ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbast62b04 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X15286.1|HVDHN17 Barley mRNA for dehydrin (dhn17) Length = 812 Score = 731 bits (369), Expect = 0.0 Identities = 378/381 (99%) Strand = Plus / Minus Query: 48 gtactaccaaaagaaaacacacactcgacgttcagagaacaaaacgtcccggcgggtaca 107 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 765 gtactaccaaaagaaaatacacactcgacgttcagagaacaaaacgtcccggcgggtaca 706 Query: 108 tacaagcaacccaaattcaagtccaccaaactcagaactcaggtattacaagtgagcaag 167 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 705 tacaagcaacccaaattcaagtccaccaaactcagaactcaggtattacaagtgagcaag 646 Query: 168 ctcactttatttgcggaagttttactgcatctccatcttattattctgcaaggtagccag 227 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 645 ctcactttatttgcggaagttttactgcatctccatcttattattctgcaaggtagccag 586 Query: 228 accggcacctcaagtttcaagtagctgccgcaggccgggctcagtgctgtccgggcagct 287 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 585 accggcacctcaagtttcaagtagctgccgctggccgggctcagtgctgtccgggcagct 526 Query: 288 tctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtgccatgcgccc 347 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 525 tctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtgccatgcgccc 466 Query: 348 ccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcgc 407 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 465 ccgtgccggtcattccggtgtgtccctgctgcccataggtgccgccggtggcggtggcgc 406 Query: 408 catgctccccggtgccggtca 428 ||||||||||||||||||||| Sbjct: 405 catgctccccggtgccggtca 385 Score = 87.7 bits (44), Expect = 3e-14 Identities = 56/60 (93%) Strand = Plus / Minus Query: 337 gccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggt 396 ||||||| |||| ||||||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 407 gccatgctccccggtgccggtcattccggtgtgtccgtgctgcccataggtgccaccggt 348 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||||||| ||| |||||||||| Sbjct: 325 ccggggagcttctccttgatcttgtccttgaggcccttcttc 284
>gb|AF043089.1|AF043089 Hordeum vulgare dehydrin 3 (dhn3) gene, complete cds Length = 1560 Score = 710 bits (358), Expect = 0.0 Identities = 377/382 (98%), Gaps = 1/382 (0%) Strand = Plus / Minus Query: 48 gtactaccaa-aagaaaacacacactcgacgttcagagaacaaaacgtcccggcgggtac 106 |||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 1544 gtactaccaagaagaaaatacacactcgacgttcagagaacaaaacgtcccggcgggtac 1485 Query: 107 atacaagcaacccaaattcaagtccaccaaactcagaactcaggtattacaagtgagcaa 166 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1484 atacaagcaacccaaattcaagtccaccaaactcagaactcaggtattacaagtgagcaa 1425 Query: 167 gctcactttatttgcggaagttttactgcatctccatcttattattctgcaaggtagcca 226 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1424 gctcactttatttgcggaagttttactgcatctccatcttattattctgcaaggtagcca 1365 Query: 227 gaccggcacctcaagtttcaagtagctgccgcaggccgggctcagtgctgtccgggcagc 286 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 1364 gaccggcacctcaagtttcaagtagctgccgctggccgggctcagtgctgtccgggcagc 1305 Query: 287 ttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtgccatgcgcc 346 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 1304 ttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtgctatgcgcc 1245 Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 1244 cccgtgccggtcattccggtgtgtccctgctgcccataggtgccgccggtggcggtggcg 1185 Query: 407 ccatgctccccggtgccggtca 428 |||||||||||||||||||||| Sbjct: 1184 ccatgctccccggtgccggtca 1163 Score = 87.7 bits (44), Expect = 3e-14 Identities = 56/60 (93%) Strand = Plus / Minus Query: 337 gccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggt 396 ||||||| |||| ||||||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 1185 gccatgctccccggtgccggtcattccggtgtgtccgtgctgcccataggtgccaccggt 1126 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||||||| ||| |||||||||| Sbjct: 1103 ccggggagcttctccttgatcttgtccttgaggcccttcttc 1062
>gb|AF181453.1|AF181453 Hordeum vulgare dehydrin (Dhn3) gene, complete cds Length = 1575 Score = 700 bits (353), Expect = 0.0 Identities = 365/369 (98%) Strand = Plus / Minus Query: 60 gaaaacacacactcgacgttcagagaacaaaacgtcccggcgggtacatacaagcaaccc 119 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1568 gaaaatacacactcgacgttcagagaacaaaacgtcccggcgggtacatacaagcaaccc 1509 Query: 120 aaattcaagtccaccaaactcagaactcaggtattacaagtgagcaagctcactttattt 179 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1508 aaattcaagtccaccaaactcagaactcaggtattacaagtgagcaagctcactttattt 1449 Query: 180 gcggaagttttactgcatctccatcttattattctgcaaggtagccagaccggcacctca 239 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 1448 gcggaagttttactgcatctccatctaattattctgcaaggtagccagaccggcacctca 1389 Query: 240 agtttcaagtagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatct 299 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 1388 agtttcaagtagctgccgctggccgggctcagtgctgtccgggcagcttctccttgatct 1329 Query: 300 tgtccatgatgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtca 359 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1328 tgtccatgatgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtca 1269 Query: 360 ttccggtgtgtccttgctgcccataggtgccgccggtggcggtggcgccatgctccccgg 419 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1268 ttccggtgtgtccctgctgcccataggtgccgccggtggcggtggcgccatgctccccgg 1209 Query: 420 tgccggtca 428 ||||||||| Sbjct: 1208 tgccggtca 1200 Score = 87.7 bits (44), Expect = 3e-14 Identities = 56/60 (93%) Strand = Plus / Minus Query: 337 gccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggt 396 ||||||| |||| ||||||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 1222 gccatgctccccggtgccggtcattccggtgtgtccgtgctgcccataggtgccaccggt 1163 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||||||| ||| |||||||||| Sbjct: 1140 ccggggagcttctccttgatcttgtccttgaggcccttcttc 1099
>gb|AF031248.1|AF031248 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-3) mRNA, complete cds Length = 793 Score = 313 bits (158), Expect = 3e-82 Identities = 222/242 (91%), Gaps = 1/242 (0%) Strand = Plus / Minus Query: 100 cgggtacatacaagcaacccaaattcaagtccaccaaactcagaactcaggtattacaag 159 |||||||||||||||| ||||||||||||||||||| |||| |||||||| |||||||| Sbjct: 652 cgggtacatacaagcagcccaaattcaagtccaccagactcggaactcagacattacaag 593 Query: 160 tgagcaagctcactttatttgcggaagttttactgcatctccatcttattattctgcaa- 218 ||||| |||||||||||||| ||||||| ||||||||||||||||||||||||||||| Sbjct: 592 tgagctagctcactttatttcgggaagttatactgcatctccatcttattattctgcaaa 533 Query: 219 ggtagccagaccggcacctcaagtttcaagtagctgccgcaggccgggctcagtgctgtc 278 ||| |||||| |||| |||||| | || |||||||||||| ||||||||||||||||||| Sbjct: 532 ggtggccagatcggcgcctcaactctcgagtagctgccgcgggccgggctcagtgctgtc 473 Query: 279 cgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtgc 338 ||||||||||||||||||||||||||||||||||||||||||| || || |||||||||| Sbjct: 472 cgggcagcttctccttgatcttgtccatgatgcccttcttctcaccggtgccgtcggtgc 413 Query: 339 ca 340 || Sbjct: 412 ca 411 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 296 agcttctccttgatcttatccttgattcccttcttc 261 Score = 40.1 bits (20), Expect = 5.7 Identities = 35/40 (87%) Strand = Plus / Minus Query: 358 cattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||||||| |||| || ||| ||||||||||| Sbjct: 408 cattccggtgtgtcccggctggccgtagttgccgccggtg 369
>emb|X78429.1|TDDEH16 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd16 Length = 814 Score = 303 bits (153), Expect = 2e-79 Identities = 263/295 (89%), Gaps = 6/295 (2%) Strand = Plus / Minus Query: 48 gtactaccaaaagaaaacacacac-tcgacgttcagagaacaaaacgtcccggcgggtac 106 |||| |||||||||||| ||||| |||| || ||||| ||||||| |||||| |||| Sbjct: 733 gtacaaccaaaagaaaattcacacatcgaagtacagagcacaaaacatcccgg---gtac 677 Query: 107 atacaagcaacccaaattcaagtccaccaaactcagaactcaggtattacaagtgagcaa 166 ||||||||| ||||||||||||||||||| ||||||||||||| || ||||||||| | Sbjct: 676 atacaagcagcccaaattcaagtccaccagactcagaactcagacatcacaagtgagta- 618 Query: 167 gctcactttatttgcggaagttttactgcatctccatcttattattctgcaa-ggtagcc 225 ||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| ||| Sbjct: 617 gctcactttatttcgggaagttttactgcatctccatcttattattctgcaaaggtggcc 558 Query: 226 agaccggcacctcaagtttcaagtagctgccgcaggccgggctcagtgctgtccgggcag 285 ||| ||||||||||| | || ||||||||| || |||||||||||||||||||||||||| Sbjct: 557 agatcggcacctcaactctcgagtagctgctgcgggccgggctcagtgctgtccgggcag 498 Query: 286 cttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtgcca 340 |||||||||||||||||||||||||||||||||||| || || | |||||||||| Sbjct: 497 cttctccttgatcttgtccatgatgcccttcttctcaccggtgctgtcggtgcca 443 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttct 320 |||||||| |||||||| ||| ||||||||||||||| Sbjct: 328 agcttctctttgatcttatccttgatgcccttcttct 292
>gb|AY895929.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin 7 (Dhn7) gene, complete cds Length = 1370 Score = 190 bits (96), Expect = 3e-45 Identities = 276/331 (83%), Gaps = 15/331 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| |||||||||||| |||| Sbjct: 1046 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaaacc 991 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 ||||||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 990 gagaactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 931 Query: 198 ctccatcttattattctgca-----aggtagccagaccggcacctc--aagtttc--aag 248 || ||||||||| ||||||| |||| ||||||||||||| || |||| ||| Sbjct: 930 cttcatcttatttttctgcagaggtgggtacgtagaccggcacctcttaactttcacaag 871 Query: 249 tagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatga 308 ||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 870 taggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtccatga 811 Query: 309 tgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgt 368 |||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||||||| Sbjct: 810 tgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccggtgt 751 Query: 369 gtccttgctgcccataggtgccgccggtggc 399 |||| ||||||| ||||| ||||| ||||| Sbjct: 750 gtcccggctgcccgtaggtaccgcctgtggc 720 Score = 75.8 bits (38), Expect = 1e-10 Identities = 50/54 (92%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 706 gcccccgtgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 653 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 583 agcttctccttgatcttatccttgatacccttcttc 548
>gb|AY895925.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 7 (Dhn7) gene, complete cds Length = 1373 Score = 190 bits (96), Expect = 3e-45 Identities = 276/331 (83%), Gaps = 15/331 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| |||||||||||| |||| Sbjct: 1049 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaaacc 994 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 ||||||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 993 gagaactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 934 Query: 198 ctccatcttattattctgca-----aggtagccagaccggcacctc--aagtttc--aag 248 || ||||||||| ||||||| |||| ||||||||||||| || |||| ||| Sbjct: 933 cttcatcttatttttctgcagaggtgggtacgtagaccggcacctcttaactttcacaag 874 Query: 249 tagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatga 308 ||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 873 taggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtccatga 814 Query: 309 tgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgt 368 |||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||||||| Sbjct: 813 tgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccggtgt 754 Query: 369 gtccttgctgcccataggtgccgccggtggc 399 |||| ||||||| ||||| ||||| ||||| Sbjct: 753 gtcccggctgcccgtaggtaccgcctgtggc 723 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 |||||| |||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 709 gcccccatgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 656 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 586 agcttctccttgatcttatccttgatacccttcttc 551
>gb|AY895924.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 7 (Dhn7) gene, complete cds Length = 1375 Score = 190 bits (96), Expect = 3e-45 Identities = 276/331 (83%), Gaps = 15/331 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| |||||||||||| |||| Sbjct: 1051 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaaacc 996 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 ||||||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 995 gagaactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 936 Query: 198 ctccatcttattattctgca-----aggtagccagaccggcacctc--aagtttc--aag 248 || ||||||||| ||||||| |||| ||||||||||||| || |||| ||| Sbjct: 935 cttcatcttatttttctgcagaggtgggtacgtagaccggcacctcttaactttcacaag 876 Query: 249 tagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatga 308 ||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 875 taggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtccatga 816 Query: 309 tgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgt 368 |||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||||||| Sbjct: 815 tgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccggtgt 756 Query: 369 gtccttgctgcccataggtgccgccggtggc 399 |||| ||||||| ||||| ||||| ||||| Sbjct: 755 gtcccggctgcccgtaggtaccgcctgtggc 725 Score = 75.8 bits (38), Expect = 1e-10 Identities = 50/54 (92%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 711 gcccccgtgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 658 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 588 agcttctccttgatcttatccttgatacccttcttc 553
>gb|AY895921.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 7 (Dhn7) gene, complete cds Length = 1373 Score = 190 bits (96), Expect = 3e-45 Identities = 276/331 (83%), Gaps = 15/331 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| |||||||||||| |||| Sbjct: 1049 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaaacc 994 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 ||||||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 993 gagaactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 934 Query: 198 ctccatcttattattctgca-----aggtagccagaccggcacctc--aagtttc--aag 248 || ||||||||| ||||||| |||| ||||||||||||| || |||| ||| Sbjct: 933 cttcatcttatttttctgcagaggtgggtacgtagaccggcacctcttaactttcacaag 874 Query: 249 tagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatga 308 ||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 873 taggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtccatga 814 Query: 309 tgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgt 368 |||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||||||| Sbjct: 813 tgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccggtgt 754 Query: 369 gtccttgctgcccataggtgccgccggtggc 399 |||| ||||||| ||||| ||||| ||||| Sbjct: 753 gtcccggctgcccgtaggtaccgcctgtggc 723 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 |||||| |||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 709 gcccccatgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 656 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 586 agcttctccttgatcttatccttgatacccttcttc 551
>gb|AY895920.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 7 (Dhn7) gene, complete cds Length = 1363 Score = 190 bits (96), Expect = 3e-45 Identities = 276/331 (83%), Gaps = 15/331 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| |||||||||||| |||| Sbjct: 1039 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaaacc 984 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 ||||||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 983 gagaactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 924 Query: 198 ctccatcttattattctgca-----aggtagccagaccggcacctc--aagtttc--aag 248 || ||||||||| ||||||| |||| ||||||||||||| || |||| ||| Sbjct: 923 cttcatcttatttttctgcagaggtgggtacgtagaccggcacctcttaactttcacaag 864 Query: 249 tagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatga 308 ||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 863 taggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtccatga 804 Query: 309 tgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgt 368 |||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||||||| Sbjct: 803 tgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccggtgt 744 Query: 369 gtccttgctgcccataggtgccgccggtggc 399 |||| ||||||| ||||| ||||| ||||| Sbjct: 743 gtcccggctgcccgtaggtaccgcctgtggc 713 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||||||||| || ||||| || |||||||||||||||| ||||||| Sbjct: 699 gcccccgtgccggtcatcccagtgtgaccctgctgcccataggtgctgccggtg 646 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 576 agcttctccttgatcttatccttgatacccttcttc 541
>gb|AY895919.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 7 (Dhn7) gene, complete cds Length = 1366 Score = 190 bits (96), Expect = 3e-45 Identities = 276/331 (83%), Gaps = 15/331 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| |||||||||||| |||| Sbjct: 1042 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaaacc 987 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 ||||||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 986 gagaactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 927 Query: 198 ctccatcttattattctgca-----aggtagccagaccggcacctc--aagtttc--aag 248 || ||||||||| ||||||| |||| ||||||||||||| || |||| ||| Sbjct: 926 cttcatcttatttttctgcagaggtgggtacgtagaccggcacctcttaactttcacaag 867 Query: 249 tagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatga 308 ||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 866 taggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtccatga 807 Query: 309 tgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgt 368 |||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||||||| Sbjct: 806 tgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccggtgt 747 Query: 369 gtccttgctgcccataggtgccgccggtggc 399 |||| ||||||| ||||| ||||| ||||| Sbjct: 746 gtcccggctgcccgtaggtaccgcctgtggc 716 Score = 75.8 bits (38), Expect = 1e-10 Identities = 50/54 (92%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 702 gcccccgtgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 649 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 579 agcttctccttgatcttatccttgatacccttcttc 544
>gb|AY895918.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 7 (Dhn7) gene, complete cds Length = 1343 Score = 190 bits (96), Expect = 3e-45 Identities = 276/331 (83%), Gaps = 15/331 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| |||||||||||| |||| Sbjct: 1019 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaaacc 964 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 ||||||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 963 gagaactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 904 Query: 198 ctccatcttattattctgca-----aggtagccagaccggcacctc--aagtttc--aag 248 || ||||||||| ||||||| |||| ||||||||||||| || |||| ||| Sbjct: 903 cttcatcttatttttctgcagaggtgggtacgtagaccggcacctcttaactttcacaag 844 Query: 249 tagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatga 308 ||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 843 taggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtccatga 784 Query: 309 tgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgt 368 |||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||||||| Sbjct: 783 tgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccggtgt 724 Query: 369 gtccttgctgcccataggtgccgccggtggc 399 |||| ||||||| ||||| ||||| ||||| Sbjct: 723 gtcccggctgcccgtaggtaccgcctgtggc 693 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||| ||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 679 gcccctgtgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 626 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 556 agcttctccttgatcttatccttgatacccttcttc 521
>gb|AY895916.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 7 (Dhn7) gene, complete cds Length = 1343 Score = 190 bits (96), Expect = 3e-45 Identities = 276/331 (83%), Gaps = 15/331 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| |||||||||||| |||| Sbjct: 1019 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaaacc 964 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 ||||||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 963 gagaactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 904 Query: 198 ctccatcttattattctgca-----aggtagccagaccggcacctc--aagtttc--aag 248 || ||||||||| ||||||| |||| ||||||||||||| || |||| ||| Sbjct: 903 cttcatcttatttttctgcagaggtgggtacgtagaccggcacctcttaactttcacaag 844 Query: 249 tagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatga 308 ||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 843 taggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtccatga 784 Query: 309 tgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgt 368 |||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||||||| Sbjct: 783 tgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccggtgt 724 Query: 369 gtccttgctgcccataggtgccgccggtggc 399 |||| ||||||| ||||| ||||| ||||| Sbjct: 723 gtcccggctgcccgtaggtaccgcctgtggc 693 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||| ||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 679 gcccctgtgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 626 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 556 agcttctccttgatcttatccttgatacccttcttc 521
>gb|AY895915.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 7 (Dhn7) gene, complete cds Length = 1366 Score = 190 bits (96), Expect = 3e-45 Identities = 276/331 (83%), Gaps = 15/331 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| |||||||||||| |||| Sbjct: 1042 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaaacc 987 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 ||||||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 986 gagaactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 927 Query: 198 ctccatcttattattctgca-----aggtagccagaccggcacctc--aagtttc--aag 248 || ||||||||| ||||||| |||| ||||||||||||| || |||| ||| Sbjct: 926 cttcatcttatttttctgcagaggtgggtacgtagaccggcacctcttaactttcacaag 867 Query: 249 tagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatga 308 ||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 866 taggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtccatga 807 Query: 309 tgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgt 368 |||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||||||| Sbjct: 806 tgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccggtgt 747 Query: 369 gtccttgctgcccataggtgccgccggtggc 399 |||| ||||||| ||||| ||||| ||||| Sbjct: 746 gtcccggctgcccgtaggtaccgcctgtggc 716 Score = 75.8 bits (38), Expect = 1e-10 Identities = 50/54 (92%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 702 gcccccgtgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 649 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 579 agcttctccttgatcttatccttgatacccttcttc 544
>gb|AY895914.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 7 (Dhn7) gene, complete cds Length = 1366 Score = 190 bits (96), Expect = 3e-45 Identities = 276/331 (83%), Gaps = 15/331 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| |||||||||||| |||| Sbjct: 1042 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaaacc 987 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 ||||||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 986 gagaactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 927 Query: 198 ctccatcttattattctgca-----aggtagccagaccggcacctc--aagtttc--aag 248 || ||||||||| ||||||| |||| ||||||||||||| || |||| ||| Sbjct: 926 cttcatcttatttttctgcagaggtgggtacgtagaccggcacctcttaactttcacaag 867 Query: 249 tagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatga 308 ||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 866 taggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtccatga 807 Query: 309 tgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgt 368 |||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||||||| Sbjct: 806 tgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccggtgt 747 Query: 369 gtccttgctgcccataggtgccgccggtggc 399 |||| ||||||| ||||| ||||| ||||| Sbjct: 746 gtcccggctgcccgtaggtaccgcctgtggc 716 Score = 75.8 bits (38), Expect = 1e-10 Identities = 50/54 (92%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 702 gcccccgtgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 649 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 579 agcttctccttgatcttatccttgatacccttcttc 544
>gb|AY895912.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 7 (Dhn7) gene, complete cds Length = 1343 Score = 190 bits (96), Expect = 3e-45 Identities = 276/331 (83%), Gaps = 15/331 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| |||||||||||| |||| Sbjct: 1019 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaaacc 964 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 ||||||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 963 gagaactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 904 Query: 198 ctccatcttattattctgca-----aggtagccagaccggcacctc--aagtttc--aag 248 || ||||||||| ||||||| |||| ||||||||||||| || |||| ||| Sbjct: 903 cttcatcttatttttctgcagaggtgggtacgtagaccggcacctcttaactttcacaag 844 Query: 249 tagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatga 308 ||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 843 taggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtccatga 784 Query: 309 tgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgt 368 |||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||||||| Sbjct: 783 tgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccggtgt 724 Query: 369 gtccttgctgcccataggtgccgccggtggc 399 |||| ||||||| ||||| ||||| ||||| Sbjct: 723 gtcccggctgcccgtaggtaccgcctgtggc 693 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||| ||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 679 gcccctgtgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 626 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 556 agcttctccttgatcttatccttgatacccttcttc 521
>gb|AY895911.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 7 (Dhn7) gene, complete cds Length = 1343 Score = 190 bits (96), Expect = 3e-45 Identities = 276/331 (83%), Gaps = 15/331 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| |||||||||||| |||| Sbjct: 1019 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaaacc 964 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 ||||||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 963 gagaactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 904 Query: 198 ctccatcttattattctgca-----aggtagccagaccggcacctc--aagtttc--aag 248 || ||||||||| ||||||| |||| ||||||||||||| || |||| ||| Sbjct: 903 cttcatcttatttttctgcagaggtgggtacgtagaccggcacctcttaactttcacaag 844 Query: 249 tagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatga 308 ||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 843 taggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtccatga 784 Query: 309 tgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgt 368 |||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||||||| Sbjct: 783 tgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccggtgt 724 Query: 369 gtccttgctgcccataggtgccgccggtggc 399 |||| ||||||| ||||| ||||| ||||| Sbjct: 723 gtcccggctgcccgtaggtaccgcctgtggc 693 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||| ||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 679 gcccctgtgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 626 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 556 agcttctccttgatcttatccttgatacccttcttc 521
>gb|AY895910.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 7 (Dhn7) gene, complete cds Length = 1363 Score = 190 bits (96), Expect = 3e-45 Identities = 276/331 (83%), Gaps = 15/331 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| |||||||||||| |||| Sbjct: 1039 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaaacc 984 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 ||||||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 983 gagaactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 924 Query: 198 ctccatcttattattctgca-----aggtagccagaccggcacctc--aagtttc--aag 248 || ||||||||| ||||||| |||| ||||||||||||| || |||| ||| Sbjct: 923 cttcatcttatttttctgcagaggtgggtacgtagaccggcacctcttaactttcacaag 864 Query: 249 tagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatga 308 ||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 863 taggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtccatga 804 Query: 309 tgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgt 368 |||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||||||| Sbjct: 803 tgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccggtgt 744 Query: 369 gtccttgctgcccataggtgccgccggtggc 399 |||| ||||||| ||||| ||||| ||||| Sbjct: 743 gtcccggctgcccgtaggtaccgcctgtggc 713 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||||||||| || ||||| || |||||||||||||||| ||||||| Sbjct: 699 gcccccgtgccggtcatcccagtgtgaccctgctgcccataggtgctgccggtg 646 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 576 agcttctccttgatcttatccttgatacccttcttc 541
>gb|AY895907.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 7 (Dhn7) gene, complete cds Length = 1343 Score = 190 bits (96), Expect = 3e-45 Identities = 276/331 (83%), Gaps = 15/331 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| |||||||||||| |||| Sbjct: 1019 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaaacc 964 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 ||||||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 963 gagaactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 904 Query: 198 ctccatcttattattctgca-----aggtagccagaccggcacctc--aagtttc--aag 248 || ||||||||| ||||||| |||| ||||||||||||| || |||| ||| Sbjct: 903 cttcatcttatttttctgcagaggtgggtacgtagaccggcacctcttaactttcacaag 844 Query: 249 tagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatga 308 ||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 843 taggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtccatga 784 Query: 309 tgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgt 368 |||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||||||| Sbjct: 783 tgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccggtgt 724 Query: 369 gtccttgctgcccataggtgccgccggtggc 399 |||| ||||||| ||||| ||||| ||||| Sbjct: 723 gtcccggctgcccgtaggtaccgcctgtggc 693 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||| ||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 679 gcccctgtgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 626 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 556 agcttctccttgatcttatccttgatacccttcttc 521
>gb|AY895906.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 7 (Dhn7) gene, complete cds Length = 1342 Score = 190 bits (96), Expect = 3e-45 Identities = 276/331 (83%), Gaps = 15/331 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| |||||||||||| |||| Sbjct: 1019 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaaacc 964 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 ||||||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 963 gagaactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 904 Query: 198 ctccatcttattattctgca-----aggtagccagaccggcacctc--aagtttc--aag 248 || ||||||||| ||||||| |||| ||||||||||||| || |||| ||| Sbjct: 903 cttcatcttatttttctgcagaggtgggtacgtagaccggcacctcttaactttcacaag 844 Query: 249 tagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatga 308 ||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 843 taggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtccatga 784 Query: 309 tgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgt 368 |||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||||||| Sbjct: 783 tgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccggtgt 724 Query: 369 gtccttgctgcccataggtgccgccggtggc 399 |||| ||||||| ||||| ||||| ||||| Sbjct: 723 gtcccggctgcccgtaggtaccgcctgtggc 693 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||| ||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 679 gcccctgtgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 626 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 556 agcttctccttgatcttatccttgatacccttcttc 521
>gb|AY895905.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 7 (Dhn7) gene, complete cds Length = 1363 Score = 190 bits (96), Expect = 3e-45 Identities = 276/331 (83%), Gaps = 15/331 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| |||||||||||| |||| Sbjct: 1039 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaaacc 984 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 ||||||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 983 gagaactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 924 Query: 198 ctccatcttattattctgca-----aggtagccagaccggcacctc--aagtttc--aag 248 || ||||||||| ||||||| |||| ||||||||||||| || |||| ||| Sbjct: 923 cttcatcttatttttctgcagaggtgggtacgtagaccggcacctcttaactttcacaag 864 Query: 249 tagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatga 308 ||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 863 taggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtccatga 804 Query: 309 tgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgt 368 |||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||||||| Sbjct: 803 tgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccggtgt 744 Query: 369 gtccttgctgcccataggtgccgccggtggc 399 |||| ||||||| ||||| ||||| ||||| Sbjct: 743 gtcccggctgcccgtaggtaccgcctgtggc 713 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||||||||| || ||||| || |||||||||||||||| ||||||| Sbjct: 699 gcccccgtgccggtcatcccagtgtgaccctgctgcccataggtgctgccggtg 646 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 576 agcttctccttgatcttatccttgatacccttcttc 541
>gb|AY895928.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 7 (Dhn7) gene, complete cds Length = 1332 Score = 182 bits (92), Expect = 6e-43 Identities = 275/331 (83%), Gaps = 15/331 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| ||||||||||| |||| Sbjct: 1008 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccataaaacc 953 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 ||||||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 952 gagaactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 893 Query: 198 ctccatcttattattctgca-----aggtagccagaccggcacctc--aagtttc--aag 248 || ||||||||| ||||||| |||| ||||||||||||| || |||| ||| Sbjct: 892 cttcatcttatttttctgcagaggtgggtacgtagaccggcacctcttaactttcacaag 833 Query: 249 tagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatga 308 ||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 832 taggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtccatga 773 Query: 309 tgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgt 368 |||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||||||| Sbjct: 772 tgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccggtgt 713 Query: 369 gtccttgctgcccataggtgccgccggtggc 399 |||| ||||||| ||||| ||||| ||||| Sbjct: 712 gtcccggctgcccgtaggtaccgcctgtggc 682 Score = 75.8 bits (38), Expect = 1e-10 Identities = 50/54 (92%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 668 gcccccgtgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 615 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 545 agcttctccttgatcttatccttgatacccttcttc 510
>gb|AY895923.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 7 (Dhn7) gene, complete cds Length = 1364 Score = 182 bits (92), Expect = 6e-43 Identities = 275/331 (83%), Gaps = 15/331 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| |||||||||||| |||| Sbjct: 1042 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaaacc 987 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 || |||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 986 gagcactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 927 Query: 198 ctccatcttattattctgca-----aggtagccagaccggcacctc--aagtttc--aag 248 || ||||||||| ||||||| |||| ||||||||||||| || |||| ||| Sbjct: 926 cttcatcttatttttctgcagaggtgggtacgtagaccggcacctcttaactttcacaag 867 Query: 249 tagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatga 308 ||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 866 taggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtccatga 807 Query: 309 tgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgt 368 |||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||||||| Sbjct: 806 tgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccggtgt 747 Query: 369 gtccttgctgcccataggtgccgccggtggc 399 |||| ||||||| ||||| ||||| ||||| Sbjct: 746 gtcccggctgcccgtaggtaccgcctgtggc 716 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 |||||||||||||| || ||||| || |||||||||||||||| ||||||| Sbjct: 699 cccgtgccggtcatcccagtgtgaccctgctgcccataggtgctgccggtg 649 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 579 agcttctccttgatcttatccttgatacccttcttc 544
>gb|AY895922.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 7 (Dhn7) gene, complete cds Length = 1364 Score = 182 bits (92), Expect = 6e-43 Identities = 275/331 (83%), Gaps = 15/331 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| |||||||||||| |||| Sbjct: 1042 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaaacc 987 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 || |||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 986 gagcactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 927 Query: 198 ctccatcttattattctgca-----aggtagccagaccggcacctc--aagtttc--aag 248 || ||||||||| ||||||| |||| ||||||||||||| || |||| ||| Sbjct: 926 cttcatcttatttttctgcagaggtgggtacgtagaccggcacctcttaactttcacaag 867 Query: 249 tagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatga 308 ||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 866 taggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtccatga 807 Query: 309 tgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgt 368 |||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||||||| Sbjct: 806 tgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccggtgt 747 Query: 369 gtccttgctgcccataggtgccgccggtggc 399 |||| ||||||| ||||| ||||| ||||| Sbjct: 746 gtcccggctgcccgtaggtaccgcctgtggc 716 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 |||||||||||||| || ||||| || |||||||||||||||| ||||||| Sbjct: 699 cccgtgccggtcatcccagtgtgaccctgctgcccataggtgctgccggtg 649 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 579 agcttctccttgatcttatccttgatacccttcttc 544
>gb|AF043092.1|AF043092 Hordeum vulgare dehydrin 7 (dhn7) gene, complete cds Length = 2127 Score = 182 bits (92), Expect = 6e-43 Identities = 275/331 (83%), Gaps = 15/331 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| ||||||||||| |||| Sbjct: 1375 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccataaaacc 1320 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 ||||||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 1319 gagaactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 1260 Query: 198 ctccatcttattattctgca-----aggtagccagaccggcacctc--aagtttc--aag 248 || ||||||||| ||||||| |||| ||||||||||||| || |||| ||| Sbjct: 1259 cttcatcttatttttctgcagaggtgggtacgtagaccggcacctcttaactttcacaag 1200 Query: 249 tagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatga 308 ||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 1199 taggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtccatga 1140 Query: 309 tgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgt 368 |||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||||||| Sbjct: 1139 tgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccggtgt 1080 Query: 369 gtccttgctgcccataggtgccgccggtggc 399 |||| ||||||| ||||| ||||| ||||| Sbjct: 1079 gtcccggctgcccgtaggtaccgcctgtggc 1049 Score = 75.8 bits (38), Expect = 1e-10 Identities = 50/54 (92%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 1035 gcccccgtgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 982 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 912 agcttctccttgatcttatccttgatacccttcttc 877
>gb|AY895930.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 7 (Dhn7) gene, complete cds Length = 1370 Score = 172 bits (87), Expect = 6e-40 Identities = 138/155 (89%) Strand = Plus / Minus Query: 245 caagtagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtcc 304 ||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 874 caagtaggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtcc 815 Query: 305 atgatgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccg 364 |||||||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||| Sbjct: 814 atgatgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccg 755 Query: 365 gtgtgtccttgctgcccataggtgccgccggtggc 399 |||||||| ||||||| ||||| ||||| ||||| Sbjct: 754 gtgtgtcccggctgcccgtaggtaccgcctgtggc 720 Score = 75.8 bits (38), Expect = 1e-10 Identities = 50/54 (92%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 706 gcccccgtgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 653 Score = 69.9 bits (35), Expect = 6e-09 Identities = 116/140 (82%), Gaps = 6/140 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| |||||||||||| |||| Sbjct: 1046 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaaacc 991 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 ||||||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 990 gagaactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 931 Query: 198 ctccatcttattattctgca 217 || ||||||||| ||||||| Sbjct: 930 cttcatcttatttttctgca 911 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 583 agcttctccttgatcttatccttgatacccttcttc 548
>gb|AY895927.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 7 (Dhn7) gene, complete cds Length = 1357 Score = 172 bits (87), Expect = 6e-40 Identities = 138/155 (89%) Strand = Plus / Minus Query: 245 caagtagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtcc 304 ||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 861 caagtaggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtcc 802 Query: 305 atgatgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccg 364 |||||||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||| Sbjct: 801 atgatgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccg 742 Query: 365 gtgtgtccttgctgcccataggtgccgccggtggc 399 |||||||| ||||||| ||||| ||||| ||||| Sbjct: 741 gtgtgtcccggctgcccgtaggtaccgcctgtggc 707 Score = 75.8 bits (38), Expect = 1e-10 Identities = 50/54 (92%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 693 gcccccgtgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 640 Score = 73.8 bits (37), Expect = 4e-10 Identities = 118/142 (83%), Gaps = 6/142 (4%) Strand = Plus / Minus Query: 77 gttcagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaa 136 |||||||| |||||||||||||| || |||||||| || ||| |||||||||||| || Sbjct: 1036 gttcagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaa 981 Query: 137 actcagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactg 194 || ||||||||| ||| ||| |||| | |||||||||| ||| ||||||||||||| Sbjct: 980 accgagaactcagatatcacatgtgaactaaagctcacttcattacgggaagttttactg 921 Query: 195 catctccatcttattattctgc 216 |||| ||||||||| |||||| Sbjct: 920 tatcttcatcttatttttctgc 899 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| |||| ||||||||| Sbjct: 576 ccggggagcttctccttgatcttatccttgatacccttcttc 535
>gb|AY895926.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 7 (Dhn7) gene, complete cds Length = 1370 Score = 172 bits (87), Expect = 6e-40 Identities = 138/155 (89%) Strand = Plus / Minus Query: 245 caagtagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtcc 304 ||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 874 caagtaggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtcc 815 Query: 305 atgatgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccg 364 |||||||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||| Sbjct: 814 atgatgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccg 755 Query: 365 gtgtgtccttgctgcccataggtgccgccggtggc 399 |||||||| ||||||| ||||| ||||| ||||| Sbjct: 754 gtgtgtcccggctgcccgtaggtaccgcctgtggc 720 Score = 81.8 bits (41), Expect = 2e-12 Identities = 119/142 (83%), Gaps = 6/142 (4%) Strand = Plus / Minus Query: 77 gttcagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaa 136 |||||||| |||||||||||||| || |||||||| || ||| |||||||||||| || Sbjct: 1049 gttcagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaa 994 Query: 137 actcagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactg 194 || ||||||||| ||| ||| |||| | |||||||||| |||| ||||||||||||| Sbjct: 993 accgagaactcagatatcacatgtgaactaaagctcacttcatttcgggaagttttactg 934 Query: 195 catctccatcttattattctgc 216 |||| ||||||||| |||||| Sbjct: 933 tatcttcatcttatttttctgc 912 Score = 75.8 bits (38), Expect = 1e-10 Identities = 50/54 (92%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 706 gcccccgtgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 653 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 583 agcttctccttgatcttatccttgatacccttcttc 548
>gb|AY895917.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 7 (Dhn7) gene, complete cds Length = 1370 Score = 172 bits (87), Expect = 6e-40 Identities = 138/155 (89%) Strand = Plus / Minus Query: 245 caagtagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtcc 304 ||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 874 caagtaggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtcc 815 Query: 305 atgatgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccg 364 |||||||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||| Sbjct: 814 atgatgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccg 755 Query: 365 gtgtgtccttgctgcccataggtgccgccggtggc 399 |||||||| ||||||| ||||| ||||| ||||| Sbjct: 754 gtgtgtcccggctgcccgtaggtaccgcctgtggc 720 Score = 81.8 bits (41), Expect = 2e-12 Identities = 119/142 (83%), Gaps = 6/142 (4%) Strand = Plus / Minus Query: 77 gttcagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaa 136 |||||||| |||||||||||||| || |||||||| || ||| |||||||||||| || Sbjct: 1049 gttcagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaa 994 Query: 137 actcagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactg 194 || ||||||||| ||| ||| |||| | |||||||||| |||| ||||||||||||| Sbjct: 993 accgagaactcagatatcacatgtgaactaaagctcacttcatttcgggaagttttactg 934 Query: 195 catctccatcttattattctgc 216 |||| ||||||||| |||||| Sbjct: 933 tatcttcatcttatttttctgc 912 Score = 75.8 bits (38), Expect = 1e-10 Identities = 50/54 (92%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 706 gcccccgtgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 653 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 583 agcttctccttgatcttatccttgatacccttcttc 548
>gb|AY895909.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 236388 dehydrin 7 (Dhn7) gene, complete cds Length = 1369 Score = 172 bits (87), Expect = 6e-40 Identities = 138/155 (89%) Strand = Plus / Minus Query: 245 caagtagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtcc 304 ||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 873 caagtaggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtcc 814 Query: 305 atgatgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccg 364 |||||||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||| Sbjct: 813 atgatgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccg 754 Query: 365 gtgtgtccttgctgcccataggtgccgccggtggc 399 |||||||| ||||||| ||||| ||||| ||||| Sbjct: 753 gtgtgtcccggctgcccgtaggtaccgcctgtggc 719 Score = 81.8 bits (41), Expect = 2e-12 Identities = 119/142 (83%), Gaps = 6/142 (4%) Strand = Plus / Minus Query: 77 gttcagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaa 136 |||||||| |||||||||||||| || |||||||| || ||| |||||||||||| || Sbjct: 1048 gttcagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaa 993 Query: 137 actcagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactg 194 || ||||||||| ||| ||| |||| | |||||||||| |||| ||||||||||||| Sbjct: 992 accgagaactcagatatcacatgtgaactaaagctcacttcatttcgggaagttttactg 933 Query: 195 catctccatcttattattctgc 216 |||| ||||||||| |||||| Sbjct: 932 tatcttcatcttatttttctgc 911 Score = 75.8 bits (38), Expect = 1e-10 Identities = 50/54 (92%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 705 gcccccgtgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 652 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 582 agcttctccttgatcttatccttgatacccttcttc 547
>gb|AY895908.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 7 (Dhn7) gene, complete cds Length = 1337 Score = 172 bits (87), Expect = 6e-40 Identities = 138/155 (89%) Strand = Plus / Minus Query: 245 caagtagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtcc 304 ||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 843 caagtaggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtcc 784 Query: 305 atgatgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccg 364 |||||||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||| Sbjct: 783 atgatgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccg 724 Query: 365 gtgtgtccttgctgcccataggtgccgccggtggc 399 |||||||| ||||||| ||||| ||||| ||||| Sbjct: 723 gtgtgtcccggctgcccgtaggtaccgcctgtggc 689 Score = 75.8 bits (38), Expect = 1e-10 Identities = 50/54 (92%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 675 gcccccgtgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 622 Score = 63.9 bits (32), Expect = 4e-07 Identities = 99/119 (83%), Gaps = 3/119 (2%) Strand = Plus / Minus Query: 100 cgggtacatacaagcaacccaaattcaagtccaccaaactcagaactcaggtattacaag 159 ||||| |||||||| || ||| ||| |||||||| |||| ||||||||| ||| ||| | Sbjct: 998 cgggtccatacaag-aagccatattgaagtccacaaaaccgagaactcagatatcacatg 940 Query: 160 tgagc--aagctcactttatttgcggaagttttactgcatctccatcttattattctgc 216 ||| | |||||||||| |||| ||||||||||||| |||| ||||||||| |||||| Sbjct: 939 tgaactaaagctcacttcatttcgggaagttttactgtatcttcatcttatttttctgc 881 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 552 agcttctccttgatcttatccttgatacccttcttc 517
>gb|AY895931.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 560559 dehydrin 7 (Dhn7) gene, complete cds Length = 1371 Score = 170 bits (86), Expect = 2e-39 Identities = 131/146 (89%) Strand = Plus / Minus Query: 254 gccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgccc 313 ||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 868 gccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtccatgatgccc 809 Query: 314 ttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgtgtcct 373 ||||| ||||| || |||||||||||||||| ||| || || ||||| ||||||||||| Sbjct: 808 ttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccggtgtgtccc 749 Query: 374 tgctgcccataggtgccgccggtggc 399 ||||||| ||||| ||||| ||||| Sbjct: 748 ggctgcccgtaggtaccgcctgtggc 723 Score = 75.8 bits (38), Expect = 1e-10 Identities = 50/54 (92%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 709 gcccccgtgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 656 Score = 69.9 bits (35), Expect = 6e-09 Identities = 116/140 (82%), Gaps = 6/140 (4%) Strand = Plus / Minus Query: 80 cagagaacaaaacgtcccggcgggtacatacaagcaacccaaattcaagtccaccaaact 139 ||||| |||||||||||||| || |||||||| || ||| |||||||||||| |||| Sbjct: 1049 cagagcacaaaacgtcccgg---gtccatacaag-aagccatattcaagtccacaaaacc 994 Query: 140 cagaactcaggtattacaagtgagc--aagctcactttatttgcggaagttttactgcat 197 ||||||||| ||| || ||||| | |||||||||| |||| | ||||||||||| || Sbjct: 993 gagaactcagatatcacgagtgaactaaagctcacttcatttcggaaagttttactgtat 934 Query: 198 ctccatcttattattctgca 217 || ||||||||| ||||||| Sbjct: 933 cttcatcttatttttctgca 914 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 586 agcttctccttgatcttatccttgatacccttcttc 551
>gb|M93342.2|WHTCOAC Triticum aestivum cold acclimation protein WCS120 (WCS120) mRNA, complete cds Length = 1504 Score = 167 bits (84), Expect = 4e-38 Identities = 138/156 (88%) Strand = Plus / Minus Query: 257 gcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttc 316 |||| |||||||||||||||||| |||||||| ||||||||||||||||||| || |||| Sbjct: 1209 gcagaccgggctcagtgctgtccaggcagcttatccttgatcttgtccatgaggctcttc 1150 Query: 317 ttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgc 376 |||||||| ||||||||| ||| || | ||| ||||| ||| ||||||||||||| ||| Sbjct: 1149 ttctcgccgatcccgtcggagccgtgtgtcccagtgccagtcgttccggtgtgtccgtgc 1090 Query: 377 tgcccataggtgccgccggtggcggtggcgccatgc 412 ||||||| ||||||||||||||| |||| ||||||| Sbjct: 1089 tgcccatgggtgccgccggtggccgtggtgccatgc 1054 Score = 81.8 bits (41), Expect = 2e-12 Identities = 94/113 (83%), Gaps = 9/113 (7%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtgccatgc 343 |||||||||||||| || ||||||| ||||||||||||||| |||||| ||| Sbjct: 528 agcttctccttgatgttctccatgacgcccttcttctcgcc---------ggtgccgtgc 478 Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggt 396 | ||||||||| |||| |||||||||||| |||| |||||||||||| ||||| Sbjct: 477 gtccccgtgccagtcactccggtgtgtccctgctccccataggtgccaccggt 425 Score = 77.8 bits (39), Expect = 3e-11 Identities = 45/47 (95%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| ||||||||||||||||| ||||||||||||||||||||||| Sbjct: 93 ccggggagcttctccttgatcttctccatgatgcccttcttctcgcc 47 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 346 ccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccg 394 ||||| ||||||||| ||||||||||| |||||| |||||||||||||| Sbjct: 859 ccccgcgccggtcatcccggtgtgtccatgctgctcataggtgccgccg 811 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgcc 393 ||||||||||| ||||||||||| |||||| ||||||||||||| Sbjct: 663 gtgccggtcatcccggtgtgtccgtgctgctcataggtgccgcc 620 Score = 58.0 bits (29), Expect = 2e-05 Identities = 53/61 (86%) Strand = Plus / Minus Query: 334 ggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgcc 393 ||||||||||| | |||||||| ||| ||| | |||||| |||||||| ||||||||||| Sbjct: 1063 ggtgccatgcgtctccgtgccgatcactccagcgtgtccatgctgcccgtaggtgccgcc 1004 Query: 394 g 394 | Sbjct: 1003 g 1003 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagt 327 ||||| |||||||| || ||||||| |||||||||||||||||| Sbjct: 912 agcttttccttgatgttctccatgacgcccttcttctcgccagt 869 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 ||||| |||||||| || ||||||| ||| |||||||||||||| |||| Sbjct: 720 agcttgtccttgatgttctccatgacgcctttcttctcgccagtgccgt 672 Score = 50.1 bits (25), Expect = 0.006 Identities = 84/103 (81%), Gaps = 3/103 (2%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtgccatgc 343 ||||| |||||||| || ||||||| ||||||||||||||| | ||| || ||||||| Sbjct: 276 agcttgtccttgatgttctccatgacgcccttcttctcgccgg---cgtgggcgccatgc 220 Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccatagg 386 |||||||||||| |||| | ||| || |||||||| |||| Sbjct: 219 aaccccgtgccggtggttccagcgtgaccctgctgcccgtagg 177 Score = 46.1 bits (23), Expect = 0.093 Identities = 32/35 (91%) Strand = Plus / Minus Query: 362 ccggtgtgtccttgctgcccataggtgccgccggt 396 ||||||||||| |||||||| |||||||| ||||| Sbjct: 783 ccggtgtgtccctgctgcccgtaggtgccaccggt 749 Score = 46.1 bits (23), Expect = 0.093 Identities = 32/35 (91%) Strand = Plus / Minus Query: 362 ccggtgtgtccttgctgcccataggtgccgccggt 396 ||||| ||||| ||||||||||||||||| ||||| Sbjct: 399 ccggtatgtccctgctgcccataggtgccaccggt 365 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 362 ccggtgtgtccttgctgcccataggt 387 ||||||||||| |||||||||||||| Sbjct: 339 ccggtgtgtccctgctgcccataggt 314
>gb|AF181457.1|AF181457 Hordeum vulgare dehydrin (Dhn7) mRNA, complete cds Length = 654 Score = 165 bits (83), Expect = 1e-37 Identities = 137/155 (88%) Strand = Plus / Minus Query: 245 caagtagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtcc 304 ||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 610 caagtaggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtcc 551 Query: 305 atgatgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccg 364 |||||||||||||| ||||| || |||||||||||||||| ||| || || ||||| ||| Sbjct: 550 atgatgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcataccg 491 Query: 365 gtgtgtccttgctgcccataggtgccgccggtggc 399 |||||||| |||| || ||||| ||||| ||||| Sbjct: 490 gtgtgtcccggctgaccgtaggtaccgccagtggc 456 Score = 75.8 bits (38), Expect = 1e-10 Identities = 50/54 (92%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 442 gcccccgtgccggtcatcccagtgtgaccctgctgcccataggtgccgccggtg 389 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 319 agcttctccttgatcttatccttgatacccttcttc 284
>gb|AF453444.1|AF453444 Triticum aestivum dehydrin WZY1-1 mRNA, complete cds Length = 483 Score = 163 bits (82), Expect = 6e-37 Identities = 139/158 (87%) Strand = Plus / Minus Query: 268 tcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagt 327 ||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| | Sbjct: 483 tcagtgctgtccgggcagcttttccttgatcttgtccatgatgcccttcttttcgccggc 424 Query: 328 cccgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggt 387 || |||||| |||||| ||| || ||||||||||||||||||||| ||||||| ||||| Sbjct: 423 gccatcggtgacatgcgtcccagtaccggtcattccggtgtgtcctggctgcccgtaggt 364 Query: 388 gccgccggtggcggtggcgccatgctccccggtgccgg 425 ||||| ||||| | || |||||| |||||||||||| Sbjct: 363 accgcctgtggccgcggagccatgtgccccggtgccgg 326 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 260 agcttctccttgatcttatccttgatgcccttcttc 225
>gb|AF031247.1|AF031247 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-2) mRNA, complete cds Length = 1518 Score = 157 bits (79), Expect = 4e-35 Identities = 127/143 (88%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1293 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgccggtgc 1234 Query: 330 cgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgc 389 |||||||||| || | ||| ||||||||| | ||||||||||| |||||||| ||||||| Sbjct: 1233 cgtcggtgccgtgagtcccagtgccggtcgtgccggtgtgtccctgctgcccgtaggtgc 1174 Query: 390 cgccggtggcggtggcgccatgc 412 |||||||||| |||| ||||||| Sbjct: 1173 cgccggtggccgtggtgccatgc 1151 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| ||||||||||||||| |||| Sbjct: 1075 ccggggagcttctccttgatgttttccatgacgcccttcttctcgcc---------ggtg 1025 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| |||||||| ||||| |||||||||||| |||||||| |||||| |||||||| Sbjct: 1024 ccgtgcgtccccgtgctggtcactccggtgtgtccgtgctgcccgtaggtgtcgccggtg 965 Query: 398 gc 399 || Sbjct: 964 gc 963 Score = 85.7 bits (43), Expect = 1e-13 Identities = 96/113 (84%), Gaps = 3/113 (2%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtgccatgc 343 ||||| |||||||| || ||||||| ||||||||||||||| || ||||| | | ||| Sbjct: 487 agcttgtccttgatgttctccatgacgcccttcttctcgccggt---gtcggcgtcgtgc 431 Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggt 396 | |||||||||||||| |||||||||||| |||| ||||||||||| ||||| Sbjct: 430 gtccccgtgccggtcactccggtgtgtccctgctcaccataggtgccaccggt 378 Score = 77.8 bits (39), Expect = 3e-11 Identities = 45/47 (95%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| ||||||||||||||||| ||||||||||||||||||||||| Sbjct: 124 ccggggagcttctccttgatcttctccatgatgcccttcttctcgcc 78 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 ||||||||||||| |||||||||| | |||||||| |||| ||| |||||||| | || | Sbjct: 823 cccgtgccggtcactccggtgtgttcatgctgcccgtaggcgcctccggtggctggggtg 764 Query: 407 ccatgc 412 |||||| Sbjct: 763 ccatgc 758 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||| |||||||||||||| Sbjct: 691 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc 645 Score = 48.1 bits (24), Expect = 0.024 Identities = 36/40 (90%) Strand = Plus / Minus Query: 346 ccccgtgccggtcattccggtgtgtccttgctgcccatag 385 ||||||||||||||| ||||| ||||| |||||| ||||| Sbjct: 632 ccccgtgccggtcatcccggtatgtccctgctgctcatag 593 Score = 46.1 bits (23), Expect = 0.093 Identities = 47/55 (85%) Strand = Plus / Minus Query: 334 ggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtg 388 ||||||||||| | |||||||||||| ||| | ||||| |||||||| |||||| Sbjct: 1160 ggtgccatgcgtctccgtgccggtcactccagcatgtccatgctgcccgtaggtg 1106
>gb|AY895913.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 7 (Dhn7) gene, complete cds Length = 1344 Score = 157 bits (79), Expect = 4e-35 Identities = 136/155 (87%) Strand = Plus / Minus Query: 245 caagtagctgccgcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtcc 304 ||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 848 caagtaggggccgcgggccgggctcagtgctgtccgggcagcttctccttgattttgtcc 789 Query: 305 atgatgcccttcttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccg 364 |||||||||||||| ||||| || |||||||||||||||| ||| || || ||||| | Sbjct: 788 atgatgcccttcttttcgccggtgccgtcggtgccatgcgtcccagtaccagtcatatgg 729 Query: 365 gtgtgtccttgctgcccataggtgccgccggtggc 399 |||||||| ||||||| ||||| ||||| ||||| Sbjct: 728 gtgtgtcccggctgcccgtaggtaccgcctgtggc 694 Score = 60.0 bits (30), Expect = 6e-06 Identities = 48/54 (88%) Strand = Plus / Minus Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||| ||||||||||| || ||||| || |||||||||||||||| ||||||| Sbjct: 680 gcccctgtgccggtcatcccagtgtgaccctgctgcccataggtgctgccggtg 627 Score = 58.0 bits (29), Expect = 2e-05 Identities = 99/120 (82%), Gaps = 3/120 (2%) Strand = Plus / Minus Query: 100 cgggtacatacaagcaacccaaattcaagtccaccaaactcagaactcaggtattacaag 159 ||||| |||||||| || ||| ||| |||||||| |||| ||||||||| ||| || || Sbjct: 1003 cgggtccatacaag-aagccatattgaagtccacaaaaccgagaactcagatatcacgag 945 Query: 160 tgagc--aagctcactttatttgcggaagttttactgcatctccatcttattattctgca 217 ||| | |||||||||| |||| | ||||||||||| |||| ||||||||| ||||||| Sbjct: 944 tgaactaaagctcacttcatttcggaaagttttactgtatcttcatcttatttttctgca 885 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 557 agcttctccttgatcttatccttgatacccttcttc 522
>gb|AF058794.1|AF058794 Triticum aestivum COR39 (cor39) mRNA, complete cds Length = 1243 Score = 149 bits (75), Expect = 9e-33 Identities = 126/143 (88%) Strand = Plus / Minus Query: 262 ccgggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||||| |||||||| ||||||||||||||||||| || ||||||||| Sbjct: 1232 ccgggctcagtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctc 1173 Query: 322 gccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgccc 381 ||| |||||||||||| || | ||| ||||| ||| |||||| |||||| |||||||| Sbjct: 1172 gcccaccccgtcggtgccgtgtgtcccagtgccagtcgttccggcgtgtccgtgctgccc 1113 Query: 382 ataggtgccgccggtggcggtgg 404 || ||||||||||||||| |||| Sbjct: 1112 atgggtgccgccggtggccgtgg 1090 Score = 89.7 bits (45), Expect = 7e-15 Identities = 98/117 (83%), Gaps = 9/117 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| ||||||||||||||| |||| Sbjct: 946 ccggggagcttctccttgatgttctccatgacgcccttcttctcgcc---------ggtg 896 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccg 394 || || | ||||||||||||||| ||||||||||| |||||| |||||||||||||| Sbjct: 895 ccgtgtgtccccgtgccggtcatcccggtgtgtccgtgctgctcataggtgccgccg 839 Score = 89.7 bits (45), Expect = 7e-15 Identities = 95/113 (84%), Gaps = 9/113 (7%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtgccatgc 343 |||||||||||||| || ||||||| ||||||||||||||| |||||| ||| Sbjct: 556 agcttctccttgatgttctccatgaggcccttcttctcgcc---------ggtgccgtgc 506 Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggt 396 | |||||||||||||| |||||||||||| |||| |||||||||||| ||||| Sbjct: 505 gtccccgtgccggtcactccggtgtgtccctgctccccataggtgccaccggt 453 Score = 77.8 bits (39), Expect = 3e-11 Identities = 45/47 (95%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| ||||||||||||||||| ||||||||||||||||||||||| Sbjct: 121 ccggggagcttctccttgatcttctccatgatgcccttcttctcgcc 75 Score = 65.9 bits (33), Expect = 1e-07 Identities = 54/61 (88%) Strand = Plus / Minus Query: 334 ggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgcc 393 |||||| |||| | |||||||||||||||| |||||| | |||||||| ||||||||||| Sbjct: 1091 ggtgccgtgcgtctccgtgccggtcattccagtgtgtgcatgctgcccgtaggtgccgcc 1032 Query: 394 g 394 | Sbjct: 1031 g 1031 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||| || ||||||| ||||||||||||||| Sbjct: 748 agcttgtccttgatgttctccatgacgcccttcttctcgcc 708 Score = 46.1 bits (23), Expect = 0.093 Identities = 32/35 (91%) Strand = Plus / Minus Query: 362 ccggtgtgtccttgctgcccataggtgccgccggt 396 ||||||||||| |||||||| |||||||| ||||| Sbjct: 811 ccggtgtgtccctgctgcccgtaggtgccaccggt 777 Score = 46.1 bits (23), Expect = 0.093 Identities = 103/129 (79%), Gaps = 3/129 (2%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtgccatgc 343 ||||| |||||||| || ||||| | ||||||||||||||| | ||| || ||||||| Sbjct: 304 agcttgtccttgatgttctccatcacgcccttcttctcgccgg---cgtgggcgccatgc 248 Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtg 403 |||||||||||| |||| | ||| || |||||||| |||| || |||||||| | | Sbjct: 247 aaccccgtgccggtggttccagcgtgaccctgctgcccgtaggcaccaccggtggccggg 188 Query: 404 gcgccatgc 412 || |||||| Sbjct: 187 gcaccatgc 179
>gb|U73212.1|TAU73212 Triticum aestivum cold acclimation protein WCOR80 (Wcor80) mRNA, complete cds Length = 465 Score = 149 bits (75), Expect = 9e-33 Identities = 126/143 (88%) Strand = Plus / Minus Query: 262 ccgggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||| |||||||||| |||||||||||||||| ||||||||||| || ||||||||| Sbjct: 335 ccgggcttagtgctgtccaggcagcttctccttgaccttgtccatgaggctcttcttctc 276 Query: 322 gccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgccc 381 ||| |||||| | ||||| || | ||| ||||| ||| ||||||||||||| |||||||| Sbjct: 275 gccggtcccggctgtgccgtgtgtcccagtgccagtcgttccggtgtgtccctgctgccc 216 Query: 382 ataggtgccgccggtggcggtgg 404 | |||||||||||||||| |||| Sbjct: 215 aaaggtgccgccggtggccgtgg 193 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||||||| ||||||||||| Sbjct: 118 ccggggagcttctccttgatgttctccatgatgcctttcttctcgcc 72 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 348 ccgtgccggtcattccggtgtgtccttgctgcccataggtgcc 390 |||||||||||||||| |||||||| |||||||| | |||||| Sbjct: 180 ccgtgccggtcattccagtgtgtccctgctgcccgtgggtgcc 138
>gb|L27516.1|WHTWCS66X Triticum aestivum (Wcs66) gene, complete cds Length = 1629 Score = 143 bits (72), Expect = 5e-31 Identities = 135/156 (86%) Strand = Plus / Minus Query: 257 gcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttc 316 |||| |||||||||||||||||| || ||||| ||||||||||||||||||| || |||| Sbjct: 1497 gcagaccgggctcagtgctgtccaggtagcttgtccttgatcttgtccatgaggctcttc 1438 Query: 317 ttctcgccagtcccgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgc 376 |||||||| |||||||||||| || | ||| ||||| || |||| |||||||| ||| Sbjct: 1437 ttctcgccgaccccgtcggtgccgtgtgtcccagtgccagtagttcccgtgtgtccgtgc 1378 Query: 377 tgcccataggtgccgccggtggcggtggcgccatgc 412 ||||||| ||||||||||||||| |||| ||||||| Sbjct: 1377 tgcccatgggtgccgccggtggccgtggtgccatgc 1342 Score = 77.8 bits (39), Expect = 3e-11 Identities = 60/67 (89%) Strand = Plus / Minus Query: 346 ccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggc 405 ||||||||||||||| ||||||||||| |||||| |||||||||||||| |||| | || Sbjct: 1147 ccccgtgccggtcatcccggtgtgtccgtgctgctcataggtgccgccgctggccggggt 1088 Query: 406 gccatgc 412 ||||||| Sbjct: 1087 gccatgc 1081 Score = 77.8 bits (39), Expect = 3e-11 Identities = 45/47 (95%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| ||||||||||||||||| ||||||||||||||||||||||| Sbjct: 147 ccggggagcttctccttgatcttctccatgatgcccttcttctcgcc 101 Score = 65.9 bits (33), Expect = 1e-07 Identities = 54/61 (88%) Strand = Plus / Minus Query: 334 ggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgcc 393 ||||||||||| | |||||||||||||||| |||| || |||||| ||||||||||||| Sbjct: 1351 ggtgccatgcgtctccgtgccggtcattccagtgttaccgtgctgctcataggtgccgcc 1292 Query: 394 g 394 | Sbjct: 1291 g 1291 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 346 ccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccg 394 ||||||||||||||| || |||||||| |||||| |||||||||||||| Sbjct: 955 ccccgtgccggtcatcccagtgtgtccgtgctgctcataggtgccgccg 907 Score = 65.9 bits (33), Expect = 1e-07 Identities = 92/113 (81%), Gaps = 9/113 (7%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtgccatgc 343 ||||| |||||||| || ||||||| ||||||||||||||| |||||| ||| Sbjct: 816 agcttgtccttgatgttctccatgaggcccttcttctcgcc---------ggtgccgtgc 766 Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggt 396 | |||||||||||||| ||| | |||||| |||| |||||||||||| ||||| Sbjct: 765 gtccccgtgccggtcactccagcgtgtccctgctccccataggtgccaccggt 713 Score = 65.9 bits (33), Expect = 1e-07 Identities = 110/135 (81%), Gaps = 3/135 (2%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| ||||| |||||||| || ||||||| ||||||||||||||| | ||| || | Sbjct: 336 ccggggagcttgtccttgatgttctccatgacgcccttcttctcgccgg---cgtgggcg 280 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 |||||| |||||||||||| |||||||||| || | |||||| |||| || || ||| Sbjct: 279 ccatgcaaccccgtgccggtggttccggtgtgaccctcctgcccgtaggcaccaccagtg 220 Query: 398 gcggtggcgccatgc 412 || | |||||||||| Sbjct: 219 gccggggcgccatgc 205 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 ||||| |||||||| || ||||||| | |||||||||||||||| |||| Sbjct: 1200 agcttgtccttgatgttctccatgacggccttcttctcgccagtgccgt 1152 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgcc 324 |||||||||||||| || ||||||| || |||||||||||| Sbjct: 624 agcttctccttgatgttctccatgaggctcttcttctcgcc 584 Score = 48.1 bits (24), Expect = 0.024 Identities = 48/56 (85%) Strand = Plus / Minus Query: 341 tgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggt 396 |||| |||||||||||||| |||||| |||| ||||| ||| ||| |||| ||||| Sbjct: 576 tgcgtccccgtgccggtcactccggtatgtctttgctccccgtagctgccaccggt 521 Score = 46.1 bits (23), Expect = 0.093 Identities = 32/35 (91%) Strand = Plus / Minus Query: 362 ccggtgtgtccttgctgcccataggtgccgccggt 396 ||||||||||| |||||||| |||||||| ||||| Sbjct: 879 ccggtgtgtccctgctgcccgtaggtgccaccggt 845 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 362 ccggtgtgtccttgctgcccataggtgcc 390 ||||| ||||| ||||||||||||||||| Sbjct: 393 ccggtatgtccctgctgcccataggtgcc 365
>emb|X15287.1|HVDHN18 Barley mRNA for dehydrin (dhn18) Length = 1049 Score = 117 bits (59), Expect = 3e-23 Identities = 59/59 (100%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 754 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 696 Score = 77.8 bits (39), Expect = 3e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| | || | Sbjct: 589 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgcggtg 530 Query: 407 ccatgctccccggtgccgg 425 ||||| |||||||||||| Sbjct: 529 ccatgtgccccggtgccgg 511 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 340 agcttctccttgatcttctccttgatgcccttcttc 305
>gb|AC145325.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0034E03 map near 50283S, complete sequence Length = 134074 Score = 109 bits (55), Expect = 7e-21 Identities = 58/59 (98%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 60516 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 60458 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| ||||| |||||||||||||||||||||| |||||||||||||||||| Sbjct: 82912 gctcagtgctggccggggagcttctccttgatcttgtccacgatgcccttcttctcgcc 82854 Score = 85.7 bits (43), Expect = 1e-13 Identities = 52/55 (94%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||| ||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 67053 agtgctggccgggcagcttctccttgatcttgtccatgaatcccttcttctcgcc 66999 Score = 77.8 bits (39), Expect = 3e-11 Identities = 51/55 (92%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||| ||||| ||||| ||||||||||||||||||| ||||||||||||||| Sbjct: 75496 agtgctggccgggaagcttttccttgatcttgtccatgaagcccttcttctcgcc 75442 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||||||||| ||| |||| ||||||||| Sbjct: 66868 ccgggcagcttctccttgatcttctccttgattcccttcttc 66827 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| |||| ||||||||| Sbjct: 82711 ccggggagcttctccttgatcttctccttgatccccttcttc 82670 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| |||| ||||||||| Sbjct: 75305 ccggggagcttctccttgatcttctccttgattcccttcttc 75264 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| |||| ||||||||| Sbjct: 60333 ccggggagcttctccttgatcttctccttgatccccttcttc 60292
>gb|AY349246.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 109 bits (55), Expect = 7e-21 Identities = 121/143 (84%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 330 cgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgc 389 |||||||||| || | || | ||| ||| | ||||| ||| | |||||||| ||||||| Sbjct: 942 cgtcggtgccgtgtgtgccagcgccagtcgtgccggtctgtgcctgctgcccgtaggtgc 883 Query: 390 cgccggtggcggtggcgccatgc 412 |||| ||||| |||| ||||||| Sbjct: 882 cgccagtggccgtggtgccatgc 860 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| |||||||||||| |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 |||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | ||||||||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctgcccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttctccttgatgttttccatgacgcccttcttctcgcc 546
>gb|AY349245.1| Hordeum vulgare subsp. spontaneum NPGS PI 560556 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 109 bits (55), Expect = 7e-21 Identities = 121/143 (84%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 330 cgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgc 389 |||||||||| || | || | ||| ||| | ||||| ||| | |||||||| ||||||| Sbjct: 942 cgtcggtgccgtgtgtgccagcgccagtcgtgccggtctgtgcctgctgcccgtaggtgc 883 Query: 390 cgccggtggcggtggcgccatgc 412 |||| ||||| |||| ||||||| Sbjct: 882 cgccagtggccgtggtgccatgc 860 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| |||||||||||| |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 |||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | |||| |||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctccccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| ||||| |||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttatccttgatgttttccatgacgcccttcttctcgcc 546
>gb|AY349244.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 109 bits (55), Expect = 7e-21 Identities = 121/143 (84%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 330 cgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgc 389 |||||||||| || | || | ||| ||| | ||||| ||| | |||||||| ||||||| Sbjct: 942 cgtcggtgccgtgtgtgccagcgccagtcgtgccggtctgtgcctgctgcccgtaggtgc 883 Query: 390 cgccggtggcggtggcgccatgc 412 |||| ||||| |||| ||||||| Sbjct: 882 cgccagtggccgtggtgccatgc 860 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| |||||||||||| |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 |||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | |||| |||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctccccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttctccttgatgttttccatgacgcccttcttctcgcc 546
>gb|AY349243.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 109 bits (55), Expect = 7e-21 Identities = 121/143 (84%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 330 cgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgc 389 |||||||||| || | || | ||| ||| | ||||| ||| | |||||||| ||||||| Sbjct: 942 cgtcggtgccgtgtgtgccagcgccagtcgtgccggtctgtgcctgctgcccgtaggtgc 883 Query: 390 cgccggtggcggtggcgccatgc 412 |||| ||||| |||| ||||||| Sbjct: 882 cgccagtggccgtggtgccatgc 860 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| |||||||||||| |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 |||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | |||| |||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctccccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttctccttgatgttttccatgacgcccttcttctcgcc 546
>gb|AY349242.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 109 bits (55), Expect = 7e-21 Identities = 121/143 (84%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 330 cgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgc 389 |||||||||| || | || | ||| ||| | ||||| ||| | |||||||| ||||||| Sbjct: 942 cgtcggtgccgtgtgtgccagcgccagtcgtgccggtctgtgcctgctgcccgtaggtgc 883 Query: 390 cgccggtggcggtggcgccatgc 412 |||| ||||| |||| ||||||| Sbjct: 882 cgccagtggccgtggtgccatgc 860 Score = 77.8 bits (39), Expect = 3e-11 Identities = 60/67 (89%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| |||| ||| |||||||||| ||||||||| || |||||||| |||||||||| Sbjct: 738 cggtgccgtgcgtcccagtgccggtcactccggtgtgaccgtgctgcccgtaggtgccgc 679 Query: 393 cggtggc 399 ||||||| Sbjct: 678 cggtggc 672 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 |||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | |||| |||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctgtccggtgtgtgcatgctccccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| ||||| |||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttatccttgatgttttccatgacgcccttcttctcgcc 546
>gb|AY349241.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 109 bits (55), Expect = 7e-21 Identities = 121/143 (84%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 330 cgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgc 389 |||||||||| || | || | ||| ||| | ||||| ||| | |||||||| ||||||| Sbjct: 942 cgtcggtgccgtgtgtgccagcgccagtcgtgccggtctgtgcctgctgcccgtaggtgc 883 Query: 390 cgccggtggcggtggcgccatgc 412 |||| ||||| |||| ||||||| Sbjct: 882 cgccagtggccgtggtgccatgc 860 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| |||||||||||| |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 |||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | |||| |||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctccccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttctccttgatgttttccatgacgcccttcttctcgcc 546
>gb|AY349240.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 109 bits (55), Expect = 7e-21 Identities = 121/143 (84%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 330 cgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgc 389 |||||||||| || | || | ||| ||| | ||||| ||| | |||||||| ||||||| Sbjct: 942 cgtcggtgccgtgtgtgccagcgccagtcgtgccggtctgtgcctgctgcccgtaggtgc 883 Query: 390 cgccggtggcggtggcgccatgc 412 |||| ||||| |||| ||||||| Sbjct: 882 cgccagtggccgtggtgccatgc 860 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| |||||||||||| |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | ||||||||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctgcccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 ||||| |||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttgtccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| ||||| |||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttatccttgatgttttccatgacgcccttcttctcgcc 546
>gb|AY349239.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 109 bits (55), Expect = 7e-21 Identities = 121/143 (84%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 330 cgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgc 389 |||||||||| || | || | ||| ||| | ||||| ||| | |||||||| ||||||| Sbjct: 942 cgtcggtgccgtgtgtgccagcgccagtcgtgccggtctgtgcctgctgcccgtaggtgc 883 Query: 390 cgccggtggcggtggcgccatgc 412 |||| ||||| |||| ||||||| Sbjct: 882 cgccagtggccgtggtgccatgc 860 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| |||||||||||| |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 |||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | |||| |||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctccccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttctccttgatgttttccatgacgcccttcttctcgcc 546
>gb|AY349238.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 109 bits (55), Expect = 7e-21 Identities = 121/143 (84%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 330 cgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgc 389 |||||||||| || | || | ||| ||| | ||||| ||| | |||||||| ||||||| Sbjct: 942 cgtcggtgccgtgtgtgccagcgccagtcgtgccggtctgtgcctgctgcccgtaggtgc 883 Query: 390 cgccggtggcggtggcgccatgc 412 |||| ||||| |||| ||||||| Sbjct: 882 cgccagtggccgtggtgccatgc 860 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| |||||||||||| |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 |||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | ||||||||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctgcccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttctccttgatgttttccatgacgcccttcttctcgcc 546
>gb|AY349233.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 109 bits (55), Expect = 7e-21 Identities = 121/143 (84%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 330 cgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgc 389 |||||||||| || | || | ||| ||| | ||||| ||| | |||||||| ||||||| Sbjct: 942 cgtcggtgccgtgtgtgccagcgccagtcgtgccggtctgtgcctgctgcccgtaggtgc 883 Query: 390 cgccggtggcggtggcgccatgc 412 |||| ||||| |||| ||||||| Sbjct: 882 cgccagtggccgtggtgccatgc 860 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| |||||||||||| |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | ||||||||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctgcccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 ||||| |||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttgtccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttctccttgatgttttccatgacgcccttcttctcgcc 546
>gb|AY349232.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 109 bits (55), Expect = 7e-21 Identities = 121/143 (84%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 330 cgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgc 389 |||||||||| || | || | ||| ||| | ||||| ||| | |||||||| ||||||| Sbjct: 942 cgtcggtgccgtgtgtgccagcgccagtcgtgccggtctgtgcctgctgcccgtaggtgc 883 Query: 390 cgccggtggcggtggcgccatgc 412 |||| ||||| |||| ||||||| Sbjct: 882 cgccagtggccgtggtgccatgc 860 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| |||||||||||| |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 |||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | ||||||||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctgcccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttctccttgatgttttccatgacgcccttcttctcgcc 546
>gb|AY349231.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 109 bits (55), Expect = 7e-21 Identities = 121/143 (84%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 330 cgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgc 389 |||||||||| || | || | ||| ||| | ||||| ||| | |||||||| ||||||| Sbjct: 942 cgtcggtgccgtgtgtgccagcgccagtcgtgccggtctgtgcctgctgcccgtaggtgc 883 Query: 390 cgccggtggcggtggcgccatgc 412 |||| ||||| |||| ||||||| Sbjct: 882 cgccagtggccgtggtgccatgc 860 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| |||||||||||| |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | ||||||||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctgcccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 ||||| |||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttgtccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttctccttgatgttttccatgacgcccttcttctcgcc 546
>gb|AY349229.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 109 bits (55), Expect = 7e-21 Identities = 121/143 (84%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 330 cgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgc 389 |||||||||| || | || | ||| ||| | ||||| ||| | |||||||| ||||||| Sbjct: 942 cgtcggtgccgtgtgtgccagcgccagtcgtgccggtctgtgcctgctgcccgtaggtgc 883 Query: 390 cgccggtggcggtggcgccatgc 412 |||| ||||| |||| ||||||| Sbjct: 882 cgccagtggccgtggtgccatgc 860 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| |||||||||||| |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 |||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | |||| |||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctccccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttctccttgatgttttccatgacgcccttcttctcgcc 546
>gb|AY349227.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 109 bits (55), Expect = 7e-21 Identities = 121/143 (84%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 330 cgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgc 389 |||||||||| || | || | ||| ||| | ||||| ||| | |||||||| ||||||| Sbjct: 942 cgtcggtgccgtgtgtgccagcgccagtcgtgccggtctgtgcctgctgcccgtaggtgc 883 Query: 390 cgccggtggcggtggcgccatgc 412 |||| ||||| |||| ||||||| Sbjct: 882 cgccagtggccgtggtgccatgc 860 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| |||||||||||| |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | ||||||||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctgcccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 ||||| |||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttgtccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttctccttgatgttttccatgacgcccttcttctcgcc 546
>gb|AY349224.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 109 bits (55), Expect = 7e-21 Identities = 121/143 (84%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 330 cgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgc 389 |||||||||| || | || | ||| ||| | ||||| ||| | |||||||| ||||||| Sbjct: 942 cgtcggtgccgtgtgtgccagcgccagtcgtgccggtctgtgcctgctgcccgtaggtgc 883 Query: 390 cgccggtggcggtggcgccatgc 412 |||| ||||| |||| ||||||| Sbjct: 882 cgccagtggccgtggtgccatgc 860 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| |||||||||||| |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 |||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | ||||||||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctgcccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttctccttgatgttttccatgacgcccttcttctcgcc 546
>gb|AY349222.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 109 bits (55), Expect = 7e-21 Identities = 121/143 (84%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 330 cgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgc 389 |||||||||| || | || | ||| ||| | ||||| ||| | |||||||| ||||||| Sbjct: 942 cgtcggtgccgtgtgtgccagcgccagtcgtgccggtctgtgcctgctgcccgtaggtgc 883 Query: 390 cgccggtggcggtggcgccatgc 412 |||| ||||| |||| ||||||| Sbjct: 882 cgccagtggccgtggtgccatgc 860 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| |||||||||||| |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | ||||||||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctgcccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 ||||| |||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttgtccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttctccttgatgttttccatgacgcccttcttctcgcc 546
>gb|AY349221.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 109 bits (55), Expect = 7e-21 Identities = 121/143 (84%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 330 cgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgc 389 |||||||||| || | || | ||| ||| | ||||| ||| | |||||||| ||||||| Sbjct: 942 cgtcggtgccgtgtgtgccagcgccagtcgtgccggtctgtgcctgctgcccgtaggtgc 883 Query: 390 cgccggtggcggtggcgccatgc 412 |||| ||||| |||| ||||||| Sbjct: 882 cgccagtggccgtggtgccatgc 860 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| |||||||||||| |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | ||||||||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctgcccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 ||||| |||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttgtccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttctccttgatgttttccatgacgcccttcttctcgcc 546
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 109 bits (55), Expect = 7e-21 Identities = 58/59 (98%) Strand = Plus / Plus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 14766544 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 14766602 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Plus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| ||||| |||||||||||||||||||||| |||||||||||||||||| Sbjct: 14744148 gctcagtgctggccggggagcttctccttgatcttgtccacgatgcccttcttctcgcc 14744206 Score = 85.7 bits (43), Expect = 1e-13 Identities = 52/55 (94%) Strand = Plus / Plus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||| ||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 14760007 agtgctggccgggcagcttctccttgatcttgtccatgaatcccttcttctcgcc 14760061 Score = 77.8 bits (39), Expect = 3e-11 Identities = 51/55 (92%) Strand = Plus / Plus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||| ||||| ||||| ||||||||||||||||||| ||||||||||||||| Sbjct: 14751564 agtgctggccgggaagcttttccttgatcttgtccatgaagcccttcttctcgcc 14751618 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||||||||| ||| |||| ||||||||| Sbjct: 14760192 ccgggcagcttctccttgatcttctccttgattcccttcttc 14760233 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||| ||||||||||||||||| ||||| || |||||||||||| Sbjct: 14645646 ccggggagcttctccttgatcttctccatcatacccttcttctcg 14645690 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| |||| ||||||||| Sbjct: 14766727 ccggggagcttctccttgatcttctccttgatccccttcttc 14766768 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| |||| ||||||||| Sbjct: 14751755 ccggggagcttctccttgatcttctccttgattcccttcttc 14751796 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| |||| ||||||||| Sbjct: 14744349 ccggggagcttctccttgatcttctccttgatccccttcttc 14744390 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| |||| ||||||||| Sbjct: 14645832 ccggggagcttctccttgatcttctccttgattcccttcttc 14645873
>emb|Y00842.1|OSRAB21 Rice rab21 gene for water-stress inducible protein RAB21 Length = 2537 Score = 109 bits (55), Expect = 7e-21 Identities = 58/59 (98%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2175 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 2117 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| |||| ||||||||| Sbjct: 1962 ccggggagcttctccttgatcttctccttgatccccttcttc 1921
>gb|U60097.2|OSU60097 Oryza sativa dehydrin mRNA, complete cds Length = 864 Score = 109 bits (55), Expect = 7e-21 Identities = 58/59 (98%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 584 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 526
>gb|AF181455.1|AF181455 Hordeum vulgare dehydrin (Dhn5) gene, complete cds Length = 3447 Score = 109 bits (55), Expect = 7e-21 Identities = 121/143 (84%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 2324 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 2265 Query: 330 cgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgc 389 |||||||||| || | || | ||| ||| | ||||| ||| | |||||||| ||||||| Sbjct: 2264 cgtcggtgccgtgtgtgccagcgccagtcgtgccggtctgtgcctgctgcccgtaggtgc 2205 Query: 390 cgccggtggcggtggcgccatgc 412 |||| ||||| |||| ||||||| Sbjct: 2204 cgccagtggccgtggtgccatgc 2182 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 2106 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 2056 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| |||||||||||| |||||||| ||||||||||||||| Sbjct: 2055 ccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtaggtgccgccggtg 1996 Query: 398 gc 399 || Sbjct: 1995 gc 1994 Score = 77.8 bits (39), Expect = 3e-11 Identities = 45/47 (95%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| ||||||||||||||||| ||||||||||||||||||||||| Sbjct: 669 ccggggagcttctccttgatcttctccatgatgcccttcttctcgcc 623 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 |||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 1515 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccgt 1467 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | ||||||||||||| ||||| Sbjct: 1676 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctgcccataggagccgc 1617 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 1616 cggtggccggggcgctatgc 1597 Score = 65.9 bits (33), Expect = 1e-07 Identities = 95/117 (81%), Gaps = 9/117 (7%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtgccatgc 343 ||||| |||||||| || ||||||| ||||||||||||||| || |||| || Sbjct: 1122 agcttgtccttgatgttctccatgacgcccttcttctcgccggttccgt---------gc 1072 Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcg 400 | ||||||||||||| |||||||||| | ||||||||||||| |||||| |||||| Sbjct: 1071 gtccccgtgccggtccctccggtgtgtgcatgctgcccataggcgccgcccgtggcg 1015 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||| ||||||||||||||| Sbjct: 1914 ccggggagcttctccttgatgttttccatgacgcccttcttctcgcc 1868 Score = 58.0 bits (29), Expect = 2e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| ||||||||||| ||||||| ||||||||||||||| Sbjct: 861 agcttgtccttgatcttctccatgaggcccttcttctcgcc 821 Score = 52.0 bits (26), Expect = 0.002 Identities = 71/86 (82%) Strand = Plus / Minus Query: 341 tgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcg 400 ||||||||| |||| | ||| ||||||||||| | ||| |||||||||||||| ||| Sbjct: 1005 tgcgcccccatgccagacatcccggtgtgtccctcctggtcataggtgccgccgccggcc 946 Query: 401 gtggcgccatgctccccggtgccggt 426 | || ||||||| || |||||||||| Sbjct: 945 ggggtgccatgcgccgcggtgccggt 920 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 362 ccggtgtgtccttgctgcccataggtgcc 390 ||||||||||| ||||||||||||||||| Sbjct: 924 ccggtgtgtccctgctgcccataggtgcc 896 Score = 46.1 bits (23), Expect = 0.093 Identities = 35/39 (89%) Strand = Plus / Minus Query: 361 tccggtgtgtccttgctgcccataggtgccgccggtggc 399 |||||||||| | ||||||||||||| ||||||||||| Sbjct: 1255 tccggtgtgtacatgctgcccataggaaccgccggtggc 1217
>gb|AF043096.1|AF043096 Hordeum vulgare dehydrin 5 (dhn5) gene, complete cds Length = 2814 Score = 109 bits (55), Expect = 7e-21 Identities = 121/143 (84%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 2322 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 2263 Query: 330 cgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgc 389 |||||||||| || | || | ||| ||| | ||||| ||| | |||||||| ||||||| Sbjct: 2262 cgtcggtgccgtgtgtgccagcgccagtcgtgccggtctgtgcctgctgcccgtaggtgc 2203 Query: 390 cgccggtggcggtggcgccatgc 412 |||| ||||| |||| ||||||| Sbjct: 2202 cgccagtggccgtggtgccatgc 2180 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 2104 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 2054 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| |||||||||||| |||||||| ||||||||||||||| Sbjct: 2053 ccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtaggtgccgccggtg 1994 Query: 398 gc 399 || Sbjct: 1993 gc 1992 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 |||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 1513 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccgt 1465 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | ||||||||||||| ||||| Sbjct: 1674 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctgcccataggagccgc 1615 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 1614 cggtggccggggcgctatgc 1595 Score = 69.9 bits (35), Expect = 6e-09 Identities = 94/115 (81%), Gaps = 9/115 (7%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtgccatgc 343 ||||| |||||||| || ||||||| ||||||||||||||| |||||| ||| Sbjct: 1120 agcttgtccttgatgttctccatgacgcccttcttctcgcc---------ggtgccgtgc 1070 Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtgg 398 | ||||||||||||| |||||||||| | ||||||||||||| |||||| |||| Sbjct: 1069 gtccccgtgccggtccctccggtgtgtgcatgctgcccataggcgccgcccgtgg 1015 Score = 69.9 bits (35), Expect = 6e-09 Identities = 44/47 (93%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| || |||||||||||||| ||||||||||||||||||||||| Sbjct: 667 ccggggagtttctccttgatcttctccatgatgcccttcttctcgcc 621 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||| ||||||||||||||| Sbjct: 1912 ccggggagcttctccttgatgttttccatgacgcccttcttctcgcc 1866 Score = 58.0 bits (29), Expect = 2e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| ||||||||||| ||||||| ||||||||||||||| Sbjct: 859 agcttgtccttgatcttctccatgaggcccttcttctcgcc 819 Score = 52.0 bits (26), Expect = 0.002 Identities = 71/86 (82%) Strand = Plus / Minus Query: 341 tgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcg 400 ||||||||| |||| | ||| ||||||||||| | ||| |||||||||||||| ||| Sbjct: 1003 tgcgcccccatgccagacatcccggtgtgtccctcctggtcataggtgccgccgccggcc 944 Query: 401 gtggcgccatgctccccggtgccggt 426 | || ||||||| || |||||||||| Sbjct: 943 ggggtgccatgcgccgcggtgccggt 918 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 362 ccggtgtgtccttgctgcccataggtgcc 390 ||||||||||| ||||||||||||||||| Sbjct: 922 ccggtgtgtccctgctgcccataggtgcc 894 Score = 46.1 bits (23), Expect = 0.093 Identities = 35/39 (89%) Strand = Plus / Minus Query: 361 tccggtgtgtccttgctgcccataggtgccgccggtggc 399 |||||||||| | ||||||||||||| ||||||||||| Sbjct: 1253 tccggtgtgtacatgctgcccataggaaccgccggtggc 1215
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 109 bits (55), Expect = 7e-21 Identities = 58/59 (98%) Strand = Plus / Plus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 14846981 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 14847039 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Plus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| ||||| |||||||||||||||||||||| |||||||||||||||||| Sbjct: 14824585 gctcagtgctggccggggagcttctccttgatcttgtccacgatgcccttcttctcgcc 14824643 Score = 85.7 bits (43), Expect = 1e-13 Identities = 52/55 (94%) Strand = Plus / Plus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||| ||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 14840444 agtgctggccgggcagcttctccttgatcttgtccatgaatcccttcttctcgcc 14840498 Score = 77.8 bits (39), Expect = 3e-11 Identities = 51/55 (92%) Strand = Plus / Plus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||| ||||| ||||| ||||||||||||||||||| ||||||||||||||| Sbjct: 14832001 agtgctggccgggaagcttttccttgatcttgtccatgaagcccttcttctcgcc 14832055 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||||||||| ||| |||| ||||||||| Sbjct: 14840629 ccgggcagcttctccttgatcttctccttgattcccttcttc 14840670 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||| ||||||||||||||||| ||||| || |||||||||||| Sbjct: 14727647 ccggggagcttctccttgatcttctccatcatacccttcttctcg 14727691 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| |||| ||||||||| Sbjct: 14847164 ccggggagcttctccttgatcttctccttgatccccttcttc 14847205 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| |||| ||||||||| Sbjct: 14832192 ccggggagcttctccttgatcttctccttgattcccttcttc 14832233 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| |||| ||||||||| Sbjct: 14824786 ccggggagcttctccttgatcttctccttgatccccttcttc 14824827 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| |||| ||||||||| Sbjct: 14727833 ccggggagcttctccttgatcttctccttgattcccttcttc 14727874
>gb|M95810.1|BLYDHN5 Hordeum vulgare dehydrin DHN5 (Dhn5) gene, complete cds Length = 2432 Score = 109 bits (55), Expect = 7e-21 Identities = 121/143 (84%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 2317 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 2258 Query: 330 cgtcggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgc 389 |||||||||| || | || | ||| ||| | ||||| ||| | |||||||| ||||||| Sbjct: 2257 cgtcggtgccgtgtgtgccagcgccagtcgtgccggtctgtgcctgctgcccgtaggtgc 2198 Query: 390 cgccggtggcggtggcgccatgc 412 |||| ||||| |||| ||||||| Sbjct: 2197 cgccagtggccgtggtgccatgc 2175 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 2099 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 2049 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| |||||||||||| |||||||| ||||||||||||||| Sbjct: 2048 ccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtaggtgccgccggtg 1989 Query: 398 gc 399 || Sbjct: 1988 gc 1987 Score = 77.8 bits (39), Expect = 3e-11 Identities = 45/47 (95%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| ||||||||||||||||| ||||||||||||||||||||||| Sbjct: 662 ccggggagcttctccttgatcttctccatgatgcccttcttctcgcc 616 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 |||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 1508 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccgt 1460 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | ||||||||||||| ||||| Sbjct: 1669 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctgcccataggagccgc 1610 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 1609 cggtggccggggcgctatgc 1590 Score = 65.9 bits (33), Expect = 1e-07 Identities = 95/117 (81%), Gaps = 9/117 (7%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtgccatgc 343 ||||| |||||||| || ||||||| ||||||||||||||| || |||| || Sbjct: 1115 agcttgtccttgatgttctccatgacgcccttcttctcgccggttccgt---------gc 1065 Query: 344 gcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcg 400 | ||||||||||||| |||||||||| | ||||||||||||| |||||| |||||| Sbjct: 1064 gtccccgtgccggtccctccggtgtgtgcatgctgcccataggcgccgcccgtggcg 1008 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||| ||||||||||||||| Sbjct: 1907 ccggggagcttctccttgatgttttccatgacgcccttcttctcgcc 1861 Score = 58.0 bits (29), Expect = 2e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| ||||||||||| ||||||| ||||||||||||||| Sbjct: 854 agcttgtccttgatcttctccatgaggcccttcttctcgcc 814 Score = 52.0 bits (26), Expect = 0.002 Identities = 71/86 (82%) Strand = Plus / Minus Query: 341 tgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcg 400 ||||||||| |||| | ||| ||||||||||| | ||| |||||||||||||| ||| Sbjct: 998 tgcgcccccatgccagacatcccggtgtgtccctcctggtcataggtgccgccgccggcc 939 Query: 401 gtggcgccatgctccccggtgccggt 426 | || ||||||| || |||||||||| Sbjct: 938 ggggtgccatgcgccgcggtgccggt 913 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 362 ccggtgtgtccttgctgcccataggtgcc 390 ||||||||||| ||||||||||||||||| Sbjct: 917 ccggtgtgtccctgctgcccataggtgcc 889 Score = 46.1 bits (23), Expect = 0.093 Identities = 35/39 (89%) Strand = Plus / Minus Query: 361 tccggtgtgtccttgctgcccataggtgccgccggtggc 399 |||||||||| | ||||||||||||| ||||||||||| Sbjct: 1248 tccggtgtgtacatgctgcccataggaaccgccggtggc 1210
>emb|X15994.1|ZMRAB17G Maize RAB-17 gene Length = 1986 Score = 107 bits (54), Expect = 3e-20 Identities = 69/74 (93%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcca 325 ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 1299 gctcagtgctgtccgggcagcttctccttgatcttgtccataatgcctttcttctcgccg 1240 Query: 326 gtcccgtcggtgcc 339 || || |||||||| Sbjct: 1239 gtgccctcggtgcc 1226 Score = 54.0 bits (27), Expect = 4e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 362 ccggtgtgtccttgctgcccataggtgccgccggt 396 ||||||||||| ||||||||||||| ||||||||| Sbjct: 1179 ccggtgtgtccctgctgcccataggcgccgccggt 1145 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 1111 tccgggcagcttctctttgatcttctccttgattcccttcttc 1069 Score = 40.1 bits (20), Expect = 5.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 362 ccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||| |||||||| |||| || ||||||| Sbjct: 1209 ccggtgtgtccctgctgcccgtaggcgctgccggtg 1174
>gb|AY349271.1| Hordeum vulgare subsp. spontaneum NPGS PI 559559 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 992 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 933 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 811 ccggggagcttctccttgatcttctccttcatgcccttcttc 770
>gb|AY349270.1| Hordeum vulgare subsp. spontaneum NPGS PI 559556 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 994 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 935 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 813 ccggggagcttctccttgatcttctccttcatgcccttcttc 772
>gb|AY349269.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 988 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 929 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 807 ccggggagcttctccttgatcttctccttcatgcccttcttc 766
>gb|AY349268.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 992 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 933 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 811 ccggggagcttctccttgatcttctccttcatgcccttcttc 770
>gb|AY349267.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 992 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 933 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 811 ccggggagcttctccttgatcttctccttcatgcccttcttc 770
>gb|AY349266.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 dehydrin 9 (Dhn9) gene, complete cds Length = 992 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 979 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 920 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 798 ccggggagcttctccttgatcttctccttcatgcccttcttc 757
>gb|AY349265.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 dehydrin 9 (Dhn9) gene, complete cds Length = 994 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 981 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 922 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 800 ccggggagcttctccttgatcttctccttcatgcccttcttc 759
>gb|AY349264.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 988 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 929 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 807 ccggggagcttctccttgatcttctccttcatgcccttcttc 766
>gb|AY349263.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 992 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 933 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 811 ccggggagcttctccttgatcttctccttcatgcccttcttc 770
>gb|AY349262.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 dehydrin 9 (Dhn9) gene, complete cds Length = 1000 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 987 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 928 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 806 ccggggagcttctccttgatcttctccttcatgcccttcttc 765
>gb|AY349261.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 992 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 933 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 811 ccggggagcttctccttgatcttctccttcatgcccttcttc 770
>gb|AY349260.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 988 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 929 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 807 ccggggagcttctccttgatcttctccttcatgcccttcttc 766
>gb|AY349259.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 994 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 935 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 813 ccggggagcttctccttgatcttctccttcatgcccttcttc 772
>gb|AY349258.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 988 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 929 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 807 ccggggagcttctccttgatcttctccttcatgcccttcttc 766
>gb|AY349257.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 994 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 935 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 813 ccggggagcttctccttgatcttctccttcatgcccttcttc 772
>gb|AY349256.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 988 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 929 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 807 ccggggagcttctccttgatcttctccttcatgcccttcttc 766
>gb|AY349255.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 988 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 929 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 807 ccggggagcttctccttgatcttctccttcatgcccttcttc 766
>gb|AY349254.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 988 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 929 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 807 ccggggagcttctccttgatcttctccttcatgcccttcttc 766
>gb|AY349253.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 988 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 929 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 807 ccggggagcttctccttgatcttctccttcatgcccttcttc 766
>gb|AY349252.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 988 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 929 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 807 ccggggagcttctccttgatcttctccttcatgcccttcttc 766
>gb|AY349251.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 dehydrin 9 (Dhn9) gene, complete cds Length = 1004 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 991 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 932 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 810 ccggggagcttctccttgatcttctccttcatgcccttcttc 769
>gb|AY349250.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 988 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 929 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 807 ccggggagcttctccttgatcttctccttcatgcccttcttc 766
>gb|AY349249.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 994 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 935 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 813 ccggggagcttctccttgatcttctccttcatgcccttcttc 772
>gb|AY349248.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 988 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 929 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 807 ccggggagcttctccttgatcttctccttcatgcccttcttc 766
>gb|AY349247.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 994 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 935 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 813 ccggggagcttctccttgatcttctccttcatgcccttcttc 772
>emb|X59133.1|TARAB T.aestivum L. mRNA for an ABA responsive gene, rab Length = 781 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 477 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 418 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttctt 318 ||||| ||||||||||||||||| ||| | ||||||||||| Sbjct: 284 ccggggagcttctccttgatcttctccttcatgcccttctt 244
>gb|AF181459.1|AF181459 Hordeum vulgare dehydrin (Dhn9) gene, complete cds Length = 1791 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 1159 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 1100 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 978 ccggggagcttctccttgatcttctccttcatgcccttcttc 937
>gb|AF043094.1|AF043094 Hordeum vulgare dehydrin 9 (dhn9) gene, complete cds Length = 1630 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 1219 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 1160 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 1038 ccggggagcttctccttgatcttctccttcatgcccttcttc 997
>gb|AY177889.1| Sorghum bicolor clone BAC IS_21O3 ABA-induced RAB17-like gene, partial sequence Length = 4636 Score = 101 bits (51), Expect = 2e-18 Identities = 54/55 (98%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 1509 agtgctgtccgggcagcttctccttgatcttgtccatgatgcctttcttctcgcc 1455 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||||||||||||||||||||| ||| |||| ||||||||| Sbjct: 1352 tccgggcagcttctccttgatcttctccttgattcccttcttc 1310
>dbj|AK121952.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107K14, full insert sequence Length = 709 Score = 101 bits (51), Expect = 2e-18 Identities = 54/55 (98%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttct 320 ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 613 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttct 559 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| |||| ||||||||| Sbjct: 430 ccggggagcttctccttgatcttctccttgatccccttcttc 389
>gb|U63831.1|SBU63831 Sorghum bicolor dehydrin (DHN2) mRNA, partial cds Length = 549 Score = 101 bits (51), Expect = 2e-18 Identities = 54/55 (98%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 320 agtgctgtccgggcagcttctccttgatcttgtccatgatgcctttcttctcgcc 266 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||||||||||||||||||||| ||| |||| ||||||||| Sbjct: 166 tccgggcagcttctccttgatcttctccttgattcccttcttc 124
>emb|X15290.1|HVDHN3 Zea mays mRNA for dehydrin (dhn1 gene) Length = 852 Score = 99.6 bits (50), Expect = 7e-18 Identities = 68/74 (91%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcca 325 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||||||||| Sbjct: 601 gctcagtgctgtccgggcagcttctctttgatcttgtccataatgcctttcttctcgccg 542 Query: 326 gtcccgtcggtgcc 339 || || |||||||| Sbjct: 541 gtgccctcggtgcc 528 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||||||||||||||||||||| ||| |||| ||||||||| Sbjct: 413 tccgggcagcttctccttgatcttctccttgattcccttcttc 371 Score = 46.1 bits (23), Expect = 0.093 Identities = 32/35 (91%) Strand = Plus / Minus Query: 362 ccggtgtgtccttgctgcccataggtgccgccggt 396 ||||||||||| |||||||| |||| ||||||||| Sbjct: 481 ccggtgtgtccctgctgcccgtaggcgccgccggt 447 Score = 40.1 bits (20), Expect = 5.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 362 ccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||| |||||||| |||| || ||||||| Sbjct: 511 ccggtgtgtccctgctgcccgtaggcgctgccggtg 476
>gb|AY104757.1| Zea mays PCO142314 mRNA sequence Length = 899 Score = 99.6 bits (50), Expect = 7e-18 Identities = 68/74 (91%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcca 325 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||||||||| Sbjct: 598 gctcagtgctgtccgggcagcttctctttgatcttgtccataatgcctttcttctcgccg 539 Query: 326 gtcccgtcggtgcc 339 || || |||||||| Sbjct: 538 gtgccctcggtgcc 525 Score = 54.0 bits (27), Expect = 4e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 362 ccggtgtgtccttgctgcccataggtgccgccggt 396 ||||||||||| ||||||||||||| ||||||||| Sbjct: 478 ccggtgtgtccctgctgcccataggcgccgccggt 444 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 410 tccgggcagcttctctttgatcttctccttgattcccttcttc 368 Score = 40.1 bits (20), Expect = 5.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 362 ccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||| |||||||| |||| || ||||||| Sbjct: 508 ccggtgtgtccctgctgcccgtaggcgctgccggtg 473
>emb|X78431.1|TDDEH27 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd27e Length = 751 Score = 95.6 bits (48), Expect = 1e-16 Identities = 57/60 (95%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||||||| |||||||||||||| |||||||||||||| |||||||||||||| Sbjct: 508 ggctcagtgctgtcccggcagcttctccttaatcttgtccatgatccccttcttctcgcc 449 Score = 44.1 bits (22), Expect = 0.37 Identities = 37/42 (88%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| || | |||||||||||| Sbjct: 315 ccggggagcttctccttgatcttctctttcatgcccttcttc 274
>gb|U11696.1|SBU11696 Sorghum bicolor dehydrin (DHN1) mRNA, complete cds Length = 748 Score = 95.6 bits (48), Expect = 1e-16 Identities = 51/52 (98%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 498 agtgctgtccgggcagcttctccttgatcttgtccatgatgcctttcttctc 447 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatctt 300 |||||||||||||||||||||||| Sbjct: 344 tccgggcagcttctccttgatctt 321 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 362 ccggtgtgtccttgctgcccatagg 386 |||||||||||||||||||| |||| Sbjct: 412 ccggtgtgtccttgctgcccgtagg 388
>gb|AY619566.1| Triticum turgidum subsp. durum dehydrin mRNA, complete cds Length = 1124 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 782 gctcagtgctggcctgggagcttctccttgatcttgtccatgatgcccttcttctcgcc 724 Score = 89.7 bits (45), Expect = 7e-15 Identities = 81/93 (87%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| |||||||||||||| ||||| |||||||| || ||||||| |||||||| | Sbjct: 691 cggtgccgtgcgcccccgtgcctgtcatcccggtgtggcccggctgcccgtaggtgccac 632 Query: 393 cggtggcggtggcgccatgctccccggtgccgg 425 | ||||| |||| ||||||| |||||||||||| Sbjct: 631 cagtggccgtggtgccatgcgccccggtgccgg 599 Score = 81.8 bits (41), Expect = 2e-12 Identities = 62/69 (89%) Strand = Plus / Minus Query: 334 ggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgcc 393 ||||||||||||||| ||||||| ||| |||||||| |||||||| || ||||||||||| Sbjct: 621 ggtgccatgcgccccggtgccggccatcccggtgtggccttgctgtccgtaggtgccgcc 562 Query: 394 ggtggcggt 402 |||| |||| Sbjct: 561 ggtgccggt 553 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggt 402 ||||||||||| || ||||| || |||||||| ||||||||||||||| |||| Sbjct: 560 gtgccggtcatcccagtgtggccctgctgcccgtaggtgccgccggtgccggt 508 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggt 402 ||||||||||| || ||||| || |||||||| ||||||||||||||| |||| Sbjct: 515 gtgccggtcatcccagtgtgaccctgctgcccgtaggtgccgccggtgccggt 463 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttctt 318 ||||| ||||||||||||||||| ||| | ||||||||||| Sbjct: 359 ccggggagcttctccttgatcttctccttcatgcccttctt 319 Score = 48.1 bits (24), Expect = 0.024 Identities = 42/48 (87%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||| || ||||| || | |||||| ||||||||||||||| Sbjct: 470 gtgccggtcatcccagtgtgacccttctgcccgtaggtgccgccggtg 423
>emb|X62476.1|TARAB15B T.aestivum rab15B mRNA Length = 1068 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 767 gctcagtgctggcctgggagcttctccttgatcttgtccatgatgcccttcttctcgcc 709 Score = 89.7 bits (45), Expect = 7e-15 Identities = 81/93 (87%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| |||||||||||||| ||||| |||||||| || ||||||| |||||||| | Sbjct: 676 cggtgccgtgcgcccccgtgcctgtcatcccggtgtggcccggctgcccgtaggtgccac 617 Query: 393 cggtggcggtggcgccatgctccccggtgccgg 425 | ||||| |||| ||||||| |||||||||||| Sbjct: 616 cagtggccgtggtgccatgcgccccggtgccgg 584 Score = 81.8 bits (41), Expect = 2e-12 Identities = 62/69 (89%) Strand = Plus / Minus Query: 334 ggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgcc 393 ||||||||||||||| ||||||| ||| |||||||| |||||||| || ||||||||||| Sbjct: 606 ggtgccatgcgccccggtgccggccatcccggtgtggccttgctgtccgtaggtgccgcc 547 Query: 394 ggtggcggt 402 |||| |||| Sbjct: 546 ggtgccggt 538 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| |||||||||||||| Sbjct: 344 ccggggagcttctccttgatcttctccttgatgcccttcttc 303 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggt 402 ||||||||||| || ||||| || |||||||| ||||||||||||||| |||| Sbjct: 545 gtgccggtcatcccagtgtggccctgctgcccgtaggtgccgccggtgccggt 493 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggt 402 ||||||||||| || ||||| || |||||||| ||||||||||||||| |||| Sbjct: 500 gtgccggtcatcccagtgtgaccctgctgcccgtaggtgccgccggtgccggt 448 Score = 48.1 bits (24), Expect = 0.024 Identities = 42/48 (87%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||| || ||||| || | |||||| ||||||||||||||| Sbjct: 455 gtgccggtcatcccagtgtgacccttctgcccgtaggtgccgccggtg 408
>emb|X52424.1|OSRAB16D O.sativa DNA for rab 16D gene Length = 2459 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| ||||| |||||||||||||||||||||| |||||||||||||||||| Sbjct: 1529 gctcagtgctggccggggagcttctccttgatcttgtccacgatgcccttcttctcgcc 1471 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| |||| ||||||||| Sbjct: 1328 ccggggagcttctccttgatcttctccttgatccccttcttc 1287
>dbj|AK109096.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-155-A09, full insert sequence Length = 852 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| ||||| |||||||||||||||||||||| |||||||||||||||||| Sbjct: 563 gctcagtgctggccggggagcttctccttgatcttgtccacgatgcccttcttctcgcc 505 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 356 agcttctccttgatcttctccttgatccccttcttc 321
>gb|AF181454.1|AF181454 Hordeum vulgare dehydrin (Dhn4) gene, complete cds Length = 2440 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 1557 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 1499 Score = 77.8 bits (39), Expect = 3e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| | || | Sbjct: 1452 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgcggtg 1393 Query: 407 ccatgctccccggtgccgg 425 ||||| |||||||||||| Sbjct: 1392 ccatgtgccccggtgccgg 1374 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 1203 agcttctccttgatcttctccttgatgcccttcttc 1168
>gb|AY895904.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 560559 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 726 Score = 77.8 bits (39), Expect = 3e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| | || | Sbjct: 619 cccgtgcctgtcatcccggtgtgaccctgctgcccgtaggtgccgccggtggccgcggtg 560 Query: 407 ccatgctccccggtgccgg 425 ||||| |||||||||||| Sbjct: 559 ccatgtgccccggtgccgg 541 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 |||||||| ||||| |||||||| || |||||||| ||||||||||||||| Sbjct: 679 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtg 629 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895903.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 726 Score = 77.8 bits (39), Expect = 3e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| | || | Sbjct: 619 cccgtgcctgtcatcccggtgtgaccctgctgcccgtaggtgccgccggtggccgcggtg 560 Query: 407 ccatgctccccggtgccgg 425 ||||| |||||||||||| Sbjct: 559 ccatgtgccccggtgccgg 541 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 |||||||| ||||| |||||||| || |||||||| ||||||||||||||| Sbjct: 679 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtg 629 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895902.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin 4-like (Dhn4) gene, partial sequence Length = 422 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 359 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 301 Score = 77.8 bits (39), Expect = 3e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| | || | Sbjct: 194 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgcggtg 135 Query: 407 ccatgctccccggtgccgg 425 ||||| |||||||||||| Sbjct: 134 ccatgtgccccggtgccgg 116
>gb|AY895901.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 4 (Dhn4) gene, complete cds Length = 920 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 782 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 724 Score = 77.8 bits (39), Expect = 3e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| | || | Sbjct: 617 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgcggtg 558 Query: 407 ccatgctccccggtgccgg 425 ||||| |||||||||||| Sbjct: 557 ccatgtgccccggtgccgg 539 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 368 agcttctccttgatcttctccttgatgcccttcttc 333
>gb|AY895900.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 4 (Dhn4) gene, complete cds Length = 924 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 726 Score = 77.8 bits (39), Expect = 3e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| | || | Sbjct: 619 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgcggtg 560 Query: 407 ccatgctccccggtgccgg 425 ||||| |||||||||||| Sbjct: 559 ccatgtgccccggtgccgg 541 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895899.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 726 Score = 77.8 bits (39), Expect = 3e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| | || | Sbjct: 619 cccgtgcctgtcatcccggtgtgaccctgctgcccgtaggtgccgccggtggccgcggtg 560 Query: 407 ccatgctccccggtgccgg 425 ||||| |||||||||||| Sbjct: 559 ccatgtgccccggtgccgg 541 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 |||||||| ||||| |||||||| || |||||||| ||||||||||||||| Sbjct: 679 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtg 629 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895898.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 4 (Dhn4) gene, complete cds Length = 921 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 783 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 725 Score = 77.8 bits (39), Expect = 3e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| | || | Sbjct: 618 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgcggtg 559 Query: 407 ccatgctccccggtgccgg 425 ||||| |||||||||||| Sbjct: 558 ccatgtgccccggtgccgg 540 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 369 agcttctccttgatcttctccttgatgcccttcttc 334
>gb|AY895897.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 4 (Dhn4) gene, complete cds Length = 919 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 781 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 723 Score = 77.8 bits (39), Expect = 3e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| | || | Sbjct: 616 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgcggtg 557 Query: 407 ccatgctccccggtgccgg 425 ||||| |||||||||||| Sbjct: 556 ccatgtgccccggtgccgg 538 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 367 agcttctccttgatcttctccttgatgcccttcttc 332
>gb|AY895896.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 4 (Dhn4) gene, complete cds Length = 910 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 772 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 714 Score = 91.7 bits (46), Expect = 2e-15 Identities = 73/82 (89%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| |||| | Sbjct: 667 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgtggtg 608 Query: 407 ccatgctccccggtgccggtca 428 ||||| ||||||||||||||| Sbjct: 607 ccatgtgccccggtgccggtca 586 Score = 83.8 bits (42), Expect = 4e-13 Identities = 60/66 (90%) Strand = Plus / Minus Query: 334 ggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgcc 393 ||||||||| ||||| ||||||||||| |||||||| |||||||| || ||||||||||| Sbjct: 611 ggtgccatgtgccccggtgccggtcatcccggtgtggccttgctgtccgtaggtgccgcc 552 Query: 394 ggtggc 399 |||||| Sbjct: 551 ggtggc 546 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggt 402 ||||||||||| || ||||| || |||||||| ||||||||||||||| |||| Sbjct: 541 gtgccggtcatgccagtgtgaccctgctgcccgtaggtgccgccggtgccggt 489 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||| || ||||| || |||||||| ||||||||||||||| Sbjct: 496 gtgccggtcatgccagtgtgaccctgctgcccgtaggtgccgccggtg 449 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 373 agcttctccttgatcttctccttgatgcccttcttc 338
>gb|AY895895.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 4 (Dhn4) gene, complete cds Length = 921 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 783 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 725 Score = 77.8 bits (39), Expect = 3e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| | || | Sbjct: 618 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgcggtg 559 Query: 407 ccatgctccccggtgccgg 425 ||||| |||||||||||| Sbjct: 558 ccatgtgccccggtgccgg 540 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 369 agcttctccttgatcttctccttgatgcccttcttc 334
>gb|AY895894.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 726 Score = 77.8 bits (39), Expect = 3e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| | || | Sbjct: 619 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgcggtg 560 Query: 407 ccatgctccccggtgccgg 425 ||||| |||||||||||| Sbjct: 559 ccatgtgccccggtgccgg 541 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 |||||||| ||||| |||||||| || |||||||| ||||||||||||||| Sbjct: 679 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtg 629 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895893.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 726 Score = 77.8 bits (39), Expect = 3e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| | || | Sbjct: 619 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgcggtg 560 Query: 407 ccatgctccccggtgccgg 425 ||||| |||||||||||| Sbjct: 559 ccatgtgccccggtgccgg 541 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895892.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 4 (Dhn4) gene, complete cds Length = 907 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 769 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 711 Score = 91.7 bits (46), Expect = 2e-15 Identities = 73/82 (89%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| |||| | Sbjct: 664 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgtggtg 605 Query: 407 ccatgctccccggtgccggtca 428 ||||| ||||||||||||||| Sbjct: 604 ccatgtgccccggtgccggtca 583 Score = 83.8 bits (42), Expect = 4e-13 Identities = 60/66 (90%) Strand = Plus / Minus Query: 334 ggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgcc 393 ||||||||| ||||| ||||||||||| |||||||| |||||||| || ||||||||||| Sbjct: 608 ggtgccatgtgccccggtgccggtcatcccggtgtggccttgctgtccgtaggtgccgcc 549 Query: 394 ggtggc 399 |||||| Sbjct: 548 ggtggc 543 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggt 402 ||||||||||| || ||||| || |||||||| ||||||||||||||| |||| Sbjct: 538 gtgccggtcatgccagtgtgaccctgctgcccgtaggtgccgccggtgccggt 486 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||| || ||||| || |||||||| ||||||||||||||| Sbjct: 493 gtgccggtcatgccagtgtgaccctgctgcccgtaggtgccgccggtg 446 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895891.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 726 Score = 77.8 bits (39), Expect = 3e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| | || | Sbjct: 619 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgcggtg 560 Query: 407 ccatgctccccggtgccgg 425 ||||| |||||||||||| Sbjct: 559 ccatgtgccccggtgccgg 541 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895890.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 4 (Dhn4) gene, complete cds Length = 907 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 769 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 711 Score = 91.7 bits (46), Expect = 2e-15 Identities = 73/82 (89%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| |||| | Sbjct: 664 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgtggtg 605 Query: 407 ccatgctccccggtgccggtca 428 ||||| ||||||||||||||| Sbjct: 604 ccatgtgccccggtgccggtca 583 Score = 83.8 bits (42), Expect = 4e-13 Identities = 60/66 (90%) Strand = Plus / Minus Query: 334 ggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgcc 393 ||||||||| ||||| ||||||||||| |||||||| |||||||| || ||||||||||| Sbjct: 608 ggtgccatgtgccccggtgccggtcatcccggtgtggccttgctgtccgtaggtgccgcc 549 Query: 394 ggtggc 399 |||||| Sbjct: 548 ggtggc 543 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggt 402 ||||||||||| || ||||| || |||||||| ||||||||||||||| |||| Sbjct: 538 gtgccggtcatgccagtgtgaccctgctgcccgtaggtgccgccggtgccggt 486 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||| || ||||| || |||||||| ||||||||||||||| Sbjct: 493 gtgccggtcatgccagtgtgaccctgctgcccgtaggtgccgccggtg 446 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895889.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 4 (Dhn4) gene, complete cds Length = 921 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 783 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 725 Score = 77.8 bits (39), Expect = 3e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| | || | Sbjct: 618 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgcggtg 559 Query: 407 ccatgctccccggtgccgg 425 ||||| |||||||||||| Sbjct: 558 ccatgtgccccggtgccgg 540 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 369 agcttctccttgatcttctccttgatgcccttcttc 334
>gb|AY895888.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 4 (Dhn4) gene, complete cds Length = 980 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 842 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 784 Score = 77.8 bits (39), Expect = 3e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| | || | Sbjct: 617 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgcggtg 558 Query: 407 ccatgctccccggtgccgg 425 ||||| |||||||||||| Sbjct: 557 ccatgtgccccggtgccgg 539 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 368 agcttctccttgatcttctccttgatgcccttcttc 333
>gb|AY895887.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 4 (Dhn4) gene, complete cds Length = 907 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 769 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 711 Score = 91.7 bits (46), Expect = 2e-15 Identities = 73/82 (89%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| |||| | Sbjct: 664 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgtggtg 605 Query: 407 ccatgctccccggtgccggtca 428 ||||| ||||||||||||||| Sbjct: 604 ccatgtgccccggtgccggtca 583 Score = 83.8 bits (42), Expect = 4e-13 Identities = 60/66 (90%) Strand = Plus / Minus Query: 334 ggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgcc 393 ||||||||| ||||| ||||||||||| |||||||| |||||||| || ||||||||||| Sbjct: 608 ggtgccatgtgccccggtgccggtcatcccggtgtggccttgctgtccgtaggtgccgcc 549 Query: 394 ggtggc 399 |||||| Sbjct: 548 ggtggc 543 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggt 402 ||||||||||| || ||||| || |||||||| ||||||||||||||| |||| Sbjct: 538 gtgccggtcatgccagtgtgaccctgctgcccgtaggtgccgccggtgccggt 486 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||| || ||||| || |||||||| ||||||||||||||| Sbjct: 493 gtgccggtcatgccagtgtgaccctgctgcccgtaggtgccgccggtg 446 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895886.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 4 (Dhn4) gene, complete cds Length = 904 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 766 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 708 Score = 91.7 bits (46), Expect = 2e-15 Identities = 73/82 (89%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| |||| | Sbjct: 661 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgtggtg 602 Query: 407 ccatgctccccggtgccggtca 428 ||||| ||||||||||||||| Sbjct: 601 ccatgtgccccggtgccggtca 580 Score = 83.8 bits (42), Expect = 4e-13 Identities = 60/66 (90%) Strand = Plus / Minus Query: 334 ggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgcc 393 ||||||||| ||||| ||||||||||| |||||||| |||||||| || ||||||||||| Sbjct: 605 ggtgccatgtgccccggtgccggtcatcccggtgtggccttgctgtccgtaggtgccgcc 546 Query: 394 ggtggc 399 |||||| Sbjct: 545 ggtggc 540 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggt 402 ||||||||||| || ||||| || |||||||| ||||||||||||||| |||| Sbjct: 535 gtgccggtcatgccagtgtgaccctgctgcccgtaggtgccgccggtgccggt 483 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||| || ||||| || |||||||| ||||||||||||||| Sbjct: 490 gtgccggtcatgccagtgtgaccctgctgcccgtaggtgccgccggtg 443 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 367 agcttctccttgatcttctccttgatgcccttcttc 332
>gb|AY895885.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 726 Score = 77.8 bits (39), Expect = 3e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| | || | Sbjct: 619 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgcggtg 560 Query: 407 ccatgctccccggtgccgg 425 ||||| |||||||||||| Sbjct: 559 ccatgtgccccggtgccgg 541 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 |||||||| ||||| |||||||| || |||||||| ||||||||||||||| Sbjct: 679 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtg 629 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895884.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 236388 dehydrin 4 (Dhn4) gene, complete cds Length = 916 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 778 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 720 Score = 77.8 bits (39), Expect = 3e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| | || | Sbjct: 613 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgcggtg 554 Query: 407 ccatgctccccggtgccgg 425 ||||| |||||||||||| Sbjct: 553 ccatgtgccccggtgccgg 535 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 364 agcttctccttgatcttctccttgatgcccttcttc 329
>gb|AY895883.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 4 (Dhn4) gene, complete cds Length = 906 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 768 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 710 Score = 83.8 bits (42), Expect = 4e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| |||| | Sbjct: 663 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgtggtg 604 Query: 407 ccatgctccccggtgccggtca 428 ||||| |||||| |||||||| Sbjct: 603 ccatgtgccccggcgccggtca 582 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Minus Query: 334 ggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgcc 393 ||||||||| ||||| | ||||||||| |||||||| |||||||| || ||||||||||| Sbjct: 607 ggtgccatgtgccccggcgccggtcatcccggtgtggccttgctgtccgtaggtgccgcc 548 Query: 394 ggtggc 399 |||||| Sbjct: 547 ggtggc 542 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||| || ||||| || |||||||| ||||||||||||||| Sbjct: 492 gtgccggtcatgccagtgtgaccctgctgcccgtaggtgccgccggtg 445 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 369 agcttctccttgatcttctccttgatgcccttcttc 334 Score = 50.1 bits (25), Expect = 0.006 Identities = 46/53 (86%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggt 402 ||||| ||||| || ||||| || |||||||| ||||||||||||||| |||| Sbjct: 537 gtgcctgtcatgccagtgtgaccctgctgcccgtaggtgccgccggtgccggt 485
>gb|AY895882.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 4 (Dhn4) gene, complete cds Length = 908 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 769 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 711 Score = 91.7 bits (46), Expect = 2e-15 Identities = 73/82 (89%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| |||| | Sbjct: 664 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgtggtg 605 Query: 407 ccatgctccccggtgccggtca 428 ||||| ||||||||||||||| Sbjct: 604 ccatgtgccccggtgccggtca 583 Score = 83.8 bits (42), Expect = 4e-13 Identities = 60/66 (90%) Strand = Plus / Minus Query: 334 ggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgcc 393 ||||||||| ||||| ||||||||||| |||||||| |||||||| || ||||||||||| Sbjct: 608 ggtgccatgtgccccggtgccggtcatcccggtgtggccttgctgtccgtaggtgccgcc 549 Query: 394 ggtggc 399 |||||| Sbjct: 548 ggtggc 543 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggt 402 ||||||||||| || ||||| || |||||||| ||||||||||||||| |||| Sbjct: 538 gtgccggtcatgccagtgtgaccctgctgcccgtaggtgccgccggtgccggt 486 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||| || ||||| || |||||||| ||||||||||||||| Sbjct: 493 gtgccggtcatgccagtgtgaccctgctgcccgtaggtgccgccggtg 446 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895881.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 4 (Dhn4) gene, complete cds Length = 907 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 769 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 711 Score = 91.7 bits (46), Expect = 2e-15 Identities = 73/82 (89%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| |||| | Sbjct: 664 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgtggtg 605 Query: 407 ccatgctccccggtgccggtca 428 ||||| ||||||||||||||| Sbjct: 604 ccatgtgccccggtgccggtca 583 Score = 83.8 bits (42), Expect = 4e-13 Identities = 60/66 (90%) Strand = Plus / Minus Query: 334 ggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgcc 393 ||||||||| ||||| ||||||||||| |||||||| |||||||| || ||||||||||| Sbjct: 608 ggtgccatgtgccccggtgccggtcatcccggtgtggccttgctgtccgtaggtgccgcc 549 Query: 394 ggtggc 399 |||||| Sbjct: 548 ggtggc 543 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggt 402 ||||||||||| || ||||| || |||||||| ||||||||||||||| |||| Sbjct: 538 gtgccggtcatgccagtgtgaccctgctgcccgtaggtgccgccggtgccggt 486 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 ||||||||||| || ||||| || |||||||| ||||||||||||||| Sbjct: 493 gtgccggtcatgccagtgtgaccctgctgcccgtaggtgccgccggtg 446 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895880.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 726 Score = 77.8 bits (39), Expect = 3e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| | || | Sbjct: 619 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgcggtg 560 Query: 407 ccatgctccccggtgccgg 425 ||||| |||||||||||| Sbjct: 559 ccatgtgccccggtgccgg 541 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 |||||||| ||||| |||||||| || |||||||| ||||||||||||||| Sbjct: 679 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtg 629 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335
>gb|AF043090.1|AF043090 Hordeum vulgare dehydrin 4 (dhn4) gene, complete cds Length = 2790 Score = 93.7 bits (47), Expect = 4e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 2205 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 2147 Score = 77.8 bits (39), Expect = 3e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| || |||||||| ||||||||||||||||| | || | Sbjct: 1980 cccgtgcctgtcatcccggtgtggccctgctgcccgtaggtgccgccggtggccgcggtg 1921 Query: 407 ccatgctccccggtgccgg 425 ||||| |||||||||||| Sbjct: 1920 ccatgtgccccggtgccgg 1902 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 1731 agcttctccttgatcttctccttgatgcccttcttc 1696
>gb|AY349237.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 91.7 bits (46), Expect = 2e-15 Identities = 64/70 (91%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1008 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 949 Query: 330 cgtcggtgcc 339 |||||||||| Sbjct: 948 cgtcggtgcc 939 Score = 83.8 bits (42), Expect = 4e-13 Identities = 101/122 (82%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccgggaagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| ||||||||| || |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgaccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 |||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | |||| |||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctccccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| ||||| |||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttatccttgatgttttccatgacgcccttcttctcgcc 546
>gb|AY349236.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 5 (Dhn5) gene, partial cds Length = 446 Score = 91.7 bits (46), Expect = 2e-15 Identities = 64/70 (91%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 399 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 340 Query: 330 cgtcggtgcc 339 |||||||||| Sbjct: 339 cgtcggtgcc 330 Score = 83.8 bits (42), Expect = 4e-13 Identities = 101/122 (82%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 175 ccgggaagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 125 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| ||||||||| || |||||||| ||||||||||||||| Sbjct: 124 ccgtgcgtcccagtgccggtcactccggtgtgaccgtgctgcccgtaggtgccgccggtg 65 Query: 398 gc 399 || Sbjct: 64 gc 63
>gb|AY349235.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 5 (Dhn5) gene, partial cds Length = 446 Score = 91.7 bits (46), Expect = 2e-15 Identities = 64/70 (91%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 399 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 340 Query: 330 cgtcggtgcc 339 |||||||||| Sbjct: 339 cgtcggtgcc 330 Score = 83.8 bits (42), Expect = 4e-13 Identities = 101/122 (82%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 175 ccgggaagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 125 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| ||||||||| || |||||||| ||||||||||||||| Sbjct: 124 ccgtgcgtcccagtgccggtcactccggtgtgaccgtgctgcccgtaggtgccgccggtg 65 Query: 398 gc 399 || Sbjct: 64 gc 63
>gb|AY349234.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 91.7 bits (46), Expect = 2e-15 Identities = 123/149 (82%), Gaps = 6/149 (4%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1008 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 949 Query: 330 cgtcggtgccatgcg------cccccgtgccggtcattccggtgtgtccttgctgcccat 383 |||||||||| || | | || ||||| ||| | ||||| ||| | |||||||| | Sbjct: 948 cgtcggtgccgtgtgtgccagcgccagtgccagtcgtgccggtctgtgcctgctgcccgt 889 Query: 384 aggtgccgccggtggcggtggcgccatgc 412 |||||||||| ||||| |||| ||||||| Sbjct: 888 aggtgccgccagtggccgtggtgccatgc 860 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| |||||||||||| |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 |||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | ||||||||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctgcccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttctccttgatgttttccatgacgcccttcttctcgcc 546
>gb|AY349230.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 dehydrin 5 (Dhn5) gene, partial cds Length = 1061 Score = 91.7 bits (46), Expect = 2e-15 Identities = 64/70 (91%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1014 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 955 Query: 330 cgtcggtgcc 339 |||||||||| Sbjct: 954 cgtcggtgcc 945 Score = 83.8 bits (42), Expect = 4e-13 Identities = 101/122 (82%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccgggaagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| ||||||||| || |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgaccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 |||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | |||| |||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctccccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| ||||| |||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttatccttgatgttttccatgacgcccttcttctcgcc 546 Score = 46.1 bits (23), Expect = 0.093 Identities = 35/39 (89%) Strand = Plus / Minus Query: 374 tgctgcccataggtgccgccggtggcggtggcgccatgc 412 |||||||| ||||||||||| ||||| |||| ||||||| Sbjct: 898 tgctgcccgtaggtgccgccagtggccgtggtgccatgc 860
>gb|AY349228.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 91.7 bits (46), Expect = 2e-15 Identities = 64/70 (91%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1008 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 949 Query: 330 cgtcggtgcc 339 |||||||||| Sbjct: 948 cgtcggtgcc 939 Score = 91.7 bits (46), Expect = 2e-15 Identities = 102/122 (83%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccggggagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| |||||||||||| |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | ||||||||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctgcccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 ||||| |||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttgtccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttctccttgatgttttccatgacgcccttcttctcgcc 546 Score = 46.1 bits (23), Expect = 0.093 Identities = 35/39 (89%) Strand = Plus / Minus Query: 374 tgctgcccataggtgccgccggtggcggtggcgccatgc 412 |||||||| ||||||||||| ||||| |||| ||||||| Sbjct: 898 tgctgcccgtaggtgccgccagtggccgtggtgccatgc 860
>gb|AY349226.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 5 (Dhn5) gene, partial cds Length = 446 Score = 91.7 bits (46), Expect = 2e-15 Identities = 64/70 (91%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 399 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 340 Query: 330 cgtcggtgcc 339 |||||||||| Sbjct: 339 cgtcggtgcc 330 Score = 83.8 bits (42), Expect = 4e-13 Identities = 101/122 (82%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 175 ccgggaagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 125 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| ||||||||| || |||||||| ||||||||||||||| Sbjct: 124 ccgtgcgtcccagtgccggtcactccggtgtgaccgtgctgcccgtaggtgccgccggtg 65 Query: 398 gc 399 || Sbjct: 64 gc 63
>gb|AY349225.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 5 (Dhn5) gene, partial cds Length = 446 Score = 91.7 bits (46), Expect = 2e-15 Identities = 64/70 (91%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 399 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 340 Query: 330 cgtcggtgcc 339 |||||||||| Sbjct: 339 cgtcggtgcc 330 Score = 83.8 bits (42), Expect = 4e-13 Identities = 101/122 (82%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 175 ccgggaagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 125 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| ||||||||| || |||||||| ||||||||||||||| Sbjct: 124 ccgtgcgtcccagtgccggtcactccggtgtgaccgtgctgcccgtaggtgccgccggtg 65 Query: 398 gc 399 || Sbjct: 64 gc 63
>gb|AY349223.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 91.7 bits (46), Expect = 2e-15 Identities = 64/70 (91%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1008 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 949 Query: 330 cgtcggtgcc 339 |||||||||| Sbjct: 948 cgtcggtgcc 939 Score = 83.8 bits (42), Expect = 4e-13 Identities = 101/122 (82%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccgggaagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| ||||||||| || |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgaccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgt 332 |||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccgt 145 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | |||| |||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtgcatgctccccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| ||||| |||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttatccttgatgttttccatgacgcccttcttctcgcc 546
>gb|AY349220.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 91.7 bits (46), Expect = 2e-15 Identities = 64/70 (91%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcc 329 |||||||||| |||||||| ||||||||||||||||||| || |||||||||||| || | Sbjct: 1008 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 949 Query: 330 cgtcggtgcc 339 |||||||||| Sbjct: 948 cgtcggtgcc 939 Score = 83.8 bits (42), Expect = 4e-13 Identities = 101/122 (82%), Gaps = 9/122 (7%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccagtcccgtcggtg 337 ||||| |||||||||||||| || ||||||| |||||||||||||| |||| Sbjct: 784 ccgggaagcttctccttgatgttctccatgacacccttcttctcgcc---------ggtg 734 Query: 338 ccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtg 397 || |||| ||| |||||||||| ||||||||| || |||||||| ||||||||||||||| Sbjct: 733 ccgtgcgtcccagtgccggtcactccggtgtgaccgtgctgcccgtaggtgccgccggtg 674 Query: 398 gc 399 || Sbjct: 673 gc 672 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgcc 324 |||||||||||||| || ||||||||||||||||||||||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgcc 153 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 333 cggtgccatgcgcccccgtgccggtcattccggtgtgtccttgctgcccataggtgccgc 392 ||||||| || | ||||||||||||| |||||||||| | |||| |||||||| ||||| Sbjct: 354 cggtgccgtgtgtccccgtgccggtctctccggtgtgtacatgctccccataggagccgc 295 Query: 393 cggtggcggtggcgccatgc 412 ||||||| | ||||| |||| Sbjct: 294 cggtggccggggcgctatgc 275 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| ||||| |||||||| || ||||||| ||||||||||||||| Sbjct: 592 ccggggagcttatccttgatgttttccatgacgcccttcttctcgcc 546
>emb|X72748.1|HVDEHYD H.vulgare mRNA for dehydrin Length = 1016 Score = 85.7 bits (43), Expect = 1e-13 Identities = 55/59 (93%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||||| || | ||||||||||||||||||||||||||||||||||||||||| Sbjct: 707 gctcagtgctggccaaggagcttctccttgatcttgtccatgatgcccttcttctcgcc 649 Score = 85.7 bits (43), Expect = 1e-13 Identities = 70/79 (88%) Strand = Plus / Minus Query: 347 cccgtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggcggtggcg 406 |||||||| ||||| |||||||| ||||||||||| ||||||||||||||||| | || | Sbjct: 602 cccgtgcctgtcatcccggtgtggccttgctgcccgtaggtgccgccggtggccgcggtg 543 Query: 407 ccatgctccccggtgccgg 425 ||||| |||||||||||| Sbjct: 542 ccatgtgccccggtgccgg 524 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||| ||| |||||||||||||| Sbjct: 353 agcttctccttgatcttctccttgatgcccttcttc 318
>emb|X52422.1|OSRAB16B O.sativa DNA for rab 16B gene Length = 2890 Score = 85.7 bits (43), Expect = 1e-13 Identities = 52/55 (94%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||| ||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 1983 agtgctggccgggcagcttctccttgatcttgtccatgaatcccttcttctcgcc 1929 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||||||||| ||| |||| ||||||||| Sbjct: 1798 ccgggcagcttctccttgatcttctccttgatccccttcttc 1757
>dbj|AK063517.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-116-H03, full insert sequence Length = 872 Score = 85.7 bits (43), Expect = 1e-13 Identities = 52/55 (94%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||| ||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 628 agtgctggccgggcagcttctccttgatcttgtccatgaatcccttcttctcgcc 574 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||||||||||||||||||||| ||| |||| ||||||||| Sbjct: 443 ccgggcagcttctccttgatcttctccttgattcccttcttc 402
>gb|AF155129.1|AF155129 Hordeum vulgare dehydrin 12 (Dhn12) gene, complete cds Length = 2890 Score = 85.7 bits (43), Expect = 1e-13 Identities = 55/59 (93%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 |||||||||||||||||||||||||||||||||||||||| || ||||||| |||||| Sbjct: 1897 gctcagtgctgtccgggcagcttctccttgatcttgtccacgactcccttctcctcgcc 1839
>emb|X71362.1|HVDHN7 H.vulgare gene for dehydrin 7 Length = 2138 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 1523 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 1464 Query: 322 gcc 324 ||| Sbjct: 1463 gcc 1461 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 1376 tccggggagcttctccttgatcttctccttcatccccttcttc 1334
>emb|X15288.1|HVDHN8 Barley mRNA for dehydrin (dhn8) Length = 683 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 496 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 437 Query: 322 gcc 324 ||| Sbjct: 436 gcc 434 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 349 tccggggagcttctccttgatcttctccttcatccccttcttc 307
>emb|X98326.1|HVDEHYDRN H.vulgare mRNA for dehydrin Length = 671 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 485 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 426 Query: 322 gcc 324 ||| Sbjct: 425 gcc 423 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 335 tccggggagcttctccttgatcttctccttcatccccttcttc 293
>gb|AF181451.1|AF181451 Hordeum vulgare dehydrin (Dhn1) mRNA, complete cds Length = 512 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 450 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 391 Query: 322 gcc 324 ||| Sbjct: 390 gcc 388 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 303 tccggggagcttctccttgatcttctccttcatccccttcttc 261
>gb|AY895879.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 1 (Dhn1) gene, partial cds Length = 1446 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 322 gcc 324 ||| Sbjct: 444 gcc 442 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 357 tccggggagcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895878.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin 1 (Dhn1) gene, partial cds Length = 1268 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 322 gcc 324 ||| Sbjct: 444 gcc 442 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 357 tccggggagcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895877.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 1 (Dhn1) gene, partial cds Length = 1268 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 322 gcc 324 ||| Sbjct: 444 gcc 442 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 357 tccggggagcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895876.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 1 (Dhn1) gene, partial cds Length = 1291 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 322 gcc 324 ||| Sbjct: 444 gcc 442 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 357 tccggggagcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895875.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 1 (Dhn1) gene, partial cds Length = 1268 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 322 gcc 324 ||| Sbjct: 444 gcc 442 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 357 tccggggagcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895874.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 1 (Dhn1) gene, partial cds Length = 1249 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 322 gcc 324 ||| Sbjct: 444 gcc 442 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 357 tccggggagcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895873.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 1 (Dhn1) gene, partial cds Length = 1202 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 322 gcc 324 ||| Sbjct: 444 gcc 442 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 357 tccggggagcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895872.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 1 (Dhn1) gene, partial cds Length = 1268 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 322 gcc 324 ||| Sbjct: 444 gcc 442 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 357 tccggggagcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895871.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 1 (Dhn1) gene, partial cds Length = 1330 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 498 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 439 Query: 322 gcc 324 ||| Sbjct: 438 gcc 436 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 351 tccggggagcttctccttgatcttctccttcatccccttcttc 309
>gb|AY895870.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 1 (Dhn1) gene, partial cds Length = 1428 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 322 gcc 324 ||| Sbjct: 444 gcc 442 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 357 tccggggagcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895869.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 322 gcc 324 ||| Sbjct: 444 gcc 442 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 357 tccggggagcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895868.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 322 gcc 324 ||| Sbjct: 444 gcc 442 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 357 tccggggagcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895867.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 1 (Dhn1) gene, partial cds Length = 1417 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 498 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 439 Query: 322 gcc 324 ||| Sbjct: 438 gcc 436 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 351 tccggggagcttctccttgatcttctccttcatccccttcttc 309
>gb|AY895866.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 1 (Dhn1) gene, partial cds Length = 1428 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 322 gcc 324 ||| Sbjct: 444 gcc 442 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 357 tccggggagcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895865.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 498 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 439 Query: 322 gcc 324 ||| Sbjct: 438 gcc 436 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 351 tccggggagcttctccttgatcttctccttcatccccttcttc 309
>gb|AY895863.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 322 gcc 324 ||| Sbjct: 444 gcc 442 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 357 tccggggagcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895862.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 322 gcc 324 ||| Sbjct: 444 gcc 442 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 357 tccggggagcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895861.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 1 (Dhn1) gene, partial cds Length = 1243 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 508 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 449 Query: 322 gcc 324 ||| Sbjct: 448 gcc 446 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 361 tccggggagcttctccttgatcttctccttcatccccttcttc 319
>gb|AY895860.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 1 (Dhn1) gene, partial cds Length = 1249 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 322 gcc 324 ||| Sbjct: 444 gcc 442 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 357 tccggggagcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895859.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 1 (Dhn1) gene, partial cds Length = 1243 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 508 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 449 Query: 322 gcc 324 ||| Sbjct: 448 gcc 446 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 361 tccggggagcttctccttgatcttctccttcatccccttcttc 319
>gb|AY895858.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 322 gcc 324 ||| Sbjct: 444 gcc 442 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 357 tccggggagcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895857.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 1 (Dhn1) gene, partial cds Length = 1249 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 322 gcc 324 ||| Sbjct: 444 gcc 442 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 357 tccggggagcttctccttgatcttctccttcatccccttcttc 315
>gb|AF043087.1|AF043087 Hordeum vulgare dehydrin 1 (dhn1) gene, complete cds Length = 2717 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 265 ggctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 1780 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 1721 Query: 322 gcc 324 ||| Sbjct: 1720 gcc 1718 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 1633 tccggggagcttctccttgatcttctccttcatccccttcttc 1591
>gb|AF031249.1|AF031249 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-4) mRNA, complete cds Length = 680 Score = 79.8 bits (40), Expect = 7e-12 Identities = 67/76 (88%) Strand = Plus / Minus Query: 264 gggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgc 323 ||||| |||||||||| |||||||| |||||||||||||||||||||| ||| ||||| | Sbjct: 398 gggcttagtgctgtccaggcagcttgtccttgatcttgtccatgatgctcttgttctcac 339 Query: 324 cagtcccgtcggtgcc 339 | || ||||| ||||| Sbjct: 338 cggtgccgtcagtgcc 323
>gb|U73213.1|TAU73213 Triticum aestivum cold acclimation protein WCOR726 (Wcor726) mRNA, complete cds Length = 667 Score = 79.8 bits (40), Expect = 7e-12 Identities = 67/76 (88%) Strand = Plus / Minus Query: 264 gggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgc 323 ||||| |||||||||| |||||||| |||||||||||||||||||||| ||| ||||| | Sbjct: 442 gggcttagtgctgtccaggcagcttgtccttgatcttgtccatgatgctcttgttctcac 383 Query: 324 cagtcccgtcggtgcc 339 | || ||||| ||||| Sbjct: 382 cggtgccgtcagtgcc 367 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgc 323 ||||| |||||||||||||| || || |||| |||||||||||||| Sbjct: 266 ccggggagcttctccttgatgttctcgatgacgcccttcttctcgc 221
>emb|X52423.1|OSRAB16C O.sativa DNA for rab 16C gene Length = 2493 Score = 77.8 bits (39), Expect = 3e-11 Identities = 51/55 (92%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||| ||||| ||||| ||||||||||||||||||| ||||||||||||||| Sbjct: 2054 agtgctggccgggaagcttttccttgatcttgtccatgaagcccttcttctcgcc 2000 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| |||| ||||||||| Sbjct: 1863 ccggggagcttctccttgatcttctccttgattcccttcttc 1822
>dbj|AK071366.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096D05, full insert sequence Length = 795 Score = 77.8 bits (39), Expect = 3e-11 Identities = 51/55 (92%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||| ||||| ||||| ||||||||||||||||||| ||||||||||||||| Sbjct: 571 agtgctggccgggaagcttttccttgatcttgtccatgaagcccttcttctcgcc 517 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| |||| ||||||||| Sbjct: 380 ccggggagcttctccttgatcttctccttgattcccttcttc 339
>gb|AY895864.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 1 (Dhn1) gene, partial cds Length = 1230 Score = 77.8 bits (39), Expect = 3e-11 Identities = 45/47 (95%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| ||||||||||||||||||||||||| ||||||||||||||| Sbjct: 488 ccgggaagcttctccttgatcttgtccatgacgcccttcttctcgcc 442 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| | || ||||||||| Sbjct: 357 tccggggagcttctccttgatcttctccttcatccccttcttc 315
>gb|AF031250.1|AF031250 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-5) mRNA, complete cds Length = 697 Score = 75.8 bits (38), Expect = 1e-10 Identities = 53/58 (91%) Strand = Plus / Minus Query: 264 gggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||| |||||||||| |||||||| |||||||||||||||||||||| ||| ||||| Sbjct: 422 gggcttagtgctgtccaggcagcttgtccttgatcttgtccatgatgctcttgttctc 365 Score = 46.1 bits (23), Expect = 0.093 Identities = 41/47 (87%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || || | || ||||||||||||||| Sbjct: 246 ccggggagcttctccttgatgttctcgacgacgcccttcttctcgcc 200
>gb|AF181461.1|AF181461 Hordeum vulgare dehydrin (Dhn11) gene, complete cds Length = 2009 Score = 73.8 bits (37), Expect = 4e-10 Identities = 52/57 (91%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 |||||||| ||||| || ||||||||||||||||| |||||||| |||||||||||| Sbjct: 1641 gctcagtggtgtccagggagcttctccttgatcttctccatgatacccttcttctcg 1585 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttct 320 ||||||||||| ||||| ||| ||||||||||||||| Sbjct: 1512 agcttctcctttatcttctccttgatgcccttcttct 1476
>gb|AF043086.1|AF043086 Hordeum vulgare dehydrin 11 (dhn11) gene, complete cds Length = 2420 Score = 73.8 bits (37), Expect = 4e-10 Identities = 52/57 (91%) Strand = Plus / Minus Query: 266 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 |||||||| ||||| || ||||||||||||||||| |||||||| |||||||||||| Sbjct: 1649 gctcagtggtgtccagggagcttctccttgatcttctccatgatacccttcttctcg 1593 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttct 320 ||||||||||| ||||| ||| ||||||||||||||| Sbjct: 1520 agcttctcctttatcttctccttgatgcccttcttct 1484
>gb|AY823548.1| Pennisetum glaucum putative RAB protein mRNA, complete cds Length = 616 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||| ||||| ||||||||||||||||||||||||| ||||||||||| Sbjct: 499 agtgctgcccgggaagcttctccttgatcttgtccatgagtcccttcttctc 448 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 277 tccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 |||||| ||||||||||||||||| ||| ||||||| |||||| Sbjct: 339 tccggggagcttctccttgatcttctccttgatgcctttcttc 297
>gb|AY465376.1| Prunus persica dehydrin 2 mRNA, complete cds Length = 829 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||| |||||||| || ||||||||||||||||||||||| ||||||||||| Sbjct: 699 agtgttgtccgggaagtttctccttgatcttgtccatgatccccttcttctc 648 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 281 ggcagcttctccttgatcttgtccat 306 |||||||||||||||||||||||||| Sbjct: 544 ggcagcttctccttgatcttgtccat 519
>gb|AF172263.1| Prunus dulcis abscisic acid response protein (rab21) mRNA, complete cds Length = 897 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||| |||||||| || ||||||||||||||||||||||| ||||||||||| Sbjct: 693 agtgttgtccgggaagtttctccttgatcttgtccatgatccccttcttctc 642 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 281 ggcagcttctccttgatcttgtccat 306 |||||||||||||||||||||||||| Sbjct: 538 ggcagcttctccttgatcttgtccat 513
>emb|X15289.1|HVDHN9 Barley mRNA for dehydrin (dhn9) Length = 683 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/62 (90%), Gaps = 3/62 (4%) Strand = Plus / Minus Query: 266 gctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 489 gctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacacccttcttctcg 430 Query: 323 cc 324 || Sbjct: 429 cc 428
>gb|AF043088.1|AF043088 Hordeum vulgare dehydrin 2 (dhn2) gene, complete cds Length = 1849 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/62 (90%), Gaps = 3/62 (4%) Strand = Plus / Minus Query: 266 gctcagtgctgtccg---ggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||||||||||||| || ||||||||||||||||||||||||| |||||||||||| Sbjct: 1190 gctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacacccttcttctcg 1131 Query: 323 cc 324 || Sbjct: 1130 cc 1129
>emb|X78432.1|TDDEH38 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd38 Length = 555 Score = 69.9 bits (35), Expect = 6e-09 Identities = 44/47 (93%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||||||||||||||||||| Sbjct: 134 ccggggagcttctccttgatgttctccatgatgcccttcttctcgcc 88 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 257 gcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttc 316 |||| ||| ||| |||||||||| |||||||||||||| | ||||||||||| || |||| Sbjct: 356 gcagaccgagcttagtgctgtccaggcagcttctccttcaccttgtccatgaggctcttc 297 Query: 317 ttctc 321 ||||| Sbjct: 296 ttctc 292
>emb|X78430.1|TDDEH25 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd25a Length = 565 Score = 69.9 bits (35), Expect = 6e-09 Identities = 44/47 (93%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || ||||||||||||||||||||||| Sbjct: 140 ccggggagcttctccttgatgttctccatgatgcccttcttctcgcc 94 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 257 gcaggccgggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttc 316 |||| ||| ||| |||||||||| |||||||||||||| | ||||||||||| || |||| Sbjct: 362 gcagaccgagcttagtgctgtccaggcagcttctccttcaccttgtccatgaggctcttc 303 Query: 317 ttctc 321 ||||| Sbjct: 302 ttctc 298
>gb|AF181452.1|AF181452 Hordeum vulgare dehydrin (Dhn2) gene, complete cds Length = 1294 Score = 69.9 bits (35), Expect = 6e-09 Identities = 55/61 (90%), Gaps = 3/61 (4%) Strand = Plus / Minus Query: 267 ctcagtgctgt---ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgc 323 ||||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||| Sbjct: 1181 ctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacacccttcttctcgc 1122 Query: 324 c 324 | Sbjct: 1121 c 1121
>gb|AF181460.1|AF181460 Hordeum vulgare dehydrin (Dhn10) gene, complete cds Length = 2501 Score = 69.9 bits (35), Expect = 6e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||| || |||||||| ||||||||||||||||| || |||||||||||||| Sbjct: 1896 agtgctggccaggcagcttttccttgatcttgtccataatacccttcttctcgcc 1842 Score = 61.9 bits (31), Expect = 2e-06 Identities = 66/75 (88%), Gaps = 2/75 (2%) Strand = Plus / Minus Query: 287 ttctccttgatcttgtccatgatgcccttcttctcgccagtc-ccgtcggtgccatgcgc 345 |||||| ||||||||||| | |||||||||||||| |||||| |||| ||| || ||||| Sbjct: 1561 ttctccatgatcttgtccttcatgcccttcttctcaccagtcgccgt-ggtcccgtgcgc 1503 Query: 346 ccccgtgccggtcat 360 ||| ||||||||||| Sbjct: 1502 cccggtgccggtcat 1488 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| |||||||||||||| Sbjct: 1267 ccgggaagcttctccttgatcttctccttgatgcccttcttc 1226
>gb|AF043095.1|AF043095 Hordeum vulgare dehydrin 10 (dhn10) gene, complete cds Length = 2984 Score = 69.9 bits (35), Expect = 6e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||| || |||||||| ||||||||||||||||| || |||||||||||||| Sbjct: 2294 agtgctggccaggcagcttttccttgatcttgtccataatacccttcttctcgcc 2240 Score = 61.9 bits (31), Expect = 2e-06 Identities = 66/75 (88%), Gaps = 2/75 (2%) Strand = Plus / Minus Query: 287 ttctccttgatcttgtccatgatgcccttcttctcgccagtc-ccgtcggtgccatgcgc 345 |||||| ||||||||||| | |||||||||||||| |||||| |||| ||| || ||||| Sbjct: 1959 ttctccatgatcttgtccttcatgcccttcttctcaccagtcgccgt-ggtcccgtgcgc 1901 Query: 346 ccccgtgccggtcat 360 ||| ||||||||||| Sbjct: 1900 cccggtgccggtcat 1886 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| |||||||||||||| Sbjct: 1665 ccgggaagcttctccttgatcttctccttgatgcccttcttc 1624
>dbj|AB076807.1| Triticum aestivum Wdhn13 mRNA for LEA D-11 dehydrin, complete cds Length = 657 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 264 gggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||| |||||||||| |||||||| ||||||||||||||||| |||| ||| ||||| Sbjct: 389 gggcttagtgctgtccaggcagcttgtccttgatcttgtccatcatgctcttgttctc 332 Score = 60.0 bits (30), Expect = 6e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 350 gtgccggtcattccggtgtgtccttgctgcccataggtgccgccggtggc 399 |||||||| | ||||||||||||||||||||| || ||||| |||||||| Sbjct: 153 gtgccggtaactccggtgtgtccttgctgcccgtacgtgccaccggtggc 104 Score = 46.1 bits (23), Expect = 0.093 Identities = 41/47 (87%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||| |||||||||||||| || || | || ||||||||||||||| Sbjct: 213 ccgggaagcttctccttgatgttctcgacgacgcccttcttctcgcc 167 Score = 42.1 bits (21), Expect = 1.5 Identities = 36/41 (87%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcgcc 324 ||||||||| |||| | ||||||| ||||||||||||||| Sbjct: 75 agcttctccgtgatgctttccatgacgcccttcttctcgcc 35
>ref|NM_192219.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 687 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||| ||||||||||||||||| |||| |||||||||||||||| Sbjct: 671 ccggggagcttctccttgatcttctccacgatgcccttcttctcg 627 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttct 320 ||||| ||||||||||| ||||| ||| |||||| |||||||| Sbjct: 533 ccgggaagcttctcctttatcttctccttgatgctcttcttct 491
>gb|AY333185.1| Oryza sativa (japonica cultivar-group) drought-resistant protein mRNA, complete cds Length = 1021 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||| ||||||||||||||||| |||| |||||||||||||||| Sbjct: 760 ccggggagcttctccttgatcttctccacgatgcccttcttctcg 716 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttct 320 ||||| ||||||||||| ||||| ||| |||||| |||||||| Sbjct: 622 ccgggaagcttctcctttatcttctccttgatgctcttcttct 580
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||| ||||||||||||||||| |||| |||||||||||||||| Sbjct: 29117638 ccggggagcttctccttgatcttctccacgatgcccttcttctcg 29117594 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttct 320 ||||| ||||||||||| ||||| ||| |||||| |||||||| Sbjct: 29117500 ccgggaagcttctcctttatcttctccttgatgctcttcttct 29117458 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 390 cgccggtggcggtggcgccat 410 ||||||||||||||||||||| Sbjct: 5147936 cgccggtggcggtggcgccat 5147916
>dbj|AP003245.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0421H07 Length = 158126 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||| ||||||||||||||||| |||| |||||||||||||||| Sbjct: 78004 ccggggagcttctccttgatcttctccacgatgcccttcttctcg 77960 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttct 320 ||||| ||||||||||| ||||| ||| |||||| |||||||| Sbjct: 77866 ccgggaagcttctcctttatcttctccttgatgctcttcttct 77824
>emb|X57327.1|OSRAB25 Rice rab25 mRNA Length = 920 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||| ||||||||||||||||| |||| |||||||||||||||| Sbjct: 731 ccggggagcttctccttgatcttctccacgatgcccttcttctcg 687 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttct 320 ||||| ||||||||||| ||||| ||| |||||| |||||||| Sbjct: 593 ccgggaagcttctcctttatcttctccttgatgctcttcttct 551
>gb|AF181456.1|AF181456 Hordeum vulgare dehydrin (Dhn6) mRNA, complete cds Length = 1637 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||| ||||||||||||||||| ||||| ||||||||||||||| Sbjct: 1467 ccggggagcttctccttgatcttctccatcatgcccttcttctcg 1423 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||||||||||||||| ||||||| ||||||||||||| Sbjct: 1284 agcttctccttgatcttctccatgacgcccttcttctcg 1246
>dbj|AK063691.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-F09, full insert sequence Length = 761 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||| ||||||||||||||||| |||| |||||||||||||||| Sbjct: 552 ccggggagcttctccttgatcttctccacgatgcccttcttctcg 508 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttct 320 ||||| ||||||||||| ||||| ||| |||||| |||||||| Sbjct: 414 ccgggaagcttctcctttatcttctccttgatgctcttcttct 372
>gb|AF043091.1|AF043091 Hordeum vulgare dehydrin 6 (dhn6) gene, complete cds Length = 3086 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||| ||||||||||||||||| ||||| ||||||||||||||| Sbjct: 2382 ccggggagcttctccttgatcttctccatcatgcccttcttctcg 2338 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||||||||||||||| ||||||| ||||||||||||| Sbjct: 2199 agcttctccttgatcttctccatgacgcccttcttctcg 2161
>gb|AY587109.1| Oryza sativa (japonica cultivar-group) dehydration-stress inducible protein 1 mRNA, complete cds Length = 1315 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||||||||||||| | || |||||||||||| Sbjct: 734 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctc 691 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttct 320 ||||||||||||||||||||||| ||| ||| |||||||||| Sbjct: 473 ccgggcagcttctccttgatcttctccttgagccccttcttct 431 Score = 40.1 bits (20), Expect = 5.7 Identities = 38/44 (86%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||| |||||| |||||||| ||| || ||||||||||| Sbjct: 908 ccgggcagtttctccatgatcttgcccagtatacccttcttctc 865
>gb|AY786415.1| Oryza sativa (japonica cultivar-group) SK3-type dehydrin 1 (Dhn1) mRNA, complete cds Length = 1117 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||||||||||||| | || |||||||||||| Sbjct: 724 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctc 681 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttct 320 ||||||||||||||||||||||| ||| ||| |||||||||| Sbjct: 463 ccgggcagcttctccttgatcttctccttgagccccttcttct 421 Score = 40.1 bits (20), Expect = 5.7 Identities = 38/44 (86%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||| |||||| |||||||| ||| || ||||||||||| Sbjct: 898 ccgggcagtttctccatgatcttgcccagtatacccttcttctc 855
>emb|X74067.1|CPCDET619 Craterostigma plantagineum CDeT6-19 gene for dessication-related protein Length = 1742 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||| |||||||| ||||||||||||||||||||||| ||||| Sbjct: 1523 ccgggaagcttctctttgatcttgtccatgatgccctttttctc 1480 Score = 42.1 bits (21), Expect = 1.5 Identities = 36/41 (87%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttctt 318 ||||| ||||||||||| ||||||||| | || |||||||| Sbjct: 1409 ccgggaagcttctccttcatcttgtccttcatccccttctt 1369
>gb|M62988.1|CRTDESRSB Craterostigma plantagineum dessication-related protein mRNA, complete cds Length = 741 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||| |||||||| ||||||||||||||||||||||| ||||| Sbjct: 522 ccgggaagcttctctttgatcttgtccatgatgccctttttctc 479 Score = 42.1 bits (21), Expect = 1.5 Identities = 36/41 (87%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttctt 318 ||||| ||||||||||| ||||||||| | || |||||||| Sbjct: 408 ccgggaagcttctccttcatcttgtccttcatccccttctt 368
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||||||||||||| | || |||||||||||| Sbjct: 27184553 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctc 27184596 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttct 320 ||||||||||||||||||||||| ||| ||| |||||||||| Sbjct: 27184814 ccgggcagcttctccttgatcttctccttgagccccttcttct 27184856 Score = 40.1 bits (20), Expect = 5.7 Identities = 38/44 (86%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||| |||||| |||||||| ||| || ||||||||||| Sbjct: 27184379 ccgggcagtttctccatgatcttgcccagtatacccttcttctc 27184422
>gb|L19419.1|LHPESI Lophopyrum elongatum ES135 mRNA sequence Length = 1130 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||||||||||||||||||| ||||||| ||| |||||||| Sbjct: 630 ccgggcagcttctccttgatcttttccatgaagcctttcttctc 587
>dbj|AP004858.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1725_H08 Length = 155431 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||||||||||||| | || |||||||||||| Sbjct: 81002 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctc 81045 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttct 320 ||||||||||||||||||||||| ||| ||| |||||||||| Sbjct: 81263 ccgggcagcttctccttgatcttctccttgagccccttcttct 81305 Score = 40.1 bits (20), Expect = 5.7 Identities = 38/44 (86%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||| |||||| |||||||| ||| || ||||||||||| Sbjct: 80828 ccgggcagtttctccatgatcttgcccagtatacccttcttctc 80871
>dbj|AP005055.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0684A08 Length = 137841 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||||||||||||| | || |||||||||||| Sbjct: 35224 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctc 35267 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttct 320 ||||||||||||||||||||||| ||| ||| |||||||||| Sbjct: 35485 ccgggcagcttctccttgatcttctccttgagccccttcttct 35527 Score = 40.1 bits (20), Expect = 5.7 Identities = 38/44 (86%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||| |||||| |||||||| ||| || ||||||||||| Sbjct: 35050 ccgggcagtttctccatgatcttgcccagtatacccttcttctc 35093
>dbj|AK070197.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023042N13, full insert sequence Length = 1292 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||||||||||||| | || |||||||||||| Sbjct: 746 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctc 703 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttct 320 ||||||||||||||||||||||| ||| ||| |||||||||| Sbjct: 485 ccgggcagcttctccttgatcttctccttgagccccttcttct 443 Score = 40.1 bits (20), Expect = 5.7 Identities = 38/44 (86%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||| |||||| |||||||| ||| || ||||||||||| Sbjct: 920 ccgggcagtttctccatgatcttgcccagtatacccttcttctc 877
>dbj|AB011367.1| Oryza sativa mRNA for LIP9, partial cds Length = 680 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||||||||||||| | || |||||||||||| Sbjct: 167 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctc 124 Score = 40.1 bits (20), Expect = 5.7 Identities = 38/44 (86%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||| |||||| |||||||| ||| || ||||||||||| Sbjct: 341 ccgggcagtttctccatgatcttgcccagtatacccttcttctc 298
>dbj|AB049336.1| Nicotiana tabacum NtERD10B mRNA for dehydrin, complete cds Length = 796 Score = 60.0 bits (30), Expect = 6e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||||||| |||||||||||||| ||||||||||| Sbjct: 530 agcttctccttaatcttgtccatgattcccttcttctc 493
>ref|NM_126038.2| Arabidopsis thaliana RAB18 (RESPONSIVE TO ABA 18) AT5G66400 (RAB18) transcript variant AT5G66400.1 mRNA, complete cds Length = 864 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||| ||||| ||||||||||||||||| || |||||||||||| Sbjct: 637 ccgggaagcttttccttgatcttgtccatcatccccttcttctcg 593
>ref|NM_001037085.1| Arabidopsis thaliana RAB18 (RESPONSIVE TO ABA 18) AT5G66400 (RAB18) transcript variant AT5G66400.2 mRNA, complete cds Length = 881 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||| ||||| ||||||||||||||||| || |||||||||||| Sbjct: 634 ccgggaagcttttccttgatcttgtccatcatccccttcttctcg 590
>gb|AC146946.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0037B06 map near 50283S, complete sequence Length = 149398 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||| ||||||||||||||||| ||||| || |||||||||||| Sbjct: 89070 ccggggagcttctccttgatcttctccatcatacccttcttctcg 89026 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 319 ||||| ||||||||||||||||| ||| |||| ||||||||| Sbjct: 88884 ccggggagcttctccttgatcttctccttgattcccttcttc 88843
>gb|L04173.1|ATH18RAB Arabidopsis thaliana glycine rich protein (RAB18) gene, complete cds Length = 1676 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||| ||||| ||||||||||||||||| || |||||||||||| Sbjct: 1387 ccgggaagcttttccttgatcttgtccatcatccccttcttctcg 1343
>gb|AY093779.1| Arabidopsis thaliana AT5g66400/K1F13_5 mRNA, complete cds Length = 798 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||| ||||| ||||||||||||||||| || |||||||||||| Sbjct: 630 ccgggaagcttttccttgatcttgtccatcatccccttcttctcg 586
>gb|AF428458.1|AF428458 Arabidopsis thaliana AT5g66400/K1F13_5 mRNA, complete cds Length = 861 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||| ||||| ||||||||||||||||| || |||||||||||| Sbjct: 637 ccgggaagcttttccttgatcttgtccatcatccccttcttctcg 593
>gb|AY050416.1| Arabidopsis thaliana At1g11360/T23J18_35 mRNA, complete cds Length = 1018 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||| ||||| ||||||||||||||||| || |||||||||||| Sbjct: 229 ccgggaagcttttccttgatcttgtccatcatccccttcttctcg 273
>dbj|AB013389.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K1F13 Length = 83511 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||| ||||| ||||||||||||||||| || |||||||||||| Sbjct: 7440 ccgggaagcttttccttgatcttgtccatcatccccttcttctcg 7484
>emb|X68042.1|ATRAB18A A.thaliana rab18 gene Length = 1528 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||| ||||| ||||||||||||||||| || |||||||||||| Sbjct: 1243 ccgggaagcttttccttgatcttgtccatcatccccttcttctcg 1199
>gb|BT002226.1| Arabidopsis thaliana At5g66400/K1F13_5 mRNA, complete cds Length = 561 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 322 ||||| ||||| ||||||||||||||||| || |||||||||||| Sbjct: 548 ccgggaagcttttccttgatcttgtccatcatccccttcttctcg 504
>gb|AY425975.1| Streptocarpus primulifolius microsatellite B22 sequence Length = 646 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 287 ttctccttgatcttgtccatgatgcccttcttctcg 322 |||||||||||||| ||||| ||||||||||||||| Sbjct: 399 ttctccttgatcttatccatcatgcccttcttctcg 364
>gb|DQ487110.1| Panax ginseng dehydrin 5 (Dhn5) mRNA, complete cds Length = 853 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||||||||||||||||||| ||||| || || |||||||| Sbjct: 536 ccgggcagcttctccttgatcttctccatcattcctttcttctc 493
>gb|AY574032.1| Triticum aestivum dehydrin-like gene, partial sequence Length = 391 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||||||||||||||||||| |||| || ||| |||||||| Sbjct: 242 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 199
>emb|AJ890140.1| Triticum turgidum subsp. durum mRNA for dehydrin (dhn11 gene) Length = 1127 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||||||||||||||||||| |||| || ||| |||||||| Sbjct: 649 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 606
>emb|X84056.1|HVPAF93 H.vulgare paf93 gene Length = 1154 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||||||||||||||||||| |||| || ||| |||||||| Sbjct: 640 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 597 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttct 320 ||||||||||||||||||| ||| ||| ||| |||||||||| Sbjct: 448 ccgggcagcttctccttgagcttctccttgagacccttcttct 406 Score = 40.1 bits (20), Expect = 5.7 Identities = 38/44 (86%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 796 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 753
>emb|X64327.1|LGNPR1 L.gibba gene NPR1 (negatively phytochrome regulated 1) Length = 1573 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 281 ggcagcttctccttgatcttgtccatgatgcccttcttct 320 |||| ||| ||||||||||| ||||||||||||||||||| Sbjct: 1365 ggcatcttatccttgatcttctccatgatgcccttcttct 1326 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 281 ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||| ||||| ||||| || ||||||||||| Sbjct: 1476 ggcagcttctcctttatcttctccattatccccttcttctc 1436
>gb|AF043093.1|AF043093 Hordeum vulgare dehydrin 8 (dhn8) gene, complete cds Length = 2254 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||||||||||||||||||| |||| || ||| |||||||| Sbjct: 1920 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 1877 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttct 320 ||||||||||||||||||| ||| ||| ||| |||||||||| Sbjct: 1728 ccgggcagcttctccttgagcttctccttgagacccttcttct 1686 Score = 40.1 bits (20), Expect = 5.7 Identities = 38/44 (86%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 2076 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 2033
>gb|U73211.1|TAU73211 Triticum aestivum cold acclimation protein WCOR410c (Wcor410c) mRNA, complete cds Length = 1242 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||||||||||||||||||| |||| || ||| |||||||| Sbjct: 652 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 609 Score = 46.1 bits (23), Expect = 0.093 Identities = 38/43 (88%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttct 320 ||||||||||||||||||| ||| ||| ||| |||||||||| Sbjct: 460 ccgggcagcttctccttgagcttctccttgagacccttcttct 418
>gb|U73210.1|TAU73210 Triticum aestivum cold acclimation protein WCOR410b (Wcor410b) mRNA, complete cds Length = 1181 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||||||||||||||||||| |||| || ||| |||||||| Sbjct: 637 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 594
>gb|L29152.1|WHTWCOR Triticum aestivum cold acclimation protein (WCOR410) mRNA, complete cds Length = 1136 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||||||||||||||||||| |||| || ||| |||||||| Sbjct: 652 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 609
>dbj|AB010898.1| Daucus carota mRNA for ecpp44, complete cds Length = 925 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 281 ggcagcttctccttgatcttgtccatgatgcccttcttct 320 |||||||||||||||||||| ||||| | ||||||||||| Sbjct: 538 ggcagcttctccttgatcttctccataaagcccttcttct 499
>gb|M62987.1|CRTDESRSA Craterostigma plantagineum dessication-related protein mRNA, complete cds Length = 634 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 268 tcagtgctgtccgggcagcttctccttgatcttgtccat 306 ||||||||| ||||| ||||||||||||||||| ||||| Sbjct: 415 tcagtgctggccggggagcttctccttgatcttctccat 377
>emb|AJ606474.1| Fagus sylvatica mRNA for dehydrin/response ABA (rab1 gene) Length = 952 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 275 tgtccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||| || ||||||||||| ||||| |||||||| ||||||||||| Sbjct: 764 tgtccaggaagcttctcctttatcttttccatgatccccttcttctc 718
>gb|AF345988.1| Cornus sericea 60 kDa dehydrin-like protein (Rod60) mRNA, complete cds Length = 1921 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 272 tgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||| || ||||||||||||||||| ||||||| || |||||||| Sbjct: 1751 tgctgtccaggaagcttctccttgatcttctccatgactcctttcttctc 1702
>gb|AF236067.1|AF236067 Elaeis guineensis clone pKT5 dehydrin-like protein mRNA, complete cds Length = 775 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||||||||||||| ||||| || ||||||||||| Sbjct: 462 agcttctccttgatcttttccatcatccccttcttctc 425
>dbj|AB049335.1| Nicotiana tabacum NtERD10A mRNA for dehydrin, partial cds Length = 342 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||||||| ||||||||||| || ||||||||||| Sbjct: 65 agcttctccttaatcttgtccataattcccttcttctc 28
>gb|AF044584.1|AF044584 Lavatera thuringiaca cold regulated LTCOR18 (LtCor18) mRNA, complete cds Length = 759 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 284 agcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||||||||||||| ||||| || ||||||||||| Sbjct: 502 agcttctccttgatcttctccataatacccttcttctc 465
>gb|AY243045.1| Boea crassifolia dehydrin-like protein Dh2 mRNA, complete cds Length = 697 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 281 ggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||| ||||||||||| |||||||| || ||||||||||| Sbjct: 464 ggcagtttctccttgattttgtccatcatccccttcttctc 424 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttctt 318 ||||| ||||||||||||| ||||||| |||| |||||||| Sbjct: 353 ccgggtagcttctccttgaccttgtccttgatccccttctt 313
>gb|AY607706.1| Quercus robur dehydrin 2 (Dhn2) mRNA, partial cds Length = 860 Score = 48.1 bits (24), Expect = 0.024 Identities = 45/52 (86%) Strand = Plus / Minus Query: 270 agtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||| ||||| || ||||||||||||||||| ||||| | ||||||||||| Sbjct: 632 agtgttgtccaggaagcttctccttgatcttctccatcactcccttcttctc 581
>gb|BT019045.1| Zea mays clone Contig566.F mRNA sequence Length = 722 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtcca 305 ||||| |||||||||||||||||||||| Sbjct: 192 ccgggtagcttctccttgatcttgtcca 165
>gb|DQ487112.1| Panax ginseng dehydrin 7 (Dhn7) mRNA, complete cds Length = 1057 Score = 48.1 bits (24), Expect = 0.024 Identities = 39/44 (88%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||||||||||||| ||||| ||||| || || |||||||| Sbjct: 677 ccgggcagcttctccttaatcttttccatcattcctttcttctc 634
>gb|DQ487106.1| Panax ginseng dehydrin 1 (Dhn1) mRNA, complete cds Length = 1028 Score = 48.1 bits (24), Expect = 0.024 Identities = 39/44 (88%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||||||||||||| ||||| ||||| || || |||||||| Sbjct: 690 ccgggcagcttctccttaatcttttccatcattcctttcttctc 647
>emb|AJ704825.1| Glycine max partial lea8 gene for putative dehydrin Length = 591 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 287 ttctccttgatcttgtccatgatgcccttcttctcg 322 |||||||||||||||||||| || || ||||||||| Sbjct: 581 ttctccttgatcttgtccataatccctttcttctcg 546
>emb|AJ844016.1| Plantago major partial mRNA for hypothetical protein Length = 566 Score = 48.1 bits (24), Expect = 0.024 Identities = 30/32 (93%) Strand = Plus / Minus Query: 290 tccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||| |||||||||||||| Sbjct: 244 tccttgatcttgtccaccatgcccttcttctc 213
>gb|L35913.1|MZELIPASE Zea mays dehydrin (dhn-2) mRNA, complete cds Length = 1277 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtcca 305 ||||| |||||||||||||||||||||| Sbjct: 703 ccgggtagcttctccttgatcttgtcca 676
>dbj|AB105039.1| Daucus carota CAISE1 mRNA for dehydrin protein, complete cds Length = 771 Score = 48.1 bits (24), Expect = 0.024 Identities = 39/44 (88%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||||||| ||||||||||| ||||| || || |||||||| Sbjct: 505 ccgggcagcttgtccttgatcttatccataattcctttcttctc 462
>gb|AF181458.1|AF181458 Hordeum vulgare dehydrin (Dhn8) mRNA, complete cds Length = 808 Score = 48.1 bits (24), Expect = 0.024 Identities = 39/44 (88%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 |||||||||||||||||||| || |||| || ||| |||||||| Sbjct: 547 ccgggcagcttctccttgattttttccaagaagcctttcttctc 504 Score = 40.1 bits (20), Expect = 5.7 Identities = 38/44 (86%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 321 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 703 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 660
>gb|AY111114.1| Zea mays CL2452_1 mRNA sequence Length = 1256 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Minus Query: 278 ccgggcagcttctccttgatcttgtcca 305 ||||| |||||||||||||||||||||| Sbjct: 682 ccgggtagcttctccttgatcttgtcca 655 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,400,334 Number of Sequences: 3902068 Number of extensions: 3400334 Number of successful extensions: 78915 Number of sequences better than 10.0: 397 Number of HSP's better than 10.0 without gapping: 397 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 77283 Number of HSP's gapped (non-prelim): 1529 length of query: 428 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 406 effective length of database: 17,147,199,772 effective search space: 6961763107432 effective search space used: 6961763107432 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
