ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast61b10
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AF542967.1| Triticum aestivum annexin P35-like mRNA, partial ... 242 8e-61
2ref|XM_467846.1| Oryza sativa (japonica cultivar-group), mRNA 141 2e-30
3dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 141 2e-30
4dbj|AP005012.3| Oryza sativa (japonica cultivar-group) genomic D... 141 2e-30
5dbj|AP004119.3| Oryza sativa (japonica cultivar-group) genomic D... 141 2e-30
6dbj|AK101787.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 2e-30
7dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 107 3e-20
8dbj|AP004727.2| Oryza sativa (japonica cultivar-group) genomic D... 107 3e-20
9dbj|AK072559.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 3e-20
10emb|X98245.1|ZMANNP35 Z.mays mRNA for annexin p35 82 2e-12
11gb|AY105105.1| Zea mays PCO122403 mRNA sequence 82 2e-12
12emb|X98244.2|ZMANNP33 Z.mays mRNA for annexin p33 76 1e-10
13gb|AY105151.1| Zea mays PCO072293 mRNA sequence 76 1e-10
14gb|AF373160.1| Rana macrocnemis macrocnemis haplotype M5 cytochr... 46 0.10
15gb|AF373159.1| Rana macrocnemis camerani haplotype M4 cytochrome... 46 0.10
16gb|AF373158.1| Rana macrocnemis macrocnemis haplotype M3 cytochr... 46 0.10
17gb|AF373157.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 46 0.10
18gb|AF373156.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 46 0.10
19gb|AF373155.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 46 0.10
20gb|AF373154.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 46 0.10
21gb|AF373153.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 46 0.10
22gb|AF373152.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.10
23gb|AF373151.1| Rana macrocnemis camerani haplotype M1 cytochrome... 46 0.10
24gb|AF373150.1| Rana macrocnemis camerani haplotype M1 cytochrome... 46 0.10
25gb|AF373149.1| Rana macrocnemis camerani haplotype M1 cytochrome... 46 0.10
26gb|AF373148.1| Rana macrocnemis camerani haplotype M1 cytochrome... 46 0.10
27gb|AF373147.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.10
28gb|AF373146.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.10
29gb|AF373145.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.10
30gb|AF373144.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.10
31gb|AF373143.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.10
32gb|AF373142.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.10
33gb|AF373141.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.10
34gb|AF373140.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.10
35gb|AF373139.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.10
36gb|AF373138.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.10
37gb|AF373137.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.10
38gb|AF373136.1| Rana macrocnemis camerani haplotype C6 cytochrome... 46 0.10
39gb|AF373135.1| Rana macrocnemis camerani haplotype C5 cytochrome... 46 0.10
40gb|AF373134.1| Rana macrocnemis camerani haplotype C5 cytochrome... 46 0.10
41gb|AF373133.1| Rana macrocnemis camerani haplotype C5 cytochrome... 46 0.10
42gb|AF373132.1| Rana macrocnemis camerani haplotype C4 cytochrome... 46 0.10
43gb|AF373131.1| Rana macrocnemis camerani haplotype C4 cytochrome... 46 0.10
44gb|AF373130.1| Rana macrocnemis camerani haplotype C4 cytochrome... 46 0.10
45gb|AF373129.1| Rana macrocnemis camerani haplotype C4 cytochrome... 46 0.10
46gb|AF373128.1| Rana macrocnemis camerani haplotype C4 cytochrome... 46 0.10
47gb|AF373127.1| Rana macrocnemis macrocnemis haplotype C4 cytochr... 46 0.10
48gb|AF373126.1| Rana macrocnemis macrocnemis haplotype C3 cytochr... 46 0.10
49gb|AF373125.1| Rana macrocnemis macrocnemis haplotype C2 cytochr... 46 0.10
50gb|AF373124.1| Rana macrocnemis macrocnemis haplotype C2 cytochr... 46 0.10
51gb|AF373123.1| Rana macrocnemis macrocnemis haplotype C2 cytochr... 46 0.10
52gb|AF373122.1| Rana macrocnemis camerani haplotype C1 cytochrome... 46 0.10
53gb|AF373121.1| Rana macrocnemis camerani haplotype C1 cytochrome... 46 0.10
54gb|AF373120.1| Rana macrocnemis camerani haplotype C1 cytochrome... 46 0.10
55gb|AF373119.1| Rana macrocnemis camerani haplotype C1 cytochrome... 46 0.10
56gb|AF373118.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 46 0.10
57gb|AF373117.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 46 0.10
58gb|AF373116.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 46 0.10
59gb|AF373115.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 46 0.10
60gb|AF373114.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 46 0.10
61gb|AY147969.1| Rana macrocnemis pseudodalmatina cytochrome b (cy... 46 0.10
62gb|AY147968.1| Rana macrocnemis macrocnemis cytochrome b (cytb) ... 46 0.10
63gb|AY147964.1| Rana holtzi cytochrome b (cytb) gene, partial cds... 46 0.10
64gb|AY147960.1| Rana macrocnemis cytochrome b (cytb) gene, partia... 46 0.10
65gb|AF021076.1| Megarthrus americanus cytochrome b (cytb) gene, m... 44 0.40
66gb|AC113587.16| Mus musculus chromosome 15, clone RP24-424I13, c... 42 1.6
67gb|DQ106808.1| Ephippiger provincialis clone Eprov7 cytochrome b... 42 1.6
68gb|AC104833.6| Mus Musculus Strain C57BL6/J Chromosome 15 BAC, R... 42 1.6
69dbj|AK082224.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 42 1.6
70dbj|AB201221.1| Microhyla ornata mitochondrial cytb gene for cyt... 42 1.6
71dbj|AB201218.1| Microhyla ornata mitochondrial cytb gene for cyt... 42 1.6
72dbj|AB201216.1| Microhyla ornata mitochondrial cytb gene for cyt... 42 1.6
73emb|AL136039.4|CNS01DVU Human chromosome 14 DNA sequence BAC R-7... 42 1.6
74gb|AC134914.5| Mus musculus BAC clone RP23-227C5 from 9, complet... 42 1.6
75ref|XM_775596.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 6.2
76emb|AJ298865.1|XLA298865 Xenopus laevis mRNA for winged helix tr... 40 6.2
77gb|AC011415.3| Homo sapiens chromosome 5 clone CTB-87P21, comple... 40 6.2
78gb|AC102738.9| Mus musculus chromosome 3, clone RP24-303G10, com... 40 6.2
79gb|AC004823.1|AC004823 Homo sapiens PAC clone RP1-172A13 from Xq... 40 6.2
80gb|AC151976.3| Mus musculus BAC clone RP24-446O20 from 10, compl... 40 6.2
81gb|AC133943.3| Mus musculus BAC clone RP24-104D12 from 3, comple... 40 6.2
82gb|AC149341.2| Phakopsora pachyrhizi clone JGIAFNA-25D19, comple... 40 6.2 
>gb|AF542967.1| Triticum aestivum annexin P35-like mRNA, partial sequence
          Length = 766

 Score =  242 bits (122), Expect = 8e-61
 Identities = 172/186 (92%), Gaps = 2/186 (1%)
 Strand = Plus / Minus

                                                                       
Query: 276 tccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcg 335
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 642 tccagcgggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcg 583

                                                                       
Query: 336 gcacgagtggttatcaccctagt-aagggtgtgctcgtctgtaccgacaccaccaagagc 394
           || ||||||||||| ||||| || |||||||| ||||||||| ||||| || ||||| ||
Sbjct: 582 gcgcgagtggttatgaccctcgtaaagggtgttctcgtctgtgccgacgcctccaagggc 523

                                                                       
Query: 395 catccggatgaccttctc-aagtatctgtcggggcaagtgaaacaccttatgatcgccct 453
           || |||||||| |||||| ||||||||||| |||||||||||||||||||||||||||||
Sbjct: 522 caaccggatgatcttctcaaagtatctgtcagggcaagtgaaacaccttatgatcgccct 463

                 
Query: 454 cagggt 459
           ||||||
Sbjct: 462 cagggt 457
to top
>ref|XM_467846.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1223

 Score =  141 bits (71), Expect = 2e-30
 Identities = 204/247 (82%), Gaps = 1/247 (0%)
 Strand = Plus / Minus

                                                                        
Query: 208  actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 267
            |||||||||| || || ||||| |  ||||| || |||||||||||||| || || | ||
Sbjct: 1058 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 999

                                                                        
Query: 268  cagccttctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 327
            ||||   |||||  ||||| ||||| ||||||||||| ||||||||||||| ||||||||
Sbjct: 998  cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 939

                                                                        
Query: 328  ccacctcggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccac 387
            | |||||||||||||| ||||| | ||| ||||| | || ||||||||| || |  || |
Sbjct: 938  ctacctcggcacgagttgttatgatccttgtaagagagttctcgtctgtgcccattcctc 879

                                                                        
Query: 388  caagagccatccggatgaccttctc-aagtatctgtcggggcaagtgaaacaccttatga 446
            | |||||||  || ||||| ||||| ||||||||||| ||||||||||| || |||||||
Sbjct: 878  ctagagccaatcgaatgactttctcaaagtatctgtcagggcaagtgaagcatcttatga 819

                   
Query: 447  tcgccct 453
            |||||||
Sbjct: 818  tcgccct 812
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  141 bits (71), Expect = 2e-30
 Identities = 204/247 (82%), Gaps = 1/247 (0%)
 Strand = Plus / Plus

                                                                            
Query: 208      actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 267
                |||||||||| || || ||||| |  ||||| || |||||||||||||| || || | ||
Sbjct: 31716862 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 31716921

                                                                            
Query: 268      cagccttctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 327
                ||||   |||||  ||||| ||||| ||||||||||| ||||||||||||| ||||||||
Sbjct: 31716922 cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 31716981

                                                                            
Query: 328      ccacctcggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccac 387
                | |||||||||||||| ||||| | ||| ||||| | || ||||||||| || |  || |
Sbjct: 31716982 ctacctcggcacgagttgttatgatccttgtaagagagttctcgtctgtgcccattcctc 31717041

                                                                            
Query: 388      caagagccatccggatgaccttctc-aagtatctgtcggggcaagtgaaacaccttatga 446
                | |||||||  || ||||| ||||| ||||||||||| ||||||||||| || |||||||
Sbjct: 31717042 ctagagccaatcgaatgactttctcaaagtatctgtcagggcaagtgaagcatcttatga 31717101

                       
Query: 447      tcgccct 453
                |||||||
Sbjct: 31717102 tcgccct 31717108
to top
>dbj|AP005012.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0627E03
          Length = 159861

 Score =  141 bits (71), Expect = 2e-30
 Identities = 204/247 (82%), Gaps = 1/247 (0%)
 Strand = Plus / Plus

                                                                         
Query: 208   actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 267
             |||||||||| || || ||||| |  ||||| || |||||||||||||| || || | ||
Sbjct: 12660 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 12719

                                                                         
Query: 268   cagccttctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 327
             ||||   |||||  ||||| ||||| ||||||||||| ||||||||||||| ||||||||
Sbjct: 12720 cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 12779

                                                                         
Query: 328   ccacctcggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccac 387
             | |||||||||||||| ||||| | ||| ||||| | || ||||||||| || |  || |
Sbjct: 12780 ctacctcggcacgagttgttatgatccttgtaagagagttctcgtctgtgcccattcctc 12839

                                                                         
Query: 388   caagagccatccggatgaccttctc-aagtatctgtcggggcaagtgaaacaccttatga 446
             | |||||||  || ||||| ||||| ||||||||||| ||||||||||| || |||||||
Sbjct: 12840 ctagagccaatcgaatgactttctcaaagtatctgtcagggcaagtgaagcatcttatga 12899

                    
Query: 447   tcgccct 453
             |||||||
Sbjct: 12900 tcgccct 12906
to top
>dbj|AP004119.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1288_G09
          Length = 109672

 Score =  141 bits (71), Expect = 2e-30
 Identities = 204/247 (82%), Gaps = 1/247 (0%)
 Strand = Plus / Plus

                                                                         
Query: 208   actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 267
             |||||||||| || || ||||| |  ||||| || |||||||||||||| || || | ||
Sbjct: 96649 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 96708

                                                                         
Query: 268   cagccttctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 327
             ||||   |||||  ||||| ||||| ||||||||||| ||||||||||||| ||||||||
Sbjct: 96709 cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 96768

                                                                         
Query: 328   ccacctcggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccac 387
             | |||||||||||||| ||||| | ||| ||||| | || ||||||||| || |  || |
Sbjct: 96769 ctacctcggcacgagttgttatgatccttgtaagagagttctcgtctgtgcccattcctc 96828

                                                                         
Query: 388   caagagccatccggatgaccttctc-aagtatctgtcggggcaagtgaaacaccttatga 446
             | |||||||  || ||||| ||||| ||||||||||| ||||||||||| || |||||||
Sbjct: 96829 ctagagccaatcgaatgactttctcaaagtatctgtcagggcaagtgaagcatcttatga 96888

                    
Query: 447   tcgccct 453
             |||||||
Sbjct: 96889 tcgccct 96895
to top
>dbj|AK101787.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033065F07, full
            insert sequence
          Length = 1223

 Score =  141 bits (71), Expect = 2e-30
 Identities = 204/247 (82%), Gaps = 1/247 (0%)
 Strand = Plus / Minus

                                                                        
Query: 208  actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 267
            |||||||||| || || ||||| |  ||||| || |||||||||||||| || || | ||
Sbjct: 1058 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 999

                                                                        
Query: 268  cagccttctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 327
            ||||   |||||  ||||| ||||| ||||||||||| ||||||||||||| ||||||||
Sbjct: 998  cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 939

                                                                        
Query: 328  ccacctcggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccac 387
            | |||||||||||||| ||||| | ||| ||||| | || ||||||||| || |  || |
Sbjct: 938  ctacctcggcacgagttgttatgatccttgtaagagagttctcgtctgtgcccattcctc 879

                                                                        
Query: 388  caagagccatccggatgaccttctc-aagtatctgtcggggcaagtgaaacaccttatga 446
            | |||||||  || ||||| ||||| ||||||||||| ||||||||||| || |||||||
Sbjct: 878  ctagagccaatcgaatgactttctcaaagtatctgtcagggcaagtgaagcatcttatga 819

                   
Query: 447  tcgccct 453
            |||||||
Sbjct: 818  tcgccct 812
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  107 bits (54), Expect = 3e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                           
Query: 275     ctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctc 334
               |||||| ||||| |||||||||||||||||||||||| | |||| |||||| ||||||||
Sbjct: 6264228 ctccagcgggacactgttcctcttctggtacgcctccgtgatcagcttcagatccacctc 6264169

                                                         
Query: 335     ggcacgagtggttatcaccctagtaagggtgtgctcgtctgt 376
               |||||||||||| || | |||||| |||| || |||||||||
Sbjct: 6264168 ggcacgagtggtaatgatcctagtgagggagttctcgtctgt 6264127
to top
>dbj|AP004727.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0516A04
          Length = 145107

 Score =  107 bits (54), Expect = 3e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                         
Query: 275   ctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctc 334
             |||||| ||||| |||||||||||||||||||||||| | |||| |||||| ||||||||
Sbjct: 58304 ctccagcgggacactgttcctcttctggtacgcctccgtgatcagcttcagatccacctc 58245

                                                       
Query: 335   ggcacgagtggttatcaccctagtaagggtgtgctcgtctgt 376
             |||||||||||| || | |||||| |||| || |||||||||
Sbjct: 58244 ggcacgagtggtaatgatcctagtgagggagttctcgtctgt 58203
to top
>dbj|AK072559.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132A10, full
           insert sequence
          Length = 1274

 Score =  107 bits (54), Expect = 3e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 275 ctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctc 334
           |||||| ||||| |||||||||||||||||||||||| | |||| |||||| ||||||||
Sbjct: 977 ctccagcgggacactgttcctcttctggtacgcctccgtgatcagcttcagatccacctc 918

                                                     
Query: 335 ggcacgagtggttatcaccctagtaagggtgtgctcgtctgt 376
           |||||||||||| || | |||||| |||| || |||||||||
Sbjct: 917 ggcacgagtggtaatgatcctagtgagggagttctcgtctgt 876
to top
>emb|X98245.1|ZMANNP35 Z.mays mRNA for annexin p35
          Length = 1257

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 183/229 (79%), Gaps = 1/229 (0%)
 Strand = Plus / Minus

                                                                        
Query: 225  gcaagcatcatatcttcatagtctctggttgtgtccttggaaacagccttctccaggggg 284
            |||||||| ||||| ||||| ||||| ||||| || ||||  |||||   |||||| || 
Sbjct: 1057 gcaagcataatatcctcataatctctagttgtatctttggccacagcacgctccagcggc 998

                                                                        
Query: 285  acgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcggcacgagtg 344
            || ||||| |||||||| || ||||||||||||| ||||||||| |||||||| ||||| 
Sbjct: 997  acactgtttctcttctgataagcctcctttatcagcttcaggtcgacctcggcgcgagta 938

                                                                        
Query: 345  gttatcaccctagtaagggtgtgctcgtctgtaccgacaccaccaagagccatccggatg 404
            ||||  ||||| || |||   | ||| || || || |  || ||||||||||  || |||
Sbjct: 937  gttacgaccctggtgaggtcatcctcatcagtgcccatgcctccaagagccagtcgaatg 878

                                                             
Query: 405  accttctc-aagtatctgtcggggcaagtgaaacaccttatgatcgccc 452
            || ||||| ||||||||||| ||||| ||||| ||||  ||||||||||
Sbjct: 877  actttctcgaagtatctgtcagggcaggtgaagcaccggatgatcgccc 829
to top
>gb|AY105105.1| Zea mays PCO122403 mRNA sequence
          Length = 1401

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 183/229 (79%), Gaps = 1/229 (0%)
 Strand = Plus / Minus

                                                                        
Query: 225  gcaagcatcatatcttcatagtctctggttgtgtccttggaaacagccttctccaggggg 284
            |||||||| ||||| ||||| ||||| ||||| || ||||  |||||   |||||| || 
Sbjct: 1151 gcaagcataatatcctcataatctctagttgtatctttggccacagcacgctccagcggc 1092

                                                                        
Query: 285  acgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcggcacgagtg 344
            || ||||| |||||||| || ||||||||||||| ||||||||| |||||||| ||||| 
Sbjct: 1091 acactgtttctcttctgataagcctcctttatcagcttcaggtcgacctcggcgcgagta 1032

                                                                        
Query: 345  gttatcaccctagtaagggtgtgctcgtctgtaccgacaccaccaagagccatccggatg 404
            ||||  ||||| || |||   | ||| || || || |  || ||||||||||  || |||
Sbjct: 1031 gttacgaccctggtgaggtcatcctcatcagtgcccatgcctccaagagccagtcgaatg 972

                                                             
Query: 405  accttctc-aagtatctgtcggggcaagtgaaacaccttatgatcgccc 452
            || ||||| ||||||||||| ||||| ||||| ||||  ||||||||||
Sbjct: 971  actttctcgaagtatctgtcagggcaggtgaagcaccggatgatcgccc 923
to top
>emb|X98244.2|ZMANNP33 Z.mays mRNA for annexin p33
          Length = 1277

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 86/102 (84%)
 Strand = Plus / Minus

                                                                       
Query: 275 ctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctc 334
           |||||| || ||||||||||||||||||||||||||||| ||||  || |||||||||||
Sbjct: 960 ctccagcggcacgctgttcctcttctggtacgcctccttaatcagtttgaggtccacctc 901

                                                     
Query: 335 ggcacgagtggttatcaccctagtaagggtgtgctcgtctgt 376
            || || ||||| || ||||| || |||| || ||| |||||
Sbjct: 900 agcgcgggtggtgatgaccctggtcagggagttctcatctgt 859
to top
>gb|AY105151.1| Zea mays PCO072293 mRNA sequence
          Length = 1369

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 86/102 (84%)
 Strand = Plus / Minus

                                                                       
Query: 275 ctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctc 334
           |||||| || ||||||||||||||||||||||||||||| ||||  || |||||||||||
Sbjct: 977 ctccagcggcacgctgttcctcttctggtacgcctccttaatcagtttgaggtccacctc 918

                                                     
Query: 335 ggcacgagtggttatcaccctagtaagggtgtgctcgtctgt 376
            || || ||||| || ||||| || |||| || ||| |||||
Sbjct: 917 agcgcgggtggtgatgaccctggtcagggagttctcatctgt 876
to top
>gb|AF373160.1| Rana macrocnemis macrocnemis haplotype M5 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373159.1| Rana macrocnemis camerani haplotype M4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373158.1| Rana macrocnemis macrocnemis haplotype M3 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373157.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373156.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373155.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373154.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373153.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373152.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373151.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373150.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373149.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373148.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373147.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373146.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373145.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373144.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373143.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373142.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373141.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373140.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373139.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373138.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373137.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373136.1| Rana macrocnemis camerani haplotype C6 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373135.1| Rana macrocnemis camerani haplotype C5 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373134.1| Rana macrocnemis camerani haplotype C5 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373133.1| Rana macrocnemis camerani haplotype C5 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373132.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373131.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373130.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373129.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373128.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373127.1| Rana macrocnemis macrocnemis haplotype C4 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373126.1| Rana macrocnemis macrocnemis haplotype C3 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373125.1| Rana macrocnemis macrocnemis haplotype C2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373124.1| Rana macrocnemis macrocnemis haplotype C2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373123.1| Rana macrocnemis macrocnemis haplotype C2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373122.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373121.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373120.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373119.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373118.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373117.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373116.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373115.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373114.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AY147969.1| Rana macrocnemis pseudodalmatina cytochrome b (cytb) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 378 atctcttattcctccatcaaaca 400
to top
>gb|AY147968.1| Rana macrocnemis macrocnemis cytochrome b (cytb) gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 378 atctcttattcctccatcaaaca 400
to top
>gb|AY147964.1| Rana holtzi cytochrome b (cytb) gene, partial cds; mitochondrial
           gene for mitochondrial product
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 378 atctcttattcctccatcaaaca 400
to top
>gb|AY147960.1| Rana macrocnemis cytochrome b (cytb) gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 157 atctcttattcctccatcaaaca 179
           |||||||||||||||||||||||
Sbjct: 378 atctcttattcctccatcaaaca 400
to top
>gb|AF021076.1| Megarthrus americanus cytochrome b (cytb) gene, mitochondrial gene
           encoding mitochondrial protein, partial cds
          Length = 465

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 157 atctcttattcctccatcaaac 178
           ||||||||||||||||||||||
Sbjct: 185 atctcttattcctccatcaaac 206
to top
>gb|AC113587.16| Mus musculus chromosome 15, clone RP24-424I13, complete sequence
          Length = 191054

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 280    gggggacgctgttcctcttct 300
              |||||||||||||||||||||
Sbjct: 157842 gggggacgctgttcctcttct 157822
to top
>gb|DQ106808.1| Ephippiger provincialis clone Eprov7 cytochrome b (Cytb) gene,
           partial cds; mitochondrial
          Length = 427

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 159 ctcttattcctccatcaaaca 179
           |||||||||||||||||||||
Sbjct: 144 ctcttattcctccatcaaaca 164
to top
>gb|AC104833.6| Mus Musculus Strain C57BL6/J Chromosome 15 BAC, RP23-319B16, Complete
             Sequence, complete sequence
          Length = 171061

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 280   gggggacgctgttcctcttct 300
             |||||||||||||||||||||
Sbjct: 36422 gggggacgctgttcctcttct 36402
to top
>dbj|AK082224.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:C230026C11 product:hypothetical
            Beta tubulin containing protein, full insert sequence
          Length = 1819

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 280  gggggacgctgttcctcttct 300
            |||||||||||||||||||||
Sbjct: 1159 gggggacgctgttcctcttct 1139
to top
>dbj|AB201221.1| Microhyla ornata mitochondrial cytb gene for cytochrome b, partial
           cds, specimen_voucher:KUHE34324
          Length = 629

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 159 ctcttattcctccatcaaaca 179
           |||||||||||||||||||||
Sbjct: 456 ctcttattcctccatcaaaca 476
to top
>dbj|AB201218.1| Microhyla ornata mitochondrial cytb gene for cytochrome b, partial
           cds, specimen_voucher:KUHE34130
          Length = 625

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 159 ctcttattcctccatcaaaca 179
           |||||||||||||||||||||
Sbjct: 452 ctcttattcctccatcaaaca 472
to top
>dbj|AB201216.1| Microhyla ornata mitochondrial cytb gene for cytochrome b, partial
           cds, specimen_voucher:KUHE21982
          Length = 629

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 159 ctcttattcctccatcaaaca 179
           |||||||||||||||||||||
Sbjct: 456 ctcttattcctccatcaaaca 476
to top
>emb|AL136039.4|CNS01DVU Human chromosome 14 DNA sequence BAC R-799P8 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 174788

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 173   tcaaacataaggtagatcaaacata 197
             |||||||| ||||||||||||||||
Sbjct: 56048 tcaaacattaggtagatcaaacata 56024
to top
>gb|AC134914.5| Mus musculus BAC clone RP23-227C5 from 9, complete sequence
          Length = 206831

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 42     tatttctgcagcttaaatgacgaaa 66
              ||||| |||||||||||||||||||
Sbjct: 165234 tatttatgcagcttaaatgacgaaa 165210
to top
>ref|XM_775596.1| PREDICTED: Strongylocentrotus purpuratus similar to tudor domain
            containing 1 (LOC575181), mRNA
          Length = 7881

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 313  ttatcaccttcaggtccacc 332
            ||||||||||||||||||||
Sbjct: 5800 ttatcaccttcaggtccacc 5781
to top
>emb|AJ298865.1|XLA298865 Xenopus laevis mRNA for winged helix transcription factor (foxd3a
           gene)
          Length = 3240

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 124 aaacaacacactcgccagttttat 147
           |||||||||||||||| |||||||
Sbjct: 478 aaacaacacactcgcctgttttat 455
to top
>gb|AC011415.3| Homo sapiens chromosome 5 clone CTB-87P21, complete sequence
          Length = 116976

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 210   tctgctcccagaagtgcaag 229
             ||||||||||||||||||||
Sbjct: 94606 tctgctcccagaagtgcaag 94587
to top
>gb|AC102738.9| Mus musculus chromosome 3, clone RP24-303G10, complete sequence
          Length = 166697

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 12     atccggagaaaactttcaaaacaccaat 39
              |||| |||||| ||||||||||||||||
Sbjct: 130653 atccagagaaacctttcaaaacaccaat 130680
to top
>gb|AC004823.1|AC004823 Homo sapiens PAC clone RP1-172A13 from Xq23, complete sequence
          Length = 115973

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 27    tcaaaacaccaatgatattt 46
             ||||||||||||||||||||
Sbjct: 17082 tcaaaacaccaatgatattt 17101
to top
>gb|AC151976.3| Mus musculus BAC clone RP24-446O20 from 10, complete sequence
          Length = 174449

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 17    gagaaaactttcaaaacacc 36
             ||||||||||||||||||||
Sbjct: 52049 gagaaaactttcaaaacacc 52068
to top
>gb|AC133943.3| Mus musculus BAC clone RP24-104D12 from 3, complete sequence
          Length = 218218

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 12     atccggagaaaactttcaaaacaccaat 39
              |||| |||||| ||||||||||||||||
Sbjct: 198027 atccagagaaacctttcaaaacaccaat 198000
to top
>gb|AC149341.2| Phakopsora pachyrhizi clone JGIAFNA-25D19, complete sequence
          Length = 38997

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 158   tctcttattcctccatcaaa 177
             ||||||||||||||||||||
Sbjct: 21072 tctcttattcctccatcaaa 21091


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,093,570
Number of Sequences: 3902068
Number of extensions: 4093570
Number of successful extensions: 100833
Number of sequences better than 10.0: 82
Number of HSP's better than 10.0 without gapping: 82
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 100699
Number of HSP's gapped (non-prelim): 128
length of query: 463
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 441
effective length of database: 17,147,199,772
effective search space: 7561915099452
effective search space used: 7561915099452
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top