ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast64b05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC129326.3| Mus musculus BAC clone RP23-326H12 from chromosom... 44 0.30
2gb|AC116451.7| Mus musculus chromosome 19, clone RP24-273P9, com... 44 0.30
3emb|AL158044.17| Human DNA sequence from clone RP11-264C14 on ch... 44 0.30
4gb|AC016205.7| Homo sapiens, clone RP11-25C13, complete sequence 44 0.30
5emb|AJ401333.1|SHY401333 Saccharum hybrid cultivar R570 microsat... 44 0.30
6gb|AC159317.3| Mus musculus BAC clone RP23-76I20 from chromosome... 42 1.2
7emb|CR847508.9| Zebrafish DNA sequence from clone DKEY-235E19 in... 42 1.2
8gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome 42 1.2
9gb|AC138306.4| Mus musculus BAC clone RP24-240E9 from 16, comple... 42 1.2
10emb|X17024.1|LM5KDINS Locusta migratoria mRNA for 5-kDa protein ... 42 1.2
11emb|Z29964.1|LMGIRP3 L.migratoria gene for insulin-related pepti... 42 1.2
12gb|AC114600.4| Mus musculus chromosome 5, clone RP23-332O18, com... 40 4.8
13gb|AC112026.4| Rattus norvegicus 19 BAC CH230-105L11 (Children's... 40 4.8
14gb|AC015689.12| Homo sapiens chromosome 11, clone RP11-23F23, co... 40 4.8
15gb|AC025125.15| Homo sapiens, clone RP11-147K16, complete sequence 40 4.8
16gb|AC104076.5| Homo sapiens BAC clone RP11-397C2 from 2, complet... 40 4.8
17gb|AC091132.16| Homo sapiens chromosome 17, clone RP11-798G7, co... 40 4.8
18gb|AC012352.7| Homo sapiens BAC clone RP11-12M21 from 2, complet... 40 4.8
19gb|AC003070.2| Homo sapiens chromosome 17, clone CTB-39G8, compl... 40 4.8
20dbj|AK000023.1| Homo sapiens cDNA FLJ20016 fis, clone ADSE00529 40 4.8
21gb|AC161466.4| Gallus gallus BAC clone CH261-104N11 from chromos... 40 4.8

>gb|AC129326.3| Mus musculus BAC clone RP23-326H12 from chromosome 19, complete
             sequence
          Length = 184128

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 212   atgagaaccacaagtttcttca 233
             ||||||||||||||||||||||
Sbjct: 85294 atgagaaccacaagtttcttca 85273



to top

>gb|AC116451.7| Mus musculus chromosome 19, clone RP24-273P9, complete sequence
          Length = 218079

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 212    atgagaaccacaagtttcttca 233
              ||||||||||||||||||||||
Sbjct: 184501 atgagaaccacaagtttcttca 184480



to top

>emb|AL158044.17| Human DNA sequence from clone RP11-264C14 on chromosome 10 Contains the
             5' end of the gene for a novel protein (MGC10848), the
             ITIH2 gene for inter-alpha (globulin) inhibitor, H2
             polypeptide (H2P), the KIN gene for KIN, antigenic
             determinant of recA protein homolog (mouse), the 3' end of
             the ATP5C1 gene for ATP synthase, H+ transporting,
             mitochondrial F1 complex, gamma polypeptide 1
             (ATP5C,ATP5CL1), a novel gene and two CpG islands,
             complete sequence
          Length = 174361

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 270   ccgcttttgtgttgctgctgtc 291
             ||||||||||||||||||||||
Sbjct: 98280 ccgcttttgtgttgctgctgtc 98259



to top

>gb|AC016205.7| Homo sapiens, clone RP11-25C13, complete sequence
          Length = 167292

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 226   tttcttcacatcctcttcctctgcac 251
             |||||||||||||||| |||||||||
Sbjct: 45055 tttcttcacatcctctacctctgcac 45030



to top

>emb|AJ401333.1|SHY401333 Saccharum hybrid cultivar R570 microsatellite DNA, clone mSSCIR56
          Length = 838

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 99  acatcaaaataattttacatgt 120
           ||||||||||||||||||||||
Sbjct: 289 acatcaaaataattttacatgt 268



to top

>gb|AC159317.3| Mus musculus BAC clone RP23-76I20 from chromosome 16, complete sequence
          Length = 224160

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 95    gggcacatcaaaataattttacatg 119
             |||||||| ||||||||||||||||
Sbjct: 16057 gggcacatgaaaataattttacatg 16081



to top

>emb|CR847508.9| Zebrafish DNA sequence from clone DKEY-235E19 in linkage group 9,
             complete sequence
          Length = 62311

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 155   agaaaaatgacccaacaagtg 175
             |||||||||||||||||||||
Sbjct: 55446 agaaaaatgacccaacaagtg 55426



to top

>gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome
          Length = 3940880

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 235     atcctcttcctctgcacaatatgct 259
               ||||||||| |||||||||||||||
Sbjct: 1796600 atcctcttcttctgcacaatatgct 1796576



to top

>gb|AC138306.4| Mus musculus BAC clone RP24-240E9 from 16, complete sequence
          Length = 170196

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 95    gggcacatcaaaataattttacatg 119
             |||||||| ||||||||||||||||
Sbjct: 57990 gggcacatgaaaataattttacatg 57966



to top

>emb|X17024.1|LM5KDINS Locusta migratoria mRNA for 5-kDa protein precursor flanked by 2
           members of insulin superfamily
          Length = 686

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 102 tcaaaataattttacatgtgcacaa 126
           ||||||||| |||||||||||||||
Sbjct: 645 tcaaaataaatttacatgtgcacaa 669



to top

>emb|Z29964.1|LMGIRP3 L.migratoria gene for insulin-related peptide, fragment 2
          Length = 528

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 102 tcaaaataattttacatgtgcacaa 126
           ||||||||| |||||||||||||||
Sbjct: 435 tcaaaataaatttacatgtgcacaa 459



to top

>gb|AC114600.4| Mus musculus chromosome 5, clone RP23-332O18, complete sequence
          Length = 203401

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 155    agaaaaatgacccaacaagt 174
              ||||||||||||||||||||
Sbjct: 114439 agaaaaatgacccaacaagt 114420



to top

>gb|AC112026.4| Rattus norvegicus 19 BAC CH230-105L11 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 237539

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 92     caagggcacatcaaaataat 111
              ||||||||||||||||||||
Sbjct: 128315 caagggcacatcaaaataat 128296



to top

>gb|AC015689.12| Homo sapiens chromosome 11, clone RP11-23F23, complete sequence
          Length = 182522

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 14     atatttcatttcagtagcatatca 37
              ||||||||||||| ||||||||||
Sbjct: 157302 atatttcatttcaatagcatatca 157279



to top

>gb|AC025125.15| Homo sapiens, clone RP11-147K16, complete sequence
          Length = 157481

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 308   ttcctgagaaaaacagatgt 327
             ||||||||||||||||||||
Sbjct: 71145 ttcctgagaaaaacagatgt 71164



to top

>gb|AC104076.5| Homo sapiens BAC clone RP11-397C2 from 2, complete sequence
          Length = 174622

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 5    gtaaaatgaatatttcattt 24
            ||||||||||||||||||||
Sbjct: 8418 gtaaaatgaatatttcattt 8437



to top

>gb|AC091132.16| Homo sapiens chromosome 17, clone RP11-798G7, complete sequence
          Length = 207611

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 313    gagaaaaacagatgtgaagg 332
              ||||||||||||||||||||
Sbjct: 190550 gagaaaaacagatgtgaagg 190531



to top

>gb|AC012352.7| Homo sapiens BAC clone RP11-12M21 from 2, complete sequence
          Length = 168142

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 239    tcttcctctgcacaatatgctcttgcca 266
              |||||||||| ||| |||||||||||||
Sbjct: 148965 tcttcctctgaacattatgctcttgcca 148938



to top

>gb|AC003070.2| Homo sapiens chromosome 17, clone CTB-39G8, complete sequence
          Length = 107217

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 313   gagaaaaacagatgtgaagg 332
             ||||||||||||||||||||
Sbjct: 31511 gagaaaaacagatgtgaagg 31492



to top

>dbj|AK000023.1| Homo sapiens cDNA FLJ20016 fis, clone ADSE00529
          Length = 1294

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 5   gtaaaatgaatatttcattt 24
           ||||||||||||||||||||
Sbjct: 240 gtaaaatgaatatttcattt 259



to top

>gb|AC161466.4| Gallus gallus BAC clone CH261-104N11 from chromosome ul, complete
              sequence
          Length = 189905

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 7      aaaatgaatatttcatttca 26
              ||||||||||||||||||||
Sbjct: 142646 aaaatgaatatttcatttca 142627


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,551,391
Number of Sequences: 3902068
Number of extensions: 4551391
Number of successful extensions: 120236
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 120170
Number of HSP's gapped (non-prelim): 66
length of query: 358
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 336
effective length of database: 17,147,199,772
effective search space: 5761459123392
effective search space used: 5761459123392
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top