ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast61b01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|BX649397.8| Zebrafish DNA sequence from clone CH211-14J20 in... 42 0.68
2gb|CP000025.1| Campylobacter jejuni RM1221, complete genome 40 2.7
3gb|AC004006.1| Homo sapiens PAC clone RP4-740B21 from 7, complet... 40 2.7
4gb|AF078886.1| Greniera fabri dopa decarboxylase (DDC) gene, par... 40 2.7
5emb|AL135780.11| Human DNA sequence from clone RP3-375M21 on chr... 40 2.7
6emb|CR387929.4| Zebrafish DNA sequence from clone DKEY-172H18 in... 40 2.7
7gb|AC022254.11| Homo sapiens chromosome 15, clone RP11-282M16, c... 40 2.7
8gb|AC009292.11| Homo sapiens chromosome 15, clone RP11-34F13, co... 40 2.7
9gb|AF322113.2| Campylobacter jejuni subsp. jejuni 81-176 putativ... 40 2.7
10emb|BX511101.3| Zebrafish DNA sequence from clone DKEYP-92F1 in ... 40 2.7
11gb|AC007546.6| Homo sapiens 12 BAC RP11-946P6 (Roswell Park Canc... 40 2.7
12emb|AJ340010.1|HSA340010 Homo sapiens genomic sequence surroundi... 40 2.7

>emb|BX649397.8| Zebrafish DNA sequence from clone CH211-14J20 in linkage group 3,
             complete sequence
          Length = 171286

 Score = 42.1 bits (21), Expect = 0.68
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 117   gttttacatagggaaaatatgctttgatt 145
             |||||| || |||||||||||||||||||
Sbjct: 72845 gttttaaattgggaaaatatgctttgatt 72817



to top

>gb|CP000025.1| Campylobacter jejuni RM1221, complete genome
          Length = 1777831

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 134     tatgctttgattgtcataca 153
               ||||||||||||||||||||
Sbjct: 1526929 tatgctttgattgtcataca 1526910



to top

>gb|AC004006.1| Homo sapiens PAC clone RP4-740B21 from 7, complete sequence
          Length = 119453

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 37    aacaaaagacaaggatacaa 56
             ||||||||||||||||||||
Sbjct: 35729 aacaaaagacaaggatacaa 35748



to top

>gb|AF078886.1| Greniera fabri dopa decarboxylase (DDC) gene, partial cds
          Length = 836

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 147 tcatacaaaaacgcaaaatt 166
           ||||||||||||||||||||
Sbjct: 416 tcatacaaaaacgcaaaatt 397



to top

>emb|AL135780.11| Human DNA sequence from clone RP3-375M21 on chromosome 6q14.1-15,
             complete sequence
          Length = 116878

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 39    caaaagacaaggatacaata 58
             ||||||||||||||||||||
Sbjct: 26967 caaaagacaaggatacaata 26986



to top

>emb|CR387929.4| Zebrafish DNA sequence from clone DKEY-172H18 in linkage group 5,
              complete sequence
          Length = 245364

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 126    agggaaaatatgctttgatt 145
              ||||||||||||||||||||
Sbjct: 209547 agggaaaatatgctttgatt 209566



to top

>gb|AC022254.11| Homo sapiens chromosome 15, clone RP11-282M16, complete sequence
          Length = 188601

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 124    atagggaaaatatgctttga 143
              ||||||||||||||||||||
Sbjct: 144951 atagggaaaatatgctttga 144932



to top

>gb|AC009292.11| Homo sapiens chromosome 15, clone RP11-34F13, complete sequence
          Length = 182855

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 124    atagggaaaatatgctttga 143
              ||||||||||||||||||||
Sbjct: 152170 atagggaaaatatgctttga 152189



to top

>gb|AF322113.2| Campylobacter jejuni subsp. jejuni 81-176 putative dUTPase (Cj1451),
            putative ATP/GTP binding protein (Cj1450), hypothetical
            protein (Cj1449c), KpsM (kpsM), and KpsT (kpsT) genes,
            complete cds
          Length = 3477

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 134  tatgctttgattgtcataca 153
            ||||||||||||||||||||
Sbjct: 1384 tatgctttgattgtcataca 1403



to top

>emb|BX511101.3| Zebrafish DNA sequence from clone DKEYP-92F1 in linkage group 2,
             complete sequence
          Length = 81968

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 126   agggaaaatatgctttgatt 145
             ||||||||||||||||||||
Sbjct: 29254 agggaaaatatgctttgatt 29235



to top

>gb|AC007546.6| Homo sapiens 12 BAC RP11-946P6 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 168396

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 129   gaaaatatgctttgattgtc 148
             ||||||||||||||||||||
Sbjct: 81253 gaaaatatgctttgattgtc 81234



to top

>emb|AJ340010.1|HSA340010 Homo sapiens genomic sequence surrounding NotI site, clone NR5-IL5C
          Length = 696

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 146 gtcatacaaaaacgcaaaat 165
           ||||||||||||||||||||
Sbjct: 577 gtcatacaaaaacgcaaaat 558


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,005,695
Number of Sequences: 3902068
Number of extensions: 2005695
Number of successful extensions: 143335
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 143275
Number of HSP's gapped (non-prelim): 60
length of query: 213
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 191
effective length of database: 17,147,199,772
effective search space: 3275115156452
effective search space used: 3275115156452
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top