ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast60g05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 105 1e-19
2dbj|AP005682.2| Oryza sativa (japonica cultivar-group) genomic D... 105 1e-19
3dbj|AK069696.1| Oryza sativa (japonica cultivar-group) cDNA clon... 105 1e-19
4gb|BT018177.1| Zea mays clone EL01N0557F01.c mRNA sequence 94 4e-16
5gb|AY105837.1| Zea mays PCO124224 mRNA sequence 94 4e-16
6gb|AY182169.1| Elaeis guineensis clone opsc155 putative 6-phosph... 66 9e-08
7ref|NM_122348.2| Arabidopsis thaliana EMB2024; 6-phosphogluconol... 58 2e-05
8emb|BX832117.1|CNS0A166 Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
9emb|BX833820.1|CNS0A0L5 Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
10gb|AY086161.1| Arabidopsis thaliana clone 21890 mRNA, complete s... 58 2e-05
11dbj|AB016884.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 58 2e-05
12gb|BT001923.1| Arabidopsis thaliana clone C105102 putative 6-pho... 58 2e-05
13gb|AC147231.2| Mus musculus BAC clone RP23-250I21 from chromosom... 46 0.088
14gb|AC111009.5| Mus musculus BAC clone RP23-418A13 from 9, comple... 46 0.088
15dbj|AP002409.3| Homo sapiens genomic DNA, chromosome 18 clone:RP... 44 0.35
16ref|NM_122350.2| Arabidopsis thaliana 6-phosphogluconolactonase ... 42 1.4
17ref|XM_483640.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.4
18gb|AY052737.1| Arabidopsis thaliana AT5g24420/K16H17_13 mRNA, co... 42 1.4
19gb|AF378879.1|AF378879 Arabidopsis thaliana AT5g24420/K16H17_13 ... 42 1.4
20dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
21emb|BX830567.1|CNS0A1E0 Arabidopsis thaliana Full-length cDNA Co... 42 1.4
22gb|AY085203.1| Arabidopsis thaliana clone 13806 mRNA, complete s... 42 1.4
23dbj|AK109374.2| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
24dbj|AP004704.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
25dbj|AK073704.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
26gb|M24359.1|RATPKM12 Rat pyruvate kinase M1 and M2 subunit genes... 42 1.4
27emb|AL671733.6| Mouse DNA sequence from clone RP23-83I22 on chro... 42 1.4
28gb|AC119834.12| Mus musculus chromosome 5, clone RP24-383P24, co... 40 5.4
29gb|AC130220.3| Mus musculus BAC clone RP23-140M6 from chromosome... 40 5.4
30emb|BX572604.1| Rhodopseudomonas palustris CGA009 complete genom... 40 5.4
31gb|AC104308.3| Homo sapiens chromosome 3 clone RP11-544F21, comp... 40 5.4
32emb|AL663044.5| Mouse DNA sequence from clone RP23-440I12 on chr... 40 5.4
33dbj|AK093916.1| Homo sapiens cDNA FLJ36597 fis, clone TRACH20144... 40 5.4
34gb|AC159195.2| Mus musculus BAC clone RP23-467E1 from chromosome... 40 5.4
35emb|BX248318.9| Zebrafish DNA sequence from clone CH211-220M17 i... 40 5.4
36emb|AL670256.6| Mouse DNA sequence from clone RP23-300H22 on chr... 40 5.4 
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  105 bits (53), Expect = 1e-19
 Identities = 133/159 (83%), Gaps = 3/159 (1%)
 Strand = Plus / Plus

                                                                            
Query: 228      cttgtcggtgaaccaggtgaattctccatcgtcaagcacagccatctcaacggggagcaa 287
                |||||| |||||||| |||||||| ||||| | ||| |||||||| || || || |||||
Sbjct: 20423859 cttgtcagtgaaccaagtgaattccccatcttgaagtacagccatttctacaggcagcaa 20423918

                                                                            
Query: 288      atcaga---agttttcttgtccgaaatcgccttctgcacagcaccagctttcccagcccc 344
                ||||||   ||| | ||| || ||||  || |||||||| ||||||||||||||||| ||
Sbjct: 20423919 atcagacgaagtctgcttatctgaaagtgctttctgcactgcaccagctttcccagctcc 20423978

                                                       
Query: 345      agttaccaccatggcgacatatgcagaggagttgatcac 383
                ||| |||||||| |||||||| ||||| |||||||||||
Sbjct: 20423979 agtgaccaccattgcgacatacgcagatgagttgatcac 20424017
to top
>dbj|AP005682.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1531_B07
          Length = 115245

 Score =  105 bits (53), Expect = 1e-19
 Identities = 133/159 (83%), Gaps = 3/159 (1%)
 Strand = Plus / Plus

                                                                         
Query: 228   cttgtcggtgaaccaggtgaattctccatcgtcaagcacagccatctcaacggggagcaa 287
             |||||| |||||||| |||||||| ||||| | ||| |||||||| || || || |||||
Sbjct: 51998 cttgtcagtgaaccaagtgaattccccatcttgaagtacagccatttctacaggcagcaa 52057

                                                                         
Query: 288   atcaga---agttttcttgtccgaaatcgccttctgcacagcaccagctttcccagcccc 344
             ||||||   ||| | ||| || ||||  || |||||||| ||||||||||||||||| ||
Sbjct: 52058 atcagacgaagtctgcttatctgaaagtgctttctgcactgcaccagctttcccagctcc 52117

                                                    
Query: 345   agttaccaccatggcgacatatgcagaggagttgatcac 383
             ||| |||||||| |||||||| ||||| |||||||||||
Sbjct: 52118 agtgaccaccattgcgacatacgcagatgagttgatcac 52156
to top
>dbj|AK069696.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023028P13, full
           insert sequence
          Length = 1234

 Score =  105 bits (53), Expect = 1e-19
 Identities = 133/159 (83%), Gaps = 3/159 (1%)
 Strand = Plus / Minus

                                                                       
Query: 228 cttgtcggtgaaccaggtgaattctccatcgtcaagcacagccatctcaacggggagcaa 287
           |||||| |||||||| |||||||| ||||| | ||| |||||||| || || || |||||
Sbjct: 941 cttgtcagtgaaccaagtgaattccccatcttgaagtacagccatttctacaggcagcaa 882

                                                                       
Query: 288 atcaga---agttttcttgtccgaaatcgccttctgcacagcaccagctttcccagcccc 344
           ||||||   ||| | ||| || ||||  || |||||||| ||||||||||||||||| ||
Sbjct: 881 atcagacgaagtctgcttatctgaaagtgctttctgcactgcaccagctttcccagctcc 822

                                                  
Query: 345 agttaccaccatggcgacatatgcagaggagttgatcac 383
           ||| |||||||| |||||||| ||||| |||||||||||
Sbjct: 821 agtgaccaccattgcgacatacgcagatgagttgatcac 783
to top
>gb|BT018177.1| Zea mays clone EL01N0557F01.c mRNA sequence
          Length = 1291

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 166/205 (80%), Gaps = 3/205 (1%)
 Strand = Plus / Minus

                                                                       
Query: 204 gttctgcagcatcgacaccgcctccttgtcggtgaaccaggtgaattctccatcgtcaag 263
           |||||||||||  ||||||||  |||| || ||||||||||||||||||||||| |  ||
Sbjct: 995 gttctgcagcaaggacaccgctgccttatcagtgaaccaggtgaattctccatcttgtag 936

                                                                       
Query: 264 cacagccatctcaacggggagcaaatc---agaagttttcttgtccgaaatcgccttctg 320
           ||||||||||||||| || ||||  ||    || |||| |||||| || | |||||||||
Sbjct: 935 cacagccatctcaacaggcagcaggtctgacgaggtttgcttgtctgagagcgccttctg 876

                                                                       
Query: 321 cacagcaccagctttcccagccccagttaccaccatggcgacatatgcagaggagttgat 380
           ||| ||  | || || ||||| ||||| |||||||| || || ||||| || ||||||||
Sbjct: 875 caccgctgccgcctttccagctccagtcaccaccatcgcaacgtatgcggatgagttgat 816

                                    
Query: 381 caccgggaacgtgaatgtgattctc 405
            || || ||||||||||| ||||||
Sbjct: 815 tactggaaacgtgaatgtaattctc 791
to top
>gb|AY105837.1| Zea mays PCO124224 mRNA sequence
          Length = 1316

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 166/205 (80%), Gaps = 3/205 (1%)
 Strand = Plus / Minus

                                                                        
Query: 204  gttctgcagcatcgacaccgcctccttgtcggtgaaccaggtgaattctccatcgtcaag 263
            |||||||||||  ||||||||  |||| || ||||||||||||||||||||||| |  ||
Sbjct: 1064 gttctgcagcaaggacaccgctgccttatcagtgaaccaggtgaattctccatcttgtag 1005

                                                                        
Query: 264  cacagccatctcaacggggagcaaatc---agaagttttcttgtccgaaatcgccttctg 320
            ||||||||||||||| || ||||  ||    || |||| |||||| || | |||||||||
Sbjct: 1004 cacagccatctcaacaggcagcaggtctgacgaggtttgcttgtctgagagcgccttctg 945

                                                                        
Query: 321  cacagcaccagctttcccagccccagttaccaccatggcgacatatgcagaggagttgat 380
            ||| ||  | || || ||||| ||||| |||||||| || || ||||| || ||||||||
Sbjct: 944  caccgctgccgcctttccagctccagtcaccaccatcgcaacgtatgcggatgagttgat 885

                                     
Query: 381  caccgggaacgtgaatgtgattctc 405
             || || ||||||||||| ||||||
Sbjct: 884  tactggaaacgtgaatgtaattctc 860
to top
>gb|AY182169.1| Elaeis guineensis clone opsc155 putative 6-phosphogluconolactonase
           mRNA, partial cds
          Length = 937

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 78/93 (83%)
 Strand = Plus / Minus

                                                                       
Query: 313 gccttctgcacagcaccagctttcccagccccagttaccaccatggcgacatatgcagag 372
           ||||| ||||||||||||||||| ||||  ||||| |||||||  || |||||||| || 
Sbjct: 686 gccttgtgcacagcaccagctttaccagatccagtgaccaccagtgcaacatatgccgat 627

                                            
Query: 373 gagttgatcaccgggaacgtgaatgtgattctc 405
           |||||||| || ||||| ||||| || ||||||
Sbjct: 626 gagttgattactgggaatgtgaaagttattctc 594
to top
>ref|NM_122348.2| Arabidopsis thaliana EMB2024; 6-phosphogluconolactonase/ catalytic
           AT5G24400 (EMB2024) mRNA, complete cds
          Length = 1248

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 361 acatatgcagaggagttgatcaccgggaacgtgaatgtgattctc 405
           |||| |||||| |||||||| |||||||||||||| |||||||||
Sbjct: 886 acatgtgcagatgagttgatgaccgggaacgtgaaggtgattctc 842
to top
>emb|BX832117.1|CNS0A166 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH52ZF11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1089

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 361 acatatgcagaggagttgatcaccgggaacgtgaatgtgattctc 405
           |||| |||||| |||||||| |||||||||||||| |||||||||
Sbjct: 817 acatgtgcagatgagttgatgaccgggaacgtgaaggtgattctc 773
to top
>emb|BX833820.1|CNS0A0L5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL79ZA10 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1116

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 361 acatatgcagaggagttgatcaccgggaacgtgaatgtgattctc 405
           |||| |||||| |||||||| |||||||||||||| |||||||||
Sbjct: 810 acatgtgcagatgagttgatgaccgggaacgtgaaggtgattctc 766
to top
>gb|AY086161.1| Arabidopsis thaliana clone 21890 mRNA, complete sequence
          Length = 1250

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 361 acatatgcagaggagttgatcaccgggaacgtgaatgtgattctc 405
           |||| |||||| |||||||| |||||||||||||| |||||||||
Sbjct: 887 acatgtgcagatgagttgatgaccgggaacgtgaaggtgattctc 843
to top
>dbj|AB016884.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K16H17
          Length = 45529

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                          
Query: 361   acatatgcagaggagttgatcaccgggaacgtgaatgtgattctc 405
             |||| |||||| |||||||| |||||||||||||| |||||||||
Sbjct: 34047 acatgtgcagatgagttgatgaccgggaacgtgaaggtgattctc 34091



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 373   gagttgatcaccgggaacgtgaatgtgattctc 405
             |||||||| ||||| || |||||||||||||||
Sbjct: 40470 gagttgatgaccggtaaagtgaatgtgattctc 40502
to top
>gb|BT001923.1| Arabidopsis thaliana clone C105102 putative
           6-phosphogluconolactonase (At5g24400) mRNA, complete cds
          Length = 1009

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 361 acatatgcagaggagttgatcaccgggaacgtgaatgtgattctc 405
           |||| |||||| |||||||| |||||||||||||| |||||||||
Sbjct: 833 acatgtgcagatgagttgatgaccgggaacgtgaaggtgattctc 789
to top
>gb|AC147231.2| Mus musculus BAC clone RP23-250I21 from chromosome 9, complete sequence
          Length = 215395

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 151   acttttattttaattaggagctt 173
             |||||||||||||||||||||||
Sbjct: 87362 acttttattttaattaggagctt 87340
to top
>gb|AC111009.5| Mus musculus BAC clone RP23-418A13 from 9, complete sequence
          Length = 194287

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 151   acttttattttaattaggagctt 173
             |||||||||||||||||||||||
Sbjct: 21734 acttttattttaattaggagctt 21712
to top
>dbj|AP002409.3| Homo sapiens genomic DNA, chromosome 18 clone:RP11-781P6, complete
              sequence
          Length = 180566

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 141    catgggactcacttttatttta 162
              ||||||||||||||||||||||
Sbjct: 109124 catgggactcacttttatttta 109145
to top
>ref|NM_122350.2| Arabidopsis thaliana 6-phosphogluconolactonase AT5G24420 mRNA,
           complete cds
          Length = 1177

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 373 gagttgatcaccgggaacgtgaatgtgattctc 405
           |||||||| ||||| || |||||||||||||||
Sbjct: 691 gagttgatgaccggtaaagtgaatgtgattctc 659
to top
>ref|XM_483640.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1416

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 313 gccttctgcacagcaccagctttcccagccccagttaccac 353
           ||||| ||||| || |||||||||||||| ||||| |||||
Sbjct: 933 gccttatgcactgccccagctttcccagcaccagtgaccac 893
to top
>gb|AY052737.1| Arabidopsis thaliana AT5g24420/K16H17_13 mRNA, complete cds
          Length = 759

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 373 gagttgatcaccgggaacgtgaatgtgattctc 405
           |||||||| ||||| || |||||||||||||||
Sbjct: 602 gagttgatgaccggtaaagtgaatgtgattctc 570
to top
>gb|AF378879.1|AF378879 Arabidopsis thaliana AT5g24420/K16H17_13 mRNA, complete cds
          Length = 1047

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 373 gagttgatcaccgggaacgtgaatgtgattctc 405
           |||||||| ||||| || |||||||||||||||
Sbjct: 691 gagttgatgaccggtaaagtgaatgtgattctc 659
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                         
Query: 313      gccttctgcacagcaccagctttcccagccccagttaccac 353
                ||||| ||||| || |||||||||||||| ||||| |||||
Sbjct: 27398713 gccttatgcactgccccagctttcccagcaccagtgaccac 27398673
to top
>emb|BX830567.1|CNS0A1E0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB90ZD03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1051

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 373 gagttgatcaccgggaacgtgaatgtgattctc 405
           |||||||| ||||| || |||||||||||||||
Sbjct: 679 gagttgatgaccggtaaagtgaatgtgattctc 647
to top
>gb|AY085203.1| Arabidopsis thaliana clone 13806 mRNA, complete sequence
          Length = 1078

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 373 gagttgatcaccgggaacgtgaatgtgattctc 405
           |||||||| ||||| || |||||||||||||||
Sbjct: 683 gagttgatgaccggtaaagtgaatgtgattctc 651
to top
>dbj|AK109374.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-208-H02, full
            insert sequence
          Length = 1440

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 313  gccttctgcacagcaccagctttcccagccccagttaccac 353
            ||||| ||||| || |||||||||||||| ||||| |||||
Sbjct: 1051 gccttatgcactgccccagctttcccagcaccagtgaccac 1011
to top
>dbj|AP004704.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0544G09
          Length = 137481

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                      
Query: 313   gccttctgcacagcaccagctttcccagccccagttaccac 353
             ||||| ||||| || |||||||||||||| ||||| |||||
Sbjct: 25508 gccttatgcactgccccagctttcccagcaccagtgaccac 25468
to top
>dbj|AK073704.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033060E10, full
           insert sequence
          Length = 1417

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 313 gccttctgcacagcaccagctttcccagccccagttaccac 353
           ||||| ||||| || |||||||||||||| ||||| |||||
Sbjct: 933 gccttatgcactgccccagctttcccagcaccagtgaccac 893
to top
>gb|M24359.1|RATPKM12 Rat pyruvate kinase M1 and M2 subunit genes, complete cds
          Length = 11788

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 328  ccagctttcccagccccagtt 348
            |||||||||||||||||||||
Sbjct: 1037 ccagctttcccagccccagtt 1017
to top
>emb|AL671733.6| Mouse DNA sequence from clone RP23-83I22 on chromosome 4, complete
              sequence
          Length = 186686

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 117    ccaggatgaatgcaaccatgc 137
              |||||||||||||||||||||
Sbjct: 152152 ccaggatgaatgcaaccatgc 152172
to top
>gb|AC119834.12| Mus musculus chromosome 5, clone RP24-383P24, complete sequence
          Length = 223764

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 133    catgccaccatgggactcac 152
              ||||||||||||||||||||
Sbjct: 139151 catgccaccatgggactcac 139132
to top
>gb|AC130220.3| Mus musculus BAC clone RP23-140M6 from chromosome 6, complete sequence
          Length = 200785

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 126    atgcaaccatgccaccatgg 145
              ||||||||||||||||||||
Sbjct: 154596 atgcaaccatgccaccatgg 154615
to top
>emb|BX572604.1| Rhodopseudomonas palustris CGA009 complete genome; segment 12/16
          Length = 348068

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   catcgtcaagcacagccatc 273
             ||||||||||||||||||||
Sbjct: 23230 catcgtcaagcacagccatc 23249
to top
>gb|AC104308.3| Homo sapiens chromosome 3 clone RP11-544F21, complete sequence
          Length = 174513

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 41     atgttatttactcctaaacacatt 64
              |||| |||||||||||||||||||
Sbjct: 115784 atgtcatttactcctaaacacatt 115761
to top
>emb|AL663044.5| Mouse DNA sequence from clone RP23-440I12 on chromosome 11 Contains
             part of a novel gene, complete sequence
          Length = 86761

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 111   gacccaccaggatgaatgca 130
             ||||||||||||||||||||
Sbjct: 64699 gacccaccaggatgaatgca 64718
to top
>dbj|AK093916.1| Homo sapiens cDNA FLJ36597 fis, clone TRACH2014442, highly similar
           to TRANSFORMING GROWTH FACTOR-BETA INDUCED PROTEIN IG-H3
           PRECURSOR
          Length = 2659

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 ccttctgcacagcaccagct 333
           ||||||||||||||||||||
Sbjct: 176 ccttctgcacagcaccagct 157
to top
>gb|AC159195.2| Mus musculus BAC clone RP23-467E1 from chromosome 13, complete sequence
          Length = 194915

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 146   gactcacttttattttaatt 165
             ||||||||||||||||||||
Sbjct: 54021 gactcacttttattttaatt 54002
to top
>emb|BX248318.9| Zebrafish DNA sequence from clone CH211-220M17 in linkage group 11,
              complete sequence
          Length = 194209

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 33/36 (91%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                  
Query: 30     cgcctcagcaaatgtt-atttactcctaaacacatt 64
              |||||||||||||||| ||| ||||||||| |||||
Sbjct: 188549 cgcctcagcaaatgttaattgactcctaaatacatt 188584
to top
>emb|AL670256.6| Mouse DNA sequence from clone RP23-300H22 on chromosome 4, complete
              sequence
          Length = 237318

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 145    ggactcacttttattttaattagg 168
              |||||||||||| |||||||||||
Sbjct: 207178 ggactcactttttttttaattagg 207155


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,918,177
Number of Sequences: 3902068
Number of extensions: 3918177
Number of successful extensions: 77743
Number of sequences better than 10.0: 36
Number of HSP's better than 10.0 without gapping: 35
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 77655
Number of HSP's gapped (non-prelim): 86
length of query: 405
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 383
effective length of database: 17,147,199,772
effective search space: 6567377512676
effective search space used: 6567377512676
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top