag 320

                                               
Query: 275 cggagacggcggaggactggaagcggaggtcggtct 310
           |   |||||| |||  ||||||||| ||||||||||
Sbjct: 319 ccatgacggccgagctctggaagcgcaggtcggtct 284



to top

>emb|X53330.1|PDHISTCL P.dumerilii histone gene cluster for core histones H2A, H2B, H3 and
            H4
          Length = 6052

 Score =  135 bits (68), Expect = 9e-29
 Identities = 134/156 (85%)
 Strand = Plus / Plus

                                                                        
Query: 155  ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
            |||| |||||||| | ||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 4160 ggatacggcgggccaactggatgtccttgggcatgatggtgactcgcttggcgtggatgg 4219

                                                                        
Query: 215  cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
            |||||| |||||||||||| ||||| || || | ||| ||||| | |||||||||||| |
Sbjct: 4220 cgcacaagttggtgtcctcaaagagaccaaccaagtaagcctcagaggcctcctggagag 4279

                                                
Query: 275  cggagacggcggaggactggaagcggaggtcggtct 310
            |   |||||| ||||||||||| || ||||||||||
Sbjct: 4280 ccatgacggcagaggactggaatcgcaggtcggtct 4315



to top

>ref|XM_684015.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC560616), mRNA
          Length = 411

 Score =  135 bits (68), Expect = 9e-29
 Identities = 95/104 (91%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||| ||| ||||||||||||| ||||||||||| ||||||||||| | ||||| |
Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 348

                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgac 245
           ||||||||||||||||||||||||||||||||||| || |||||
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcgaacagaccgac 304



to top

>ref|XM_694088.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570590), mRNA
          Length = 411

 Score =  135 bits (68), Expect = 9e-29
 Identities = 113/128 (88%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||| ||  ||||||||||||| ||||||||||||||||||||||| | ||||| |
Sbjct: 407 gcgcgctctccacggatgcggcgggctagctggatgtccttgggcatgatggtgaccctc 348

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           |||||||||||||||||||| |||||||||||||| || ||||| || || ||||||  |
Sbjct: 347 ttggcgtggatggcgcacagattggtgtcctcgaacagaccgaccagataagcctcgctg 288

                   
Query: 262 gcctcctg 269
           ||||||||
Sbjct: 287 gcctcctg 280



to top

>emb|CR541858.1| Homo sapiens full open reading frame cDNA clone RZPDo834H0632D for
           gene HIST1H3A, histone 1, H3a; complete cds, incl.
           stopcodon
          Length = 411

 Score =  135 bits (68), Expect = 9e-29
 Identities = 89/96 (92%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| ||||||||||||||||||||||||||||||||||||| | ||| ||||||||
Sbjct: 402 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggc 343

                                               
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagccc 242
           |||||||||||||||||| |||||||| || |||||
Sbjct: 342 gtggatggcgcacaggttagtgtcctcaaatagccc 307



to top

>dbj|AK006742.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700049H14 product:H3 HISTONE homolog
           [Rattus norvegicus], full insert sequence
          Length = 514

 Score =  135 bits (68), Expect = 9e-29
 Identities = 140/164 (85%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| ||||||||||||| || |||||||||||||||||||| | ||| ||||||||
Sbjct: 415 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 356

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||||||||||||||||||||| || || || || ||||| |||||   ||||||
Sbjct: 355 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 296

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 295 ctgcagagccatgacggccgagctctggaagcgcaggtcggtct 252



to top

>gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and histone H4-D (H4-D) genes,
           complete cds
          Length = 2321

 Score =  135 bits (68), Expect = 9e-29
 Identities = 140/164 (85%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| ||||||||||||| || |||||||||||||||||||| | ||| ||||||||
Sbjct: 753 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 694

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||||||||||||||||||||| || || || || ||||| |||||   ||||||
Sbjct: 693 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 634

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 633 ctgcagagccatgacggccgagctctggaagcgcaggtcggtct 590



to top

>dbj|AB185074.1| Conocephalum conicum H3 gene for histone 3, complete cds, clone:
           YFS46
          Length = 500

 Score =  135 bits (68), Expect = 9e-29
 Identities = 128/148 (86%)
 Strand = Plus / Minus

                                                                       
Query: 159 gcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgca 218
           |||||||||||||||||||||||||| |  ||| | ||| | ||||||||||||||||||
Sbjct: 479 gcggcgggcgagctggatgtccttggactggatggtgacacccttggcgtggatggcgca 420

                                                                       
Query: 219 caggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcgga 278
           |||||||||||||||||||||   ||||||||| | |||| ||| ||||||||| ||   
Sbjct: 419 caggttggtgtcctcgaagagggagacgaggtaagactcgacggactcctggagagcacc 360

                                       
Query: 279 gacggcggaggactggaagcggaggtcg 306
           || |||||| ||||||||||||||||||
Sbjct: 359 gatggcggaagactggaagcggaggtcg 332



to top

>dbj|AB185035.1| Conocephalum supradecompositum H3 gene for histone 3, complete cds,
           clone: CS15
          Length = 472

 Score =  135 bits (68), Expect = 9e-29
 Identities = 128/148 (86%)
 Strand = Plus / Minus

                                                                       
Query: 159 gcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgca 218
           ||||||||| |||||||||||||||| |  ||| | ||| ||||||||||||||||||||
Sbjct: 451 gcggcgggccagctggatgtccttggactggatggtgacacgcttggcgtggatggcgca 392

                                                                       
Query: 219 caggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcgga 278
            ||||||||||||||||||||   ||||||||| | |||| ||| ||||||||| |||  
Sbjct: 391 gaggttggtgtcctcgaagagggagacgaggtaagactcgacggactcctggagggcgcc 332

                                       
Query: 279 gacggcggaggactggaagcggaggtcg 306
           || |||||||||||||||||| ||||||
Sbjct: 331 gatggcggaggactggaagcgaaggtcg 304



to top

>gb|AF404631.1| Lewia infectoria isolate CR31 histone gene, partial cds
          Length = 516

 Score =  135 bits (68), Expect = 9e-29
 Identities = 122/140 (87%)
 Strand = Plus / Minus

                                                                       
Query: 163 cgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacagg 222
           |||||||||||||||||||||  |  ||| | ||| |||||||||||||||||||| |||
Sbjct: 514 cgggcgagctggatgtccttgctctggatggtgacacgcttggcgtggatggcgcagagg 455

                                                                       
Query: 223 ttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagacg 282
           ||||||||||||||||||  ||||||||| |||||| ||| |||||| || |||  || |
Sbjct: 454 ttggtgtcctcgaagagcgagacgaggtaggcctcgacggactcctgaagagcgccgatg 395

                               
Query: 283 gcggaggactggaagcggag 302
           ||||||||||||||||||||
Sbjct: 394 gcggaggactggaagcggag 375



to top

>gb|AY158952.1| Mus musculus histone protein Hist1h3a gene, complete cds
          Length = 1408

 Score =  135 bits (68), Expect = 9e-29
 Identities = 140/164 (85%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| ||||||||||||| || |||||||||||||||||||| | ||| ||||||||
Sbjct: 902 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 843

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||||||||||||||||||||| || || || || ||||| |||||   ||||||
Sbjct: 842 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 783

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 782 ctgcagagccatgacggccgagctctggaagcgcaggtcggtct 739



to top

>gb|AY158950.1| Mus musculus histone protein Hist1h3c gene, complete cds
          Length = 1408

 Score =  135 bits (68), Expect = 9e-29
 Identities = 95/104 (91%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 894 ggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggcgtggatgg 835

                                                       
Query: 215 cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcg 258
           ||||||||||||||||||| || || || || ||||| ||||||
Sbjct: 834 cgcacaggttggtgtcctcaaacagacccacaaggtaggcctcg 791



to top

>emb|Z46261.1|HSHISH3A H.sapiens DNA for histone H3a
          Length = 969

 Score =  135 bits (68), Expect = 9e-29
 Identities = 89/96 (92%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| ||||||||||||||||||||||||||||||||||||| | ||| ||||||||
Sbjct: 709 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggc 650

                                               
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagccc 242
           |||||||||||||||||| |||||||| || |||||
Sbjct: 649 gtggatggcgcacaggttagtgtcctcaaatagccc 614



to top

>emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for histones H3 and H4
          Length = 1898

 Score =  133 bits (67), Expect = 4e-28
 Identities = 106/119 (89%)
 Strand = Plus / Minus

                                                                        
Query: 157  atgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcg 216
            |||||||| || ||||||||||||||||||||||| | ||| ||||||||||||||||||
Sbjct: 1495 atgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcg 1436

                                                                       
Query: 217  cacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgc 275
            ||||||||||| |||||||| || || || ||||| |||||||| |||||||| |||||
Sbjct: 1435 cacaggttggtatcctcgaacaggcccaccaggtaggcctcggcagcctcctgcagcgc 1377



to top

>ref|XM_780236.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC580163), mRNA
          Length = 363

 Score =  133 bits (67), Expect = 4e-28
 Identities = 85/91 (93%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||| ||||| ||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 346 ggatgcgacgggcaagctggatgtccttgggcatgatggtgacacgcttggcgtggatgg 287

                                          
Query: 215 cgcacaggttggtgtcctcgaagagcccgac 245
           ||||||||||||||||||||||||| |||||
Sbjct: 286 cgcacaggttggtgtcctcgaagagaccgac 256



to top

>ref|XM_777897.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC577682), mRNA
          Length = 411

 Score =  133 bits (67), Expect = 4e-28
 Identities = 85/91 (93%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           |||| |||||||| ||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 394 ggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatgg 335

                                          
Query: 215 cgcacaggttggtgtcctcgaagagcccgac 245
           ||||||||||||||||||||||||| |||||
Sbjct: 334 cgcacaggttggtgtcctcgaagagaccgac 304



to top

>ref|XM_781054.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC581030), mRNA
          Length = 411

 Score =  133 bits (67), Expect = 4e-28
 Identities = 85/91 (93%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           |||| |||||||| ||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 394 ggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatgg 335

                                          
Query: 215 cgcacaggttggtgtcctcgaagagcccgac 245
           ||||||||||||||||||||||||| |||||
Sbjct: 334 cgcacaggttggtgtcctcgaagagaccgac 304



to top

>gb|BC097059.1| Danio rerio zgc:113983, mRNA (cDNA clone MGC:113983 IMAGE:7226638),
           complete cds
          Length = 1331

 Score =  133 bits (67), Expect = 4e-28
 Identities = 103/115 (89%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||| ||||||||||| ||||||||||| | ||||| ||||||||||||||
Sbjct: 439 ggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggcgtggatgg 380

                                                                  
Query: 215 cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctg 269
           ||||||||||||||||| |||| || |||||||| || ||||||  |||||||||
Sbjct: 379 cgcacaggttggtgtccccgaacagaccgacgagataagcctcgctggcctcctg 325



to top

>ref|NM_001025171.1| Danio rerio zgc:113983 (zgc:113983), mRNA
          Length = 1331

 Score =  133 bits (67), Expect = 4e-28
 Identities = 103/115 (89%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||| ||||||||||| ||||||||||| | ||||| ||||||||||||||
Sbjct: 439 ggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggcgtggatgg 380

                                                                  
Query: 215 cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctg 269
           ||||||||||||||||| |||| || |||||||| || ||||||  |||||||||
Sbjct: 379 cgcacaggttggtgtccccgaacagaccgacgagataagcctcgctggcctcctg 325



to top

>ref|NM_074632.1| Caenorhabditis elegans HIStone family member (his-2) (his-2) mRNA,
           complete cds
          Length = 411

 Score =  133 bits (67), Expect = 4e-28
 Identities = 121/139 (87%)
 Strand = Plus / Minus

                                                                       
Query: 172 tggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtgtcc 231
           ||||||||||| |||||||| | ||| |||||||||||||| ||||||| ||||||||||
Sbjct: 377 tggatgtcctttggcatgatggtgactcgcttggcgtggattgcgcacaagttggtgtcc 318

                                                                       
Query: 232 tcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggac 291
           |||||||| ||||||||||| |||||||| ||||| || || ||   ||| ||||| || 
Sbjct: 317 tcgaagagtccgacgaggtaagcctcggcagcctcttgaagagccatgacagcggaagat 258

                              
Query: 292 tggaagcggaggtcggtct 310
           |||||||||||||||||||
Sbjct: 257 tggaagcggaggtcggtct 239



to top

>emb|Z93388.1|CET10C6 Caenorhabditis elegans Cosmid T10C6, complete sequence
          Length = 33451

 Score =  133 bits (67), Expect = 4e-28
 Identities = 121/139 (87%)
 Strand = Plus / Plus

                                                                         
Query: 172   tggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtgtcc 231
             ||||||||||| |||||||| | ||| |||||||||||||| ||||||| ||||||||||
Sbjct: 29987 tggatgtcctttggcatgatggtgactcgcttggcgtggattgcgcacaagttggtgtcc 30046

                                                                         
Query: 232   tcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggac 291
             |||||||| ||||||||||| |||||||| ||||| || || ||   ||| ||||| || 
Sbjct: 30047 tcgaagagtccgacgaggtaagcctcggcagcctcttgaagagccatgacagcggaagat 30106

                                
Query: 292   tggaagcggaggtcggtct 310
             |||||||||||||||||||
Sbjct: 30107 tggaagcggaggtcggtct 30125



to top

>ref|NM_013548.2| Mus musculus histone 1, H3f (Hist1h3f), mRNA
          Length = 1851

 Score =  131 bits (66), Expect = 1e-27
 Identities = 141/166 (84%)
 Strand = Plus / Minus

                                                                       
Query: 145 cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
           ||||| ||| |||| |||||||| ||||||||||||||||||||||| | ||| ||||||
Sbjct: 924 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 865

                                                                       
Query: 205 gcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 264
           ||||||||||||||||||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 864 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 805

                                                         
Query: 265 tcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 804 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtct 759



to top

>ref|XM_527253.1| PREDICTED: Pan troglodytes similar to histone 1, H3g (LOC471875),
           mRNA
          Length = 411

 Score =  131 bits (66), Expect = 1e-27
 Identities = 90/98 (91%)
 Strand = Plus / Minus

                                                                       
Query: 145 cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
           ||||| ||| ||||||||||||||||||||||||||||||||||||| | ||| ||||||
Sbjct: 404 cgctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttg 345

                                                 
Query: 205 gcgtggatggcgcacaggttggtgtcctcgaagagccc 242
           |||||||||||||||||||| |||||||| || |||||
Sbjct: 344 gcgtggatggcgcacaggttagtgtcctcaaatagccc 307



to top

>gb|BC103549.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123925
           IMAGE:40044771), complete cds
          Length = 1003

 Score =  131 bits (66), Expect = 1e-27
 Identities = 141/166 (84%)
 Strand = Plus / Minus

                                                                       
Query: 145 cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
           ||||| ||| |||| |||||||| ||||||||||||||||||||||| | ||| ||||||
Sbjct: 837 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 778

                                                                       
Query: 205 gcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 264
           ||||||||||||||||||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 777 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 718

                                                         
Query: 265 tcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 717 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtct 672



to top

>emb|Z30939.1|MDH3HIST Mus domesticus partial mRNA for histone H3, CD-1
          Length = 287

 Score =  131 bits (66), Expect = 1e-27
 Identities = 132/154 (85%)
 Strand = Plus / Minus

                                                                       
Query: 157 atgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcg 216
           ||||| ||||| ||||||||||||||||||||||| | ||| ||||||||||||||||||
Sbjct: 158 atgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatggcg 99

                                                                       
Query: 217 cacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcg 276
           ||||||||||||||||| || || || |||||||| ||||||   |||||||| || || 
Sbjct: 98  cacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcctcctgcagagcc 39

                                             
Query: 277 gagacggcggaggactggaagcggaggtcggtct 310
             |||||| |||  ||||||||| ||||||||||
Sbjct: 38  atgacggccgagctctggaagcgcaggtcggtct 5



to top

>gb|DQ284053.1| Boophis tephraeomystax histone H3a gene, partial cds
          Length = 328

 Score =  131 bits (66), Expect = 1e-27
 Identities = 99/110 (90%)
 Strand = Plus / Minus

                                                                       
Query: 201 cttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 260
           ||||||||||||||||||||||||||||||||||||||| || ||||| || ||||||||
Sbjct: 325 cttggcgtggatggcgcacaggttggtgtcctcgaagagtcctacgagataagcctcggc 266

                                                             
Query: 261 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||||||| |||||   ||||||||||  ||||||||| ||||||||||
Sbjct: 265 ggcctcctgcagcgccatgacggcggagctctggaagcgcaggtcggtct 216



to top

>dbj|AK010121.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched
           library, clone:2310069A13 product:HISTONE H3-VI homolog
           [Gallus gallus], full insert sequence
          Length = 852

 Score =  131 bits (66), Expect = 1e-27
 Identities = 141/166 (84%)
 Strand = Plus / Minus

                                                                       
Query: 145 cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
           ||||| ||| |||| |||||||| ||||||||||||||||||||||| | ||| ||||||
Sbjct: 426 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 367

                                                                       
Query: 205 gcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 264
           ||||||||||||||||||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 366 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 307

                                                         
Query: 265 tcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 306 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtct 261



to top

>gb|AY158947.1| Mus musculus histone protein Hist1h3f gene, complete cds
          Length = 1851

 Score =  131 bits (66), Expect = 1e-27
 Identities = 141/166 (84%)
 Strand = Plus / Minus

                                                                       
Query: 145 cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
           ||||| ||| |||| |||||||| ||||||||||||||||||||||| | ||| ||||||
Sbjct: 924 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 865

                                                                       
Query: 205 gcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 264
           ||||||||||||||||||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 864 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 805

                                                         
Query: 265 tcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 804 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtct 759



to top

>gb|AY662892.1| Etroplus maculatus histone H3a gene, partial cds
          Length = 333

 Score =  131 bits (66), Expect = 1e-27
 Identities = 99/110 (90%)
 Strand = Plus / Minus

                                                                       
Query: 201 cttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 260
           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtaagcctcgct 270

                                                             
Query: 261 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtct 220



to top

>gb|BC101955.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123923
           IMAGE:40044769), complete cds
          Length = 1004

 Score =  131 bits (66), Expect = 1e-27
 Identities = 141/166 (84%)
 Strand = Plus / Minus

                                                                       
Query: 145 cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
           ||||| ||| |||| |||||||| ||||||||||||||||||||||| | ||| ||||||
Sbjct: 837 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 778

                                                                       
Query: 205 gcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 264
           ||||||||||||||||||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 777 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 718

                                                         
Query: 265 tcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 717 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtct 672



to top

>gb|BC101956.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123922
           IMAGE:40044765), complete cds
          Length = 1004

 Score =  131 bits (66), Expect = 1e-27
 Identities = 141/166 (84%)
 Strand = Plus / Minus

                                                                       
Query: 145 cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
           ||||| ||| |||| |||||||| ||||||||||||||||||||||| | ||| ||||||
Sbjct: 837 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 778

                                                                       
Query: 205 gcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 264
           ||||||||||||||||||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 777 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 718

                                                         
Query: 265 tcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 717 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtct 672



to top

>gb|BC101954.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123924
           IMAGE:40044770), complete cds
          Length = 1004

 Score =  131 bits (66), Expect = 1e-27
 Identities = 141/166 (84%)
 Strand = Plus / Minus

                                                                       
Query: 145 cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
           ||||| ||| |||| |||||||| ||||||||||||||||||||||| | ||| ||||||
Sbjct: 837 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 778

                                                                       
Query: 205 gcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 264
           ||||||||||||||||||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 777 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 718

                                                         
Query: 265 tcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 717 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtct 672



to top

>emb|X01685.1|MMHISH32 Mouse gene (H3.2) for histone H3
          Length = 702

 Score =  131 bits (66), Expect = 1e-27
 Identities = 141/166 (84%)
 Strand = Plus / Minus

                                                                       
Query: 145 cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
           ||||| ||| |||| |||||||| ||||||||||||||||||||||| | ||| ||||||
Sbjct: 555 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 496

                                                                       
Query: 205 gcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 264
           ||||||||||||||||||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 495 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 436

                                                         
Query: 265 tcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 435 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtct 390



to top

>gb|M33989.1|MUSH2AX1X Mouse histone H3.2 gene, complete cds
          Length = 693

 Score =  131 bits (66), Expect = 1e-27
 Identities = 93/102 (91%)
 Strand = Plus / Minus

                                                                       
Query: 157 atgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcg 216
           ||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||||
Sbjct: 542 atgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggcgtggatggcg 483

                                                     
Query: 217 cacaggttggtgtcctcgaagagcccgacgaggtacgcctcg 258
           ||||||||||||||||| || || || || ||||| ||||||
Sbjct: 482 cacaggttggtgtcctcaaacagacccacaaggtaggcctcg 441



to top

>gb|M32459.1|MUSHIS3A Mouse histone H3 (H3.2-221) gene, complete cds
          Length = 982

 Score =  131 bits (66), Expect = 1e-27
 Identities = 141/166 (84%)
 Strand = Plus / Minus

                                                                       
Query: 145 cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
           ||||| ||| |||| |||||||| ||||||||||||||||||||||| | ||| ||||||
Sbjct: 812 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 753

                                                                       
Query: 205 gcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 264
           ||||||||||||||||||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 752 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 693

                                                         
Query: 265 tcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||| || ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 692 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtct 647



to top

>gb|J01175.1|SULHISL34 Sea urchin (L.pictus) late-stage histone H3 and H4 genes
          Length = 2133

 Score =  131 bits (66), Expect = 1e-27
 Identities = 132/154 (85%)
 Strand = Plus / Minus

                                                                        
Query: 155  ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
            |||| |||||||| ||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 1907 ggatacggcgggcaagctggatgtccttgggcatgatggtgacacgcttggcgtggatgg 1848

                                                                        
Query: 215  cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
            |||| |||||||||||||||||||| ||||| | ||| || ||   |||||| ||||| |
Sbjct: 1847 cgcaaaggttggtgtcctcgaagagaccgaccaagtaagcttccctggcctcttggaggg 1788

                                              
Query: 275  cggagacggcggaggactggaagcggaggtcggt 308
            |   ||||||||||  |||||||||||| |||||
Sbjct: 1787 ccatgacggcggagctctggaagcggagctcggt 1754



to top

>ref|XM_524859.1| PREDICTED: Pan troglodytes LOC469476 (LOC469476), mRNA
          Length = 576

 Score =  129 bits (65), Expect = 6e-27
 Identities = 119/137 (86%)
 Strand = Plus / Minus

                                                                       
Query: 139 taggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacc 198
           ||||| ||||||||| ||||||||||||| | ||||||||||||||||||||| |  || 
Sbjct: 575 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 516

                                                                       
Query: 199 cgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcg 258
           |||||||| ||||||||||||||||| ||||| ||||| ||||| || ||||| ||||||
Sbjct: 515 cgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcg 456

                            
Query: 259 gcggcctcctggagcgc 275
             ||||||||| |||||
Sbjct: 455 ctggcctcctgcagcgc 439



to top

>gb|BC062305.1| Homo sapiens cDNA clone IMAGE:3162462
          Length = 2706

 Score =  129 bits (65), Expect = 6e-27
 Identities = 86/93 (92%)
 Strand = Plus / Minus

                                                                        
Query: 166  gcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttg 225
            |||||||||||||||||||||||||| |  ||||||||||||||||||||||||||||||
Sbjct: 2265 gcgagctggatgtccttgggcatgatagtcacccgcttggcgtggatggcgcacaggttg 2206

                                             
Query: 226  gtgtcctcgaagagcccgacgaggtacgcctcg 258
            |||||||| |||||||| || ||||| ||||||
Sbjct: 2205 gtgtcctcaaagagccccaccaggtaggcctcg 2173



to top

>gb|BC007518.2| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC:4577
           IMAGE:3030790), complete cds
          Length = 1387

 Score =  129 bits (65), Expect = 6e-27
 Identities = 86/93 (92%)
 Strand = Plus / Minus

                                                                       
Query: 166 gcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttg 225
           |||||||||||||||||||||||||| |  ||||||||||||||||||||||||||||||
Sbjct: 521 gcgagctggatgtccttgggcatgatagtcacccgcttggcgtggatggcgcacaggttg 462

                                            
Query: 226 gtgtcctcgaagagcccgacgaggtacgcctcg 258
           |||||||| |||||||| || ||||| ||||||
Sbjct: 461 gtgtcctcaaagagccccaccaggtaggcctcg 429



to top

>ref|XM_590015.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC539875), mRNA
          Length = 411

 Score =  129 bits (65), Expect = 6e-27
 Identities = 113/129 (87%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| |||||||||| || ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 402 ctccccgcggatgcggcgagcaagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           |||||||||||| || ||||||||||||||||| || || ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagagattggtgtcctcgaagaggcccaccaggtaggcctcgcacgcctc 283

                    
Query: 267 ctggagcgc 275
           ||| |||||
Sbjct: 282 ctgcagcgc 274



to top

>ref|XM_868935.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC616819), mRNA
          Length = 411

 Score =  129 bits (65), Expect = 6e-27
 Identities = 113/129 (87%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| |||||||||| || ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 402 ctccccgcggatgcggcgagcaagctggatgtccttgggcatgatagtgacgcgcttggc 343

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||| |||||||||||||| ||||||||||| || || || ||||||   |||||
Sbjct: 342 gtggatggcacacaggttggtgtcttcgaagagccccaccagataggcctcgcacgcctc 283

                    
Query: 267 ctggagcgc 275
           ||| |||||
Sbjct: 282 ctgcagcgc 274



to top

>ref|XM_868913.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC616800), mRNA
          Length = 411

 Score =  129 bits (65), Expect = 6e-27
 Identities = 113/129 (87%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| |||||||||| || ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 402 ctccccgcggatgcggcgagcaagctggatgtccttgggcatgatagtgacgcgcttggc 343

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||| |||||||||||||| ||||||||||| || || || ||||||   |||||
Sbjct: 342 gtggatggcacacaggttggtgtcttcgaagagccccaccagataggcctcgcacgcctc 283

                    
Query: 267 ctggagcgc 275
           ||| |||||
Sbjct: 282 ctgcagcgc 274



to top

>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6
          Length = 91567

 Score =  129 bits (65), Expect = 6e-27
 Identities = 86/93 (92%)
 Strand = Plus / Plus

                                                                         
Query: 166   gcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttg 225
             |||||||||||||||||||||||||| |  ||||||||||||||||||||||||||||||
Sbjct: 83996 gcgagctggatgtccttgggcatgatagtcacccgcttggcgtggatggcgcacaggttg 84055

                                              
Query: 226   gtgtcctcgaagagcccgacgaggtacgcctcg 258
             |||||||| |||||||| || ||||| ||||||
Sbjct: 84056 gtgtcctcaaagagccccaccaggtaggcctcg 84088



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                         
Query: 155   ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
             |||||||||| || ||||||||||| || ||||| || | ||| || |||||||| ||||
Sbjct: 22530 ggatgcggcgcgcaagctggatgtctttaggcataatagtgacgcgtttggcgtgaatgg 22471

                                                                         
Query: 215   cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
             ||||||||||||| ||||| || ||||| || ||||| ||||||   |||||||| ||||
Sbjct: 22470 cgcacaggttggtatcctcaaatagccccaccaggtaggcctcgcaagcctcctgcagcg 22411

              
Query: 275   c 275
             |
Sbjct: 22410 c 22410



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                        
Query: 169  agctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtg 228
            |||||||||||||| ||||| || | ||| ||||||||||| || || || |||||||||
Sbjct: 4039 agctggatgtccttaggcataatagtgacacgcttggcgtgaatagcacagaggttggtg 3980

                       
Query: 229  tcctcgaagag 239
            || || |||||
Sbjct: 3979 tcttcaaagag 3969



to top

>ref|NM_003536.2| Homo sapiens histone 1, H3h (HIST1H3H), mRNA
          Length = 473

 Score =  129 bits (65), Expect = 6e-27
 Identities = 86/93 (92%)
 Strand = Plus / Minus

                                                                       
Query: 166 gcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttg 225
           |||||||||||||||||||||||||| |  ||||||||||||||||||||||||||||||
Sbjct: 393 gcgagctggatgtccttgggcatgatagtcacccgcttggcgtggatggcgcacaggttg 334

                                            
Query: 226 gtgtcctcgaagagcccgacgaggtacgcctcg 258
           |||||||| |||||||| || ||||| ||||||
Sbjct: 333 gtgtcctcaaagagccccaccaggtaggcctcg 301



to top

>ref|XM_747656.1| Aspergillus fumigatus Af293 histone H3 (Afu1g13790) partial mRNA
          Length = 411

 Score =  129 bits (65), Expect = 6e-27
 Identities = 125/145 (86%)
 Strand = Plus / Minus

                                                                       
Query: 163 cgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacagg 222
           |||||||||||||||||||||| |  ||| | ||| ||||||||||||||||||||||||
Sbjct: 386 cgggcgagctggatgtccttggactggatggtgacacgcttggcgtggatggcgcacagg 327

                                                                       
Query: 223 ttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagacg 282
           |||||||||||||||||   ||||||||| |||||  ||| |||||| || ||   || |
Sbjct: 326 ttggtgtcctcgaagagggagacgaggtaggcctcaacggactcctgaagagcaccgatg 267

                                    
Query: 283 gcggaggactggaagcggaggtcgg 307
           || ||||||||||||||||||||||
Sbjct: 266 gcagaggactggaagcggaggtcgg 242



to top

>gb|AF531281.1| Homo sapiens histone H3 (HIST1H3H) gene, complete cds
          Length = 1227

 Score =  129 bits (65), Expect = 6e-27
 Identities = 86/93 (92%)
 Strand = Plus / Minus

                                                                       
Query: 166 gcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttg 225
           |||||||||||||||||||||||||| |  ||||||||||||||||||||||||||||||
Sbjct: 793 gcgagctggatgtccttgggcatgatagtcacccgcttggcgtggatggcgcacaggttg 734

                                            
Query: 226 gtgtcctcgaagagcccgacgaggtacgcctcg 258
           |||||||| |||||||| || ||||| ||||||
Sbjct: 733 gtgtcctcaaagagccccaccaggtaggcctcg 701



to top

>emb|CR716243.2|CNS0GFLO Tetraodon nigroviridis full-length cDNA
          Length = 844

 Score =  129 bits (65), Expect = 6e-27
 Identities = 107/121 (88%)
 Strand = Plus / Minus

                                                                       
Query: 138 ctaggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgac 197
           |||||| | ||||||| |||||||||| || ||||||||||| ||||||||||| | |||
Sbjct: 648 ctaggccctctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtgac 589

                                                                       
Query: 198 ccgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctc 257
           || |||||||||||||||||||||||||||||||||||| || || || ||||| |||||
Sbjct: 588 cctcttggcgtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaggcctc 529

            
Query: 258 g 258
           |
Sbjct: 528 g 528



to top

>gb|AY125232.1| Pterophylla camellifolia histone 3 gene, partial cds
          Length = 372

 Score =  129 bits (65), Expect = 6e-27
 Identities = 116/133 (87%)
 Strand = Plus / Minus

                                                                       
Query: 178 tccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtgtcctcgaag 237
           |||||||||||||| | ||| |||||||||||||||||||||||||||||||| ||||||
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcttcgaag 309

                                                                       
Query: 238 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 297
           || ||||| ||||| ||||||  ||||||||| |||||   ||||||||||  |||||| 
Sbjct: 308 aggccgacaaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaac 249

                        
Query: 298 cggaggtcggtct 310
           |||||||| ||||
Sbjct: 248 cggaggtccgtct 236



to top

>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a
             ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
             (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of
             IgG, high affinity Ia, receptor for (CD64), a novel gene
             similar to histone 2, H2be (HIST2H2BE), a novel gene
             similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for
             histone 2, H4, the HIST2H3C gene for histone 2, H3c, the
             HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd
             pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene
             (HIST2H2BC), a novel gene similar to histone 2, H2aa
             (HIST2H2AA), a novel gene similar to histone 2, H3c
             (HIST2H3C), a novel gene similar to histone 1, H4
             (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the
             HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for
             histone 2, H2ab, a novel protein similar to histone 2, a
             novel gene, the SV2A gene for synaptic vesicle
             glycoprotein 2A, the 3' end of the SF3B4 gene for splicing
             factor 3b, subunit 4, 49kDa and five CpG islands, complete
             sequence
          Length = 188956

 Score =  129 bits (65), Expect = 6e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                         
Query: 139   taggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacc 198
             ||||| ||||||||| ||||||||||||| | ||||||||||||||||||||| |  || 
Sbjct: 74987 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 75046

                                                                         
Query: 199   cgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcg 258
             |||||||| ||||||||||||||||| ||||| ||||| ||||| || ||||| ||||||
Sbjct: 75047 cgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcg 75106

                              
Query: 259   gcggcctcctggagcgc 275
               ||||||||| |||||
Sbjct: 75107 ctggcctcctgcagcgc 75123



 Score =  121 bits (61), Expect = 1e-24
 Identities = 106/121 (87%)
 Strand = Plus / Minus

                                                                          
Query: 155    ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
              ||||||||||||| |||||||||||||||||||| || |  || ||||||||||||||||
Sbjct: 114770 ggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttggcgtggatgg 114711

                                                                          
Query: 215    cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
              |||||||||| ||||| ||||| ||||| || ||||| ||||||  ||||||||| ||||
Sbjct: 114710 cgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcctcctgcagcg 114651

               
Query: 275    c 275
              |
Sbjct: 114650 c 114650



 Score =  121 bits (61), Expect = 1e-24
 Identities = 106/121 (87%)
 Strand = Plus / Plus

                                                                          
Query: 155    ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
              ||||||||||||| |||||||||||||||||||| || |  || ||||||||||||||||
Sbjct: 102496 ggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttggcgtggatgg 102555

                                                                          
Query: 215    cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
              |||||||||| ||||| ||||| ||||| || ||||| ||||||  ||||||||| ||||
Sbjct: 102556 cgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcctcctgcagcg 102615

               
Query: 275    c 275
              |
Sbjct: 102616 c 102616



to top

>emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 on chromosome 6p21.3-22.2
              Contains a novel pseudogene, a 60S Ribosomal protein L30
              (RPL30) pseudogene, H4 histone family member F pseudogene
              H4FFP and histone genes H2BFC, H2AFC, H3FK. Contains ESTs,
              STSs, GSSs and two CpG islands, complete sequence
          Length = 139904

 Score =  129 bits (65), Expect = 6e-27
 Identities = 86/93 (92%)
 Strand = Plus / Minus

                                                                          
Query: 166    gcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttg 225
              |||||||||||||||||||||||||| |  ||||||||||||||||||||||||||||||
Sbjct: 138607 gcgagctggatgtccttgggcatgatagtcacccgcttggcgtggatggcgcacaggttg 138548

                                               
Query: 226    gtgtcctcgaagagcccgacgaggtacgcctcg 258
              |||||||| |||||||| || ||||| ||||||
Sbjct: 138547 gtgtcctcaaagagccccaccaggtaggcctcg 138515



to top

>emb|BX649607.1| Aspergillus fumigatus BAC pilot project supercontig; segment 3/3
          Length = 227448

 Score =  129 bits (65), Expect = 6e-27
 Identities = 125/145 (86%)
 Strand = Plus / Minus

                                                                         
Query: 163   cgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacagg 222
             |||||||||||||||||||||| |  ||| | ||| ||||||||||||||||||||||||
Sbjct: 31807 cgggcgagctggatgtccttggactggatggtgacacgcttggcgtggatggcgcacagg 31748

                                                                         
Query: 223   ttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagacg 282
             |||||||||||||||||   ||||||||| |||||  ||| |||||| || ||   || |
Sbjct: 31747 ttggtgtcctcgaagagggagacgaggtaggcctcaacggactcctgaagagcaccgatg 31688

                                      
Query: 283   gcggaggactggaagcggaggtcgg 307
             || ||||||||||||||||||||||
Sbjct: 31687 gcagaggactggaagcggaggtcgg 31663



to top

>gb|BC096130.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC:116776
           IMAGE:40002510), complete cds
          Length = 463

 Score =  129 bits (65), Expect = 6e-27
 Identities = 86/93 (92%)
 Strand = Plus / Minus

                                                                       
Query: 166 gcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttg 225
           |||||||||||||||||||||||||| |  ||||||||||||||||||||||||||||||
Sbjct: 383 gcgagctggatgtccttgggcatgatagtcacccgcttggcgtggatggcgcacaggttg 324

                                            
Query: 226 gtgtcctcgaagagcccgacgaggtacgcctcg 258
           |||||||| |||||||| || ||||| ||||||
Sbjct: 323 gtgtcctcaaagagccccaccaggtaggcctcg 291



to top

>gb|BC096128.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC:116774
           IMAGE:40002508), complete cds
          Length = 463

 Score =  129 bits (65), Expect = 6e-27
 Identities = 86/93 (92%)
 Strand = Plus / Minus

                                                                       
Query: 166 gcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttg 225
           |||||||||||||||||||||||||| |  ||||||||||||||||||||||||||||||
Sbjct: 383 gcgagctggatgtccttgggcatgatagtcacccgcttggcgtggatggcgcacaggttg 324

                                            
Query: 226 gtgtcctcgaagagcccgacgaggtacgcctcg 258
           |||||||| |||||||| || ||||| ||||||
Sbjct: 323 gtgtcctcaaagagccccaccaggtaggcctcg 291



to top

>gb|BC096129.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC:116775
           IMAGE:40002509), complete cds
          Length = 463

 Score =  129 bits (65), Expect = 6e-27
 Identities = 86/93 (92%)
 Strand = Plus / Minus

                                                                       
Query: 166 gcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttg 225
           |||||||||||||||||||||||||| |  ||||||||||||||||||||||||||||||
Sbjct: 383 gcgagctggatgtccttgggcatgatagtcacccgcttggcgtggatggcgcacaggttg 324

                                            
Query: 226 gtgtcctcgaagagcccgacgaggtacgcctcg 258
           |||||||| |||||||| || ||||| ||||||
Sbjct: 323 gtgtcctcaaagagccccaccaggtaggcctcg 291



to top

>emb|Z83735.1|HSZ83735 H.sapiens hH3/k gene
          Length = 819

 Score =  129 bits (65), Expect = 6e-27
 Identities = 86/93 (92%)
 Strand = Plus / Minus

                                                                       
Query: 166 gcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttg 225
           |||||||||||||||||||||||||| |  ||||||||||||||||||||||||||||||
Sbjct: 702 gcgagctggatgtccttgggcatgatagtcacccgcttggcgtggatggcgcacaggttg 643

                                            
Query: 226 gtgtcctcgaagagcccgacgaggtacgcctcg 258
           |||||||| |||||||| || ||||| ||||||
Sbjct: 642 gtgtcctcaaagagccccaccaggtaggcctcg 610



to top

>ref|XM_683485.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC560090), mRNA
          Length = 411

 Score =  129 bits (65), Expect = 6e-27
 Identities = 92/101 (91%)
 Strand = Plus / Minus

                                                                       
Query: 145 cgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttg 204
           ||||| ||| ||||||||||||| ||||||||||||||||||||||| | ||||| ||||
Sbjct: 404 cgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttg 345

                                                    
Query: 205 gcgtggatggcgcacaggttggtgtcctcgaagagcccgac 245
           |||||||||||||||||||| ||||||||||| || |||||
Sbjct: 344 gcgtggatggcgcacaggttagtgtcctcgaacagaccgac 304



to top

>ref|XM_497711.2| PREDICTED: Homo sapiens similar to H3 histone, family 2 isoform 2
           (LOC653604), mRNA
          Length = 543

 Score =  129 bits (65), Expect = 6e-27
 Identities = 119/137 (86%)
 Strand = Plus / Minus

                                                                       
Query: 139 taggcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacc 198
           ||||| ||||||||| ||||||||||||| | ||||||||||||||||||||| |  || 
Sbjct: 542 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 483

                                                                       
Query: 199 cgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcg 258
           |||||||| ||||||||||||||||| ||||| ||||| ||||| || ||||| ||||||
Sbjct: 482 cgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcg 423

                            
Query: 259 gcggcctcctggagcgc 275
             ||||||||| |||||
Sbjct: 422 ctggcctcctgcagcgc 406



to top

>gb|AY749743.1| Ichthybotus hudsoni histone H3 (H3) gene, partial cds
          Length = 375

 Score =  129 bits (65), Expect = 6e-27
 Identities = 116/133 (87%)
 Strand = Plus / Minus

                                                                       
Query: 178 tccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtgtcctcgaag 237
           |||||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 238 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 297
           || || |||||||| ||||||  ||||||||| || ||    |||||||||  |||||| 
Sbjct: 311 agacccacgaggtaagcctcgctggcctcctgcagagccatcacggcggagctctggaaa 252

                        
Query: 298 cggaggtcggtct 310
           |||||||||||||
Sbjct: 251 cggaggtcggtct 239



to top

>gb|AY749709.1| Mystaxiops venatoris histone H3 (H3) gene, partial cds
          Length = 375

 Score =  129 bits (65), Expect = 6e-27
 Identities = 116/133 (87%)
 Strand = Plus / Minus

                                                                       
Query: 178 tccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtgtcctcgaag 237
           |||||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 238 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 297
           || ||||| ||||| ||||||  ||||||||| || ||   |||||| |||  |||||||
Sbjct: 311 aggccgaccaggtaagcctcgctggcctcctgcagggccatgacggccgagctctggaag 252

                        
Query: 298 cggaggtcggtct 310
           || ||||||||||
Sbjct: 251 cgcaggtcggtct 239



to top

>gb|AY749705.1| Choroterpes sp. EP024 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  129 bits (65), Expect = 6e-27
 Identities = 116/133 (87%)
 Strand = Plus / Minus

                                                                       
Query: 178 tccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtgtcctcgaag 237
           |||||||||||||| | ||| |||||||||||||||||||||| |||||||||||| |||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcaaag 312

                                                                       
Query: 238 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 297
           || ||||||||||| ||||||  |||||||||||| ||   ||| || |||  |||||||
Sbjct: 311 agaccgacgaggtaggcctcgctggcctcctggagggccatgactgccgagctctggaag 252

                        
Query: 298 cggaggtcggtct 310
           |||||||||||||
Sbjct: 251 cggaggtcggtct 239



to top

>ref|NM_013550.3| Mus musculus histone 1, H3a (Hist1h3a), mRNA
          Length = 535

 Score =  127 bits (64), Expect = 2e-26
 Identities = 139/164 (84%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| ||||||||||||| || |||||||||||||||||||| | ||| ||||||||
Sbjct: 436 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 377

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||||||||||||||||||||| || || || || ||||| |||||   ||||||
Sbjct: 376 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 317

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| |  ||   |||||| |||  ||||||||| ||||||||||
Sbjct: 316 ctgcaaagccatgacggccgagctctggaagcgcaggtcggtct 273



to top

>gb|BC107287.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMAGE:40053019),
           partial cds
          Length = 415

 Score =  127 bits (64), Expect = 2e-26
 Identities = 139/164 (84%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| | ||||| ||||| ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 398 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 339

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||||||||||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 338 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 279

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| || ||   ||| || |||  ||||||||| ||||||||||
Sbjct: 278 ctgcagagccatgacagccgagctctggaagcgcaggtcggtct 235



to top

>gb|DQ079682.1| Lysmata wurdemanni voucher MLP120 histone H3 (H3) gene, partial cds
          Length = 332

 Score =  127 bits (64), Expect = 2e-26
 Identities = 103/116 (88%)
 Strand = Plus / Minus

                                                                       
Query: 195 gacccgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgc 254
           ||||| |||||| |||||||||||||||||||||||||||||||| ||||| ||||| ||
Sbjct: 332 gaccctcttggcatggatggcgcacaggttggtgtcctcgaagaggccgaccaggtaagc 273

                                                                   
Query: 255 ctcggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||||| ||||||||| || ||   |||||| || ||||||||||||||||||||||
Sbjct: 272 ctcggaggcctcctgcagggccatgacggcagatgactggaagcggaggtcggtct 217



to top

>gb|BC069303.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:97421
           IMAGE:7262697), complete cds
          Length = 461

 Score =  127 bits (64), Expect = 2e-26
 Identities = 82/88 (93%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 394 ggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggcgtggatgg 335

                                       
Query: 215 cgcacaggttggtgtcctcgaagagccc 242
           |||||||||| |||||||| || |||||
Sbjct: 334 cgcacaggttagtgtcctcaaatagccc 307



to top

>gb|BC067490.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79343
           IMAGE:7002071), complete cds
          Length = 465

 Score =  127 bits (64), Expect = 2e-26
 Identities = 82/88 (93%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 394 ggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggcgtggatgg 335

                                       
Query: 215 cgcacaggttggtgtcctcgaagagccc 242
           |||||||||| |||||||| || |||||
Sbjct: 334 cgcacaggttagtgtcctcaaatagccc 307



to top

>gb|BC067491.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79344
           IMAGE:7002072), complete cds
          Length = 464

 Score =  127 bits (64), Expect = 2e-26
 Identities = 82/88 (93%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 394 ggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggcgtggatgg 335

                                       
Query: 215 cgcacaggttggtgtcctcgaagagccc 242
           |||||||||| |||||||| || |||||
Sbjct: 334 cgcacaggttagtgtcctcaaatagccc 307



to top

>gb|BC054666.1| Danio rerio zgc:66241, mRNA (cDNA clone MGC:66241 IMAGE:3818929),
           complete cds
          Length = 2172

 Score =  127 bits (64), Expect = 2e-26
 Identities = 112/128 (87%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||| ||| ||||||||||||| ||||||||||| ||||||||||| | ||| | |
Sbjct: 419 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgactctc 360

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||||||||||||||||||||| || || || || || ||||||  |
Sbjct: 359 ttggcgtggatggcgcacaggttggtgtcctcgaacagaccaaccagataagcctcgctg 300

                   
Query: 262 gcctcctg 269
           ||||||||
Sbjct: 299 gcctcctg 292



to top

>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on
            chromosome 6
          Length = 269712

 Score =  127 bits (64), Expect = 2e-26
 Identities = 82/88 (93%)
 Strand = Plus / Minus

                                                                        
Query: 155  ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
            ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 4825 ggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggcgtggatgg 4766

                                        
Query: 215  cgcacaggttggtgtcctcgaagagccc 242
            |||||||||| |||||||| || |||||
Sbjct: 4765 cgcacaggttagtgtcctcaaatagccc 4738



 Score =  125 bits (63), Expect = 9e-26
 Identities = 105/119 (88%)
 Strand = Plus / Plus

                                                                          
Query: 157    atgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcg 216
              |||||||| |||||||||||||||||||||||||| |  || |||||||||||||| || 
Sbjct: 234214 atgcggcgagcgagctggatgtccttgggcatgatagtcactcgcttggcgtggatagca 234273

                                                                         
Query: 217    cacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgc 275
              ||||||||||||||||| |||||||| || ||||| ||||||  ||||||||| |||||
Sbjct: 234274 cacaggttggtgtcctcaaagagccccaccaggtaagcctcgcaggcctcctgcagcgc 234332



 Score =  109 bits (55), Expect = 5e-21
 Identities = 103/119 (86%)
 Strand = Plus / Plus

                                                                          
Query: 157    atgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcg 216
              |||||||| || ||||||||||||||||||||||| |  || ||||||||||| ||||||
Sbjct: 180859 atgcggcgagcaagctggatgtccttgggcatgatagtcactcgcttggcgtgaatggcg 180918

                                                                         
Query: 217    cacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgc 275
              || |||||||||||||| || ||||| || ||||| ||||||  ||||||||| |||||
Sbjct: 180919 cataggttggtgtcctcaaacagccccaccaggtaggcctcgcaggcctcctgcagcgc 180977



 Score = 89.7 bits (45), Expect = 5e-15
 Identities = 96/113 (84%)
 Strand = Plus / Plus

                                                                          
Query: 157    atgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcg 216
              |||||||| |||||||| ||||||||||||||||| |  || ||||| || |||||||| 
Sbjct: 254993 atgcggcgagcgagctgaatgtccttgggcatgatagtcactcgcttagcatggatggca 255052

                                                                   
Query: 217    cacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctg 269
              ||||||||||| ||||| |||||||| || | ||| ||||||  |||||||||
Sbjct: 255053 cacaggttggtatcctcaaagagccccaccaagtaggcctcgcaggcctcctg 255105



 Score = 85.7 bits (43), Expect = 8e-14
 Identities = 100/119 (84%)
 Strand = Plus / Minus

                                                                          
Query: 157    atgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcg 216
              ||||||||||| ||||||||||| || |||||||| |  || || ||||| || || |||
Sbjct: 209546 atgcggcgggcaagctggatgtctttaggcatgatggtcacgcgtttggcatgaatagcg 209487

                                                                         
Query: 217    cacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgc 275
              |||||||||||||||||||| ||||| || | ||| ||||||  ||||||||| |||||
Sbjct: 209486 cacaggttggtgtcctcgaaaagccccaccaagtaggcctcgcaggcctcctgcagcgc 209428



 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 74/86 (86%)
 Strand = Plus / Plus

                                                                         
Query: 157   atgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcg 216
             |||||||| |||||||||||||| |||||||| || |  || ||||| || |||||||||
Sbjct: 15611 atgcggcgagcgagctggatgtctttgggcataatagtcactcgcttagcatggatggcg 15670

                                       
Query: 217   cacaggttggtgtcctcgaagagccc 242
             || ||||| |||||||| ||||||||
Sbjct: 15671 caaaggtttgtgtcctcaaagagccc 15696



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                         
Query: 155   ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
             ||||||| || || |||||||| || ||||||||||| | ||| || || ||||| || |
Sbjct: 29746 ggatgcgacgtgccagctggatatctttgggcatgatggtgacgcgtttagcgtgaatag 29687

                                                        
Query: 215   cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctc 257
             ||||||| |||||||| |||||||| || || ||||| |||||
Sbjct: 29686 cgcacagattggtgtcttcgaagagtcccaccaggtaggcctc 29644



to top

>ref|NM_003529.2| Homo sapiens histone 1, H3a (HIST1H3A), mRNA
          Length = 469

 Score =  127 bits (64), Expect = 2e-26
 Identities = 82/88 (93%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 394 ggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggcgtggatgg 335

                                       
Query: 215 cgcacaggttggtgtcctcgaagagccc 242
           |||||||||| |||||||| || |||||
Sbjct: 334 cgcacaggttagtgtcctcaaatagccc 307



to top

>gb|AY788897.1| Mnais nawai histone 3 gene, partial cds
          Length = 328

 Score =  127 bits (64), Expect = 2e-26
 Identities = 100/112 (89%)
 Strand = Plus / Minus

                                                                       
Query: 199 cgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcg 258
           ||||||||||||||||||||||||||||||||||||||||| || |||||||| ||||||
Sbjct: 327 cgcttggcgtggatggcgcacaggttggtgtcctcgaagagacccacgaggtaagcctcg 268

                                                               
Query: 259 gcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
             |||||||||||| ||   ||||||||||  |||||||||||| |||||||
Sbjct: 267 ctggcctcctggagtgccatgacggcggagctctggaagcggagatcggtct 216



to top

>gb|AF531274.1| Homo sapiens histone H3 (HIST1H3A) gene, complete cds
          Length = 1227

 Score =  127 bits (64), Expect = 2e-26
 Identities = 82/88 (93%)
 Strand = Plus / Minus

                                                                       
Query: 155 ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
           ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 804 ggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggcgtggatgg 745

                                       
Query: 215 cgcacaggttggtgtcctcgaagagccc 242
           |||||||||| |||||||| || |||||
Sbjct: 744 cgcacaggttagtgtcctcaaatagccc 717



to top

>emb|X58895.1|UCHISTO U.caupo gene for H2A, H2B, H3, and H4 histones
          Length = 4942

 Score =  127 bits (64), Expect = 2e-26
 Identities = 121/140 (86%)
 Strand = Plus / Minus

                                                                       
Query: 169 agctggatgtccttgggcatgattgcgacccgcttggcgtggatggcgcacaggttggtg 228
           ||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||
Sbjct: 725 agctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacaggttggtg 666

                                                                       
Query: 229 tcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggag 288
           ||||||||||| ||||| | ||| ||||||   |||||||| || ||   ||||||||||
Sbjct: 665 tcctcgaagagaccgaccaagtaggcctcgctagcctcctgaagggccatgacggcggag 606

                               
Query: 289 gactggaagcggaggtcggt 308
             |||||| || ||||||||
Sbjct: 605 ctctggaaacgcaggtcggt 586



to top

>emb|X00593.1|LPH3H4 Lytechinus pictus H3 and H4 gene
          Length = 2029

 Score =  127 bits (64), Expect = 2e-26
 Identities = 133/156 (85%)
 Strand = Plus / Minus

                                                                        
Query: 155  ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
            |||| |||||||| |||||||||||||| |||||||| | ||| ||||| ||||||||||
Sbjct: 1871 ggatacggcgggcaagctggatgtcctttggcatgatggtgacacgcttagcgtggatgg 1812

                                                                        
Query: 215  cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcg 274
            | |||||||||||||||||||| || ||||| | ||| || |||  |||||||||||| |
Sbjct: 1811 cacacaggttggtgtcctcgaaaagaccgaccaagtaagcttcgctggcctcctggagag 1752

                                                
Query: 275  cggagacggcggaggactggaagcggaggtcggtct 310
            |   ||||||||||  |||||||||||| |||||||
Sbjct: 1751 ccatgacggcggagctctggaagcggagctcggtct 1716



to top

>gb|AY521718.1| Romalea sp. BYU_ACOR015 histone H3 (H3) gene, partial cds
          Length = 354

 Score =  127 bits (64), Expect = 2e-26
 Identities = 112/128 (87%)
 Strand = Plus / Minus

                                                                       
Query: 183 gggcatgattgcgacccgcttggcgtggatggcgcacaggttggtgtcctcgaagagccc 242
           ||||||||| | ||| ||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 354 gggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaagaggcc 295

                                                                       
Query: 243 gacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaagcggag 302
           ||||||||||||||||  ||||||||| || ||   ||| || |||  ||||||||| ||
Sbjct: 294 gacgaggtacgcctcgctggcctcctgcagggccatgaccgccgagctctggaagcgcag 235

                   
Query: 303 gtcggtct 310
           ||||||||
Sbjct: 234 gtcggtct 227



to top

>ref|NM_199745.1| Danio rerio zgc:66241 (zgc:66241), mRNA
          Length = 2172

 Score =  127 bits (64), Expect = 2e-26
 Identities = 112/128 (87%)
 Strand = Plus / Minus

                                                                       
Query: 142 gcgcgctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgc 201
           |||||||| ||| ||||||||||||| ||||||||||| ||||||||||| | ||| | |
Sbjct: 419 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgactctc 360

                                                                       
Query: 202 ttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 261
           ||||||||||||||||||||||||||||||||||| || || || || || ||||||  |
Sbjct: 359 ttggcgtggatggcgcacaggttggtgtcctcgaacagaccaaccagataagcctcgctg 300

                   
Query: 262 gcctcctg 269
           ||||||||
Sbjct: 299 gcctcctg 292



to top

>dbj|AK155722.1| Mus musculus B6-derived CD11 +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F730210F11
           product:histone 1, H3h, full insert sequence
          Length = 1806

 Score =  127 bits (64), Expect = 2e-26
 Identities = 139/164 (84%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| | ||||| ||||| ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 430 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 371

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||||||||||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 370 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 311

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| || ||   ||| || |||  ||||||||| ||||||||||
Sbjct: 310 ctgcagagccatgacagccgagctctggaagcgcaggtcggtct 267



to top

>gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, histone 2A-like protein gene,
              hereditary haemochromatosis (HLA-H) gene, RoRet gene, and
              sodium phosphate transporter (NPT3) gene, complete cds
          Length = 246282

 Score =  127 bits (64), Expect = 2e-26
 Identities = 82/88 (93%)
 Strand = Plus / Plus

                                                                          
Query: 155    ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
              ||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||
Sbjct: 120176 ggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggcgtggatgg 120235

                                          
Query: 215    cgcacaggttggtgtcctcgaagagccc 242
              |||||||||| |||||||| || |||||
Sbjct: 120236 cgcacaggttagtgtcctcaaatagccc 120263



 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                          
Query: 157    atgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatggcg 216
              |||||||| |||||||||||||| |||||||| || |  || ||||| || |||||||||
Sbjct: 109390 atgcggcgagcgagctggatgtctttgggcataatagtcactcgcttagcatggatggcg 109331

                                        
Query: 217    cacaggttggtgtcctcgaagagccc 242
              || ||||| |||||||| ||||||||
Sbjct: 109330 caaaggtttgtgtcctcaaagagccc 109305



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 85/103 (82%)
 Strand = Plus / Plus

                                                                         
Query: 155   ggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggcgtggatgg 214
             ||||||| || || |||||||| || ||||||||||| | ||| || || ||||| || |
Sbjct: 95255 ggatgcgacgtgccagctggatatctttgggcatgatggtgacgcgtttagcgtgaatag 95314

                                                        
Query: 215   cgcacaggttggtgtcctcgaagagcccgacgaggtacgcctc 257
             ||||||| |||||||| |||||||| || || ||||| |||||
Sbjct: 95315 cgcacagattggtgtcttcgaagagtcccaccaggtaggcctc 95357



to top

>gb|U62670.1|MMU62670 Mus musculus histone H3.1-I (H3-I) gene, complete cds
          Length = 727

 Score =  127 bits (64), Expect = 2e-26
 Identities = 139/164 (84%)
 Strand = Plus / Minus

                                                                       
Query: 147 ctccccggggatgcggcgggcgagctggatgtccttgggcatgattgcgacccgcttggc 206
           ||||||| | ||||| ||||| ||||||||||||||||||||||| | ||| ||||||||
Sbjct: 548 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 489

                                                                       
Query: 207 gtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 266
           ||||||||||||||||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 488 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 429

                                                       
Query: 267 ctggagcgcggagacggcggaggactggaagcggaggtcggtct 310
           ||| || ||   ||| || |||  ||||||||| ||||||||||
Sbjct: 428 ctgcagagccatgacagccgagctctggaagcgcaggtcggtct 385


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,762,793
Number of Sequences: 3902068
Number of extensions: 1762793
Number of successful extensions: 41931
Number of sequences better than 10.0: 3269
Number of HSP's better than 10.0 without gapping: 3258
Number of HSP's successfully gapped in prelim test: 13
Number of HSP's that attempted gapping in prelim test: 37463
Number of HSP's gapped (non-prelim): 4177
length of query: 310
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 288
effective length of database: 17,147,199,772
effective search space: 4938393534336
effective search space used: 4938393534336
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top