>emb|AL158044.17| Human DNA sequence from clone RP11-264C14 on chromosome 10 Contains the
5' end of the gene for a novel protein (MGC10848), the
ITIH2 gene for inter-alpha (globulin) inhibitor, H2
polypeptide (H2P), the KIN gene for KIN, antigenic
determinant of recA protein homolog (mouse), the 3' end of
the ATP5C1 gene for ATP synthase, H+ transporting,
mitochondrial F1 complex, gamma polypeptide 1
(ATP5C,ATP5CL1), a novel gene and two CpG islands,
complete sequence
Length = 174361
Score = 44.1 bits (22), Expect = 0.30
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 270 ccgcttttgtgttgctgctgtc 291
||||||||||||||||||||||
Sbjct: 98280 ccgcttttgtgttgctgctgtc 98259
>gb|AC161466.4| Gallus gallus BAC clone CH261-104N11 from chromosome ul, complete
sequence
Length = 189905
Score = 40.1 bits (20), Expect = 4.8
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 7 aaaatgaatatttcatttca 26
||||||||||||||||||||
Sbjct: 142646 aaaatgaatatttcatttca 142627
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,551,391
Number of Sequences: 3902068
Number of extensions: 4551391
Number of successful extensions: 120236
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 120170
Number of HSP's gapped (non-prelim): 66
length of query: 358
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 336
effective length of database: 17,147,199,772
effective search space: 5761459123392
effective search space used: 5761459123392
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)