ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast59g08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_193298.1| Oryza sativa (japonica cultivar-group), predic... 103 4e-19
2dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 103 4e-19
3dbj|AP004361.4| Oryza sativa (japonica cultivar-group) genomic D... 103 4e-19
4ref|NM_111359.2| Arabidopsis thaliana ZDS (ZETA-CAROTENE DESATUR... 70 6e-09
5ref|NM_202493.1| Arabidopsis thaliana ZDS (ZETA-CAROTENE DESATUR... 70 6e-09
6ref|NM_111360.1| Arabidopsis thaliana DRT102 (DNA-DAMAGE-REPAIR/... 70 6e-09
7gb|AY143862.1| Arabidopsis thaliana At3g04880/T9J14_17 mRNA, com... 70 6e-09
8gb|AY052206.1| Arabidopsis thaliana AT3g04880/T9J14_17 mRNA, com... 70 6e-09
9emb|BX825011.1|CNS0A7TT Arabidopsis thaliana Full-length cDNA Co... 70 6e-09
10emb|BX823693.1|CNS0A6M1 Arabidopsis thaliana Full-length cDNA Co... 70 6e-09
11gb|AC009465.7|AC009465 Arabidopsis thaliana chromosome 3 BAC T9J... 70 6e-09
12gb|AF121947.1|AF121947 Arabidopsis thaliana zeta-carotene desatu... 70 6e-09
13gb|L11368.1|ATHUNIDB Arabidopsis thaliana unidentified mRNA sequ... 70 6e-09
14gb|AC009736.10| Drosophila melanogaster clone BACR10A04, complet... 46 0.081
15gb|AE003722.4| Drosophila melanogaster chromosome 3R, section 60... 46 0.081
16gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 44 0.32
17emb|AJ012318.1|GMA012318 Glycine max cctd gene 44 0.32
18emb|AJ583803.1| Glycine max cctd gene for cytosolic chaperonin d... 44 0.32
19gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 44 0.32
20gb|DQ002408.1| Zea mays gypsy retrotransposon huck, and copia re... 42 1.3
21gb|DQ002407.1| Zea mays copia retrotransposon opie1, gypsy retro... 42 1.3
22emb|CT009748.6| Mouse DNA sequence from clone RP23-120N6 on chro... 42 1.3
23emb|AL837505.21| Mouse DNA sequence from clone RP23-181N6 on chr... 42 1.3
24gb|AC117530.2| Homo sapiens chromosome 5 clone RP11-294P1, compl... 42 1.3
25gb|AC010411.7| Homo sapiens chromosome 5 clone CTD-2165P17, comp... 42 1.3
26gb|AC008856.6|AC008856 Homo sapiens chromosome 5 clone CTD-2178N... 42 1.3
27emb|BX571975.7| Zebrafish DNA sequence from clone DKEY-77F3 in l... 42 1.3
28emb|BX548070.5| Zebrafish DNA sequence from clone CH211-245P7 in... 42 1.3
29gb|AF005267.1| Saccharomyces cerevisiae Yeb3p (YEB3) mRNA, compl... 40 5.0
30gb|AC096658.1| Homo sapiens BAC clone RP11-29C24 from 7, complet... 40 5.0
31gb|AC142307.1| Pan troglodytes BAC clone RP43-131H12 from 7, com... 40 5.0
32gb|AC144435.2| Homo sapiens fosmid clone XXFOS-801248E3 from 7, ... 40 5.0
33emb|AL669838.22| Mouse DNA sequence from clone RP23-324A4 on chr... 40 5.0
34gb|AC087639.7| Homo sapiens chromosome 15, clone RP11-696L21, co... 40 5.0
35gb|AC121569.4| Mus musculus BAC clone RP23-228C13 from chromosom... 40 5.0
36gb|AC079347.6| Homo sapiens BAC clone RP11-352J13 from 2, comple... 40 5.0
37gb|U18530.1|SCE9871 Saccharomyces cerevisiae chromosome V cosmid... 40 5.0
38dbj|BS000207.2| Pan troglodytes chromosome 22 clone:PTB-155J22, ... 40 5.0
39dbj|BS000208.1| Pan troglodytes chromosome 22 clone:RP43-017N02,... 40 5.0
40gb|U51561.1|U51561 Homo sapiens cosmid clone N79E2 from 22q12, c... 40 5.0
41dbj|AP001696.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 5.0
42gb|AC124991.14| Mus musculus chromosome 12, clone RP23-138M19, c... 40 5.0
43dbj|AB216702.1| Equus caballus DNA, microsatellite TKY2759 40 5.0
44dbj|AP001595.1| Homo sapiens genomic DNA, chromosome 21, clone:K... 40 5.0

>ref|NM_193298.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 948

 Score =  103 bits (52), Expect = 4e-19
 Identities = 127/152 (83%)
 Strand = Plus / Minus

                                                                       
Query: 219 agctctgcatcgatggcattgcgtgcggtttccaggtcttcatctaggaatatgtcccag 278
           ||||| |||||||||||  |||| ||||  || ||||| || || ||||| |||||||| 
Sbjct: 926 agctccgcatcgatggctctgcgcgcggcgtcgaggtcctcgtcgaggaagatgtcccaa 867

                                                                       
Query: 279 tgcccatcccaccggatgaagaactcagtgtcttgcaagtacttgacacggtgcacgtcc 338
           || || ||||| |||||||||||||| ||||| |  ||||||||||| ||||||||||| 
Sbjct: 866 tggccgtcccagcggatgaagaactcggtgtcctcgaagtacttgacgcggtgcacgtcg 807

                                           
Query: 339 cccgcaggcgtgaacaggaagtccccgtcgac 370
           || || |||||||| |||||||| ||||||||
Sbjct: 806 ccggccggcgtgaagaggaagtcgccgtcgac 775



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  103 bits (52), Expect = 4e-19
 Identities = 127/152 (83%)
 Strand = Plus / Minus

                                                                            
Query: 219      agctctgcatcgatggcattgcgtgcggtttccaggtcttcatctaggaatatgtcccag 278
                ||||| |||||||||||  |||| ||||  || ||||| || || ||||| |||||||| 
Sbjct: 19969118 agctccgcatcgatggctctgcgcgcggcgtcgaggtcctcgtcgaggaagatgtcccaa 19969059

                                                                            
Query: 279      tgcccatcccaccggatgaagaactcagtgtcttgcaagtacttgacacggtgcacgtcc 338
                || || ||||| |||||||||||||| ||||| |  ||||||||||| ||||||||||| 
Sbjct: 19969058 tggccgtcccagcggatgaagaactcggtgtcctcgaagtacttgacgcggtgcacgtcg 19968999

                                                
Query: 339      cccgcaggcgtgaacaggaagtccccgtcgac 370
                || || |||||||| |||||||| ||||||||
Sbjct: 19968998 ccggccggcgtgaagaggaagtcgccgtcgac 19968967



to top

>dbj|AP004361.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0062A24
          Length = 148362

 Score =  103 bits (52), Expect = 4e-19
 Identities = 127/152 (83%)
 Strand = Plus / Minus

                                                                         
Query: 219   agctctgcatcgatggcattgcgtgcggtttccaggtcttcatctaggaatatgtcccag 278
             ||||| |||||||||||  |||| ||||  || ||||| || || ||||| |||||||| 
Sbjct: 72027 agctccgcatcgatggctctgcgcgcggcgtcgaggtcctcgtcgaggaagatgtcccaa 71968

                                                                         
Query: 279   tgcccatcccaccggatgaagaactcagtgtcttgcaagtacttgacacggtgcacgtcc 338
             || || ||||| |||||||||||||| ||||| |  ||||||||||| ||||||||||| 
Sbjct: 71967 tggccgtcccagcggatgaagaactcggtgtcctcgaagtacttgacgcggtgcacgtcg 71908

                                             
Query: 339   cccgcaggcgtgaacaggaagtccccgtcgac 370
             || || |||||||| |||||||| ||||||||
Sbjct: 71907 ccggccggcgtgaagaggaagtcgccgtcgac 71876



to top

>ref|NM_111359.2| Arabidopsis thaliana ZDS (ZETA-CAROTENE DESATURASE); carotene
            7,8-desaturase AT3G04870 (ZDS) transcript variant
            AT3G04870.1 mRNA, complete cds
          Length = 3033

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 59/67 (88%)
 Strand = Plus / Plus

                                                                        
Query: 246  gtttccaggtcttcatctaggaatatgtcccagtgcccatcccaccggatgaagaactca 305
            ||||| |||||||| || |||||||||||||| || ||||||||   |||||||||||||
Sbjct: 2071 gtttcgaggtcttcgtcaaggaatatgtcccaatggccatcccaagtgatgaagaactca 2130

                   
Query: 306  gtgtctt 312
            |||||||
Sbjct: 2131 gtgtctt 2137



to top

>ref|NM_202493.1| Arabidopsis thaliana ZDS (ZETA-CAROTENE DESATURASE); carotene
            7,8-desaturase AT3G04870 (ZDS) transcript variant
            AT3G04870.2 mRNA, complete cds
          Length = 3055

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 59/67 (88%)
 Strand = Plus / Plus

                                                                        
Query: 246  gtttccaggtcttcatctaggaatatgtcccagtgcccatcccaccggatgaagaactca 305
            ||||| |||||||| || |||||||||||||| || ||||||||   |||||||||||||
Sbjct: 2093 gtttcgaggtcttcgtcaaggaatatgtcccaatggccatcccaagtgatgaagaactca 2152

                   
Query: 306  gtgtctt 312
            |||||||
Sbjct: 2153 gtgtctt 2159



to top

>ref|NM_111360.1| Arabidopsis thaliana DRT102 (DNA-DAMAGE-REPAIR/TOLERATION 2)
           AT3G04880 (DRT102) mRNA, complete cds
          Length = 1082

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                       
Query: 246 gtttccaggtcttcatctaggaatatgtcccagtgcccatcccaccggatgaagaactca 305
           ||||| |||||||| || |||||||||||||| || ||||||||   |||||||||||||
Sbjct: 916 gtttcgaggtcttcgtcaaggaatatgtcccaatggccatcccaagtgatgaagaactca 857

                  
Query: 306 gtgtctt 312
           |||||||
Sbjct: 856 gtgtctt 850



to top

>gb|AY143862.1| Arabidopsis thaliana At3g04880/T9J14_17 mRNA, complete cds
          Length = 933

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                       
Query: 246 gtttccaggtcttcatctaggaatatgtcccagtgcccatcccaccggatgaagaactca 305
           ||||| |||||||| || |||||||||||||| || ||||||||   |||||||||||||
Sbjct: 902 gtttcgaggtcttcgtcaaggaatatgtcccaatggccatcccaagtgatgaagaactca 843

                  
Query: 306 gtgtctt 312
           |||||||
Sbjct: 842 gtgtctt 836



to top

>gb|AY052206.1| Arabidopsis thaliana AT3g04880/T9J14_17 mRNA, complete cds
          Length = 1082

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                       
Query: 246 gtttccaggtcttcatctaggaatatgtcccagtgcccatcccaccggatgaagaactca 305
           ||||| |||||||| || |||||||||||||| || ||||||||   |||||||||||||
Sbjct: 916 gtttcgaggtcttcgtcaaggaatatgtcccaatggccatcccaagtgatgaagaactca 857

                  
Query: 306 gtgtctt 312
           |||||||
Sbjct: 856 gtgtctt 850



to top

>emb|BX825011.1|CNS0A7TT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH8ZA05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1068

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                       
Query: 246 gtttccaggtcttcatctaggaatatgtcccagtgcccatcccaccggatgaagaactca 305
           ||||| |||||||| || |||||||||||||| || ||||||||   |||||||||||||
Sbjct: 893 gtttcgaggtcttcgtcaaggaatatgtcccaatggccatcccaagtgatgaagaactca 834

                  
Query: 306 gtgtctt 312
           |||||||
Sbjct: 833 gtgtctt 827



to top

>emb|BX823693.1|CNS0A6M1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS68ZC02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1054

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                       
Query: 246 gtttccaggtcttcatctaggaatatgtcccagtgcccatcccaccggatgaagaactca 305
           ||||| |||||||| || |||||||||||||| || ||||||||   |||||||||||||
Sbjct: 895 gtttcgaggtcttcgtcaaggaatatgtcccaatggccatcccaagtgatgaagaactca 836

                  
Query: 306 gtgtctt 312
           |||||||
Sbjct: 835 gtgtctt 829



to top

>gb|AC009465.7|AC009465 Arabidopsis thaliana chromosome 3 BAC T9J14 genomic sequence, complete
             sequence
          Length = 93234

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                         
Query: 246   gtttccaggtcttcatctaggaatatgtcccagtgcccatcccaccggatgaagaactca 305
             ||||| |||||||| || |||||||||||||| || ||||||||   |||||||||||||
Sbjct: 58483 gtttcgaggtcttcgtcaaggaatatgtcccaatggccatcccaagtgatgaagaactca 58424

                    
Query: 306   gtgtctt 312
             |||||||
Sbjct: 58423 gtgtctt 58417



to top

>gb|AF121947.1|AF121947 Arabidopsis thaliana zeta-carotene desaturase precursor, gene,
            complete cds
          Length = 4400

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 59/67 (88%)
 Strand = Plus / Plus

                                                                        
Query: 246  gtttccaggtcttcatctaggaatatgtcccagtgcccatcccaccggatgaagaactca 305
            ||||| |||||||| || |||||||||||||| || ||||||||   |||||||||||||
Sbjct: 4070 gtttcgaggtcttcgtcaaggaatatgtcccaatggccatcccaagtgatgaagaactca 4129

                   
Query: 306  gtgtctt 312
            |||||||
Sbjct: 4130 gtgtctt 4136



to top

>gb|L11368.1|ATHUNIDB Arabidopsis thaliana unidentified mRNA sequence, complete cds
          Length = 946

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                       
Query: 246 gtttccaggtcttcatctaggaatatgtcccagtgcccatcccaccggatgaagaactca 305
           ||||| |||||||| || |||||||||||||| || ||||||||   |||||||||||||
Sbjct: 757 gtttcgaggtcttcgtcaaggaatatgtcccaatggccatcccaagtgatgaagaactca 698

                  
Query: 306 gtgtctt 312
           |||||||
Sbjct: 697 gtgtctt 691



to top

>gb|AC009736.10| Drosophila melanogaster clone BACR10A04, complete sequence
          Length = 165489

 Score = 46.1 bits (23), Expect = 0.081
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 99    acagcaccagccaccagcaacaa 121
             |||||||||||||||||||||||
Sbjct: 73318 acagcaccagccaccagcaacaa 73340



to top

>gb|AE003722.4| Drosophila melanogaster chromosome 3R, section 60 of 118 of the complete
              sequence
          Length = 221164

 Score = 46.1 bits (23), Expect = 0.081
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 99     acagcaccagccaccagcaacaa 121
              |||||||||||||||||||||||
Sbjct: 140556 acagcaccagccaccagcaacaa 140578



to top

>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 237     ttgcgtgcggtttccaggtctt 258
               ||||||||||||||||||||||
Sbjct: 2003105 ttgcgtgcggtttccaggtctt 2003126



to top

>emb|AJ012318.1|GMA012318 Glycine max cctd gene
          Length = 1602

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 202 caccgtcgacgacaccgagctc 223
           ||||||||||||||||||||||
Sbjct: 627 caccgtcgacgacaccgagctc 648



to top

>emb|AJ583803.1| Glycine max cctd gene for cytosolic chaperonin delta-subunit,
           cultivar Cuc Vang
          Length = 1602

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 202 caccgtcgacgacaccgagctc 223
           ||||||||||||||||||||||
Sbjct: 627 caccgtcgacgacaccgagctc 648



to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 200     gtcaccgtcgacgacaccgagc 221
               ||||||||||||||||||||||
Sbjct: 4568273 gtcaccgtcgacgacaccgagc 4568294



to top

>gb|DQ002408.1| Zea mays gypsy retrotransposon huck, and copia retrotransposon ji,
             complete sequence; and helitron Mo17_14594, complete
             sequence
          Length = 57607

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 46    agcatccagcaaacatacatatctg 70
             |||| ||||||||||||||||||||
Sbjct: 52653 agcagccagcaaacatacatatctg 52629



to top

>gb|DQ002407.1| Zea mays copia retrotransposon opie1, gypsy retrotransposon grande1,
             xilon1 retrotransposon, helitron B73_14578, gypsy
             retrotransposon huck1 and ruda retrotransposon, complete
             sequence
          Length = 152384

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 46    agcatccagcaaacatacatatctg 70
             |||| ||||||||||||||||||||
Sbjct: 99410 agcagccagcaaacatacatatctg 99386



to top

>emb|CT009748.6| Mouse DNA sequence from clone RP23-120N6 on chromosome 9, complete
              sequence
          Length = 235839

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 40     tagcaaagcatccagcaaaca 60
              |||||||||||||||||||||
Sbjct: 226432 tagcaaagcatccagcaaaca 226412



to top

>emb|AL837505.21| Mouse DNA sequence from clone RP23-181N6 on chromosome 4, complete
             sequence
          Length = 186045

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 174   tagaaccttcagaagcctcct 194
             |||||||||||||||||||||
Sbjct: 82195 tagaaccttcagaagcctcct 82175



to top

>gb|AC117530.2| Homo sapiens chromosome 5 clone RP11-294P1, complete sequence
          Length = 172442

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 19   accattttattccaaagagca 39
            |||||||||||||||||||||
Sbjct: 2223 accattttattccaaagagca 2243



to top

>gb|AC010411.7| Homo sapiens chromosome 5 clone CTD-2165P17, complete sequence
          Length = 177807

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 19     accattttattccaaagagca 39
              |||||||||||||||||||||
Sbjct: 101773 accattttattccaaagagca 101753



to top

>gb|AC008856.6|AC008856 Homo sapiens chromosome 5 clone CTD-2178N20, complete sequence
          Length = 154229

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 19     accattttattccaaagagca 39
              |||||||||||||||||||||
Sbjct: 119323 accattttattccaaagagca 119303



to top

>emb|BX571975.7| Zebrafish DNA sequence from clone DKEY-77F3 in linkage group 18, complete
              sequence
          Length = 187272

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 16     atcaccattttattccaaaga 36
              |||||||||||||||||||||
Sbjct: 121038 atcaccattttattccaaaga 121018



to top

>emb|BX548070.5| Zebrafish DNA sequence from clone CH211-245P7 in linkage group 18,
              complete sequence
          Length = 173372

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 16     atcaccattttattccaaaga 36
              |||||||||||||||||||||
Sbjct: 120337 atcaccattttattccaaaga 120317



to top

>gb|AF005267.1| Saccharomyces cerevisiae Yeb3p (YEB3) mRNA, complete cds
          Length = 2418

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 87  accaatacaggcacagcacc 106
           ||||||||||||||||||||
Sbjct: 858 accaatacaggcacagcacc 839



to top

>gb|AC096658.1| Homo sapiens BAC clone RP11-29C24 from 7, complete sequence
          Length = 77142

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 60    atacatatctgaaaagatgt 79
             ||||||||||||||||||||
Sbjct: 48250 atacatatctgaaaagatgt 48231



to top

>gb|AC142307.1| Pan troglodytes BAC clone RP43-131H12 from 7, complete sequence
          Length = 158646

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 60   atacatatctgaaaagatgt 79
            ||||||||||||||||||||
Sbjct: 2889 atacatatctgaaaagatgt 2908



to top

>gb|AC144435.2| Homo sapiens fosmid clone XXFOS-801248E3 from 7, complete sequence
          Length = 43653

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 60    atacatatctgaaaagatgt 79
             ||||||||||||||||||||
Sbjct: 35956 atacatatctgaaaagatgt 35975



to top

>emb|AL669838.22| Mouse DNA sequence from clone RP23-324A4 on chromosome 11 Contains the
             Adcy1 gene for adenylate cyclase 1, a novel gene and a CpG
             island, complete sequence
          Length = 189132

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 89    caatacaggcacagcaccagccac 112
             ||||| ||||||||||||||||||
Sbjct: 73141 caataaaggcacagcaccagccac 73118



to top

>gb|AC087639.7| Homo sapiens chromosome 15, clone RP11-696L21, complete sequence
          Length = 190015

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 241   gtgcggtttccaggtcttcatcta 264
             |||| |||||||||||||||||||
Sbjct: 52314 gtgcagtttccaggtcttcatcta 52337



to top

>gb|AC121569.4| Mus musculus BAC clone RP23-228C13 from chromosome 12, complete
             sequence
          Length = 171710

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 134   gaactctgcattgatggagaaaaa 157
             |||||||| |||||||||||||||
Sbjct: 86265 gaactctggattgatggagaaaaa 86242



to top

>gb|AC079347.6| Homo sapiens BAC clone RP11-352J13 from 2, complete sequence
          Length = 96559

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 35    gagcatagcaaagcatccag 54
             ||||||||||||||||||||
Sbjct: 80971 gagcatagcaaagcatccag 80952



to top

>gb|U18530.1|SCE9871 Saccharomyces cerevisiae chromosome V cosmids 9871, 8199, 9867, 9495
             and lambda clones 6693 and 5898
          Length = 62643

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 87    accaatacaggcacagcacc 106
             ||||||||||||||||||||
Sbjct: 39871 accaatacaggcacagcacc 39852



to top

>dbj|BS000207.2| Pan troglodytes chromosome 22 clone:PTB-155J22, map 22, complete
              sequences
          Length = 193476

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 134    gaactctgcattgatggagaaaaa 157
              ||||||||||||| ||||||||||
Sbjct: 188851 gaactctgcattgttggagaaaaa 188828



to top

>dbj|BS000208.1| Pan troglodytes chromosome 22 clone:RP43-017N02, map 22, complete
             sequences
          Length = 173249

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 134   gaactctgcattgatggagaaaaa 157
             ||||||||||||| ||||||||||
Sbjct: 27579 gaactctgcattgttggagaaaaa 27556



to top

>gb|U51561.1|U51561 Homo sapiens cosmid clone N79E2 from 22q12, complete sequence
          Length = 39683

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 83    aagaaccaatacaggcacag 102
             ||||||||||||||||||||
Sbjct: 37174 aagaaccaatacaggcacag 37155



to top

>dbj|AP001696.1| Homo sapiens genomic DNA, chromosome 21q, section 40/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 134   gaactctgcattgatggagaaaaa 157
             ||||||||||||| ||||||||||
Sbjct: 50389 gaactctgcattgttggagaaaaa 50366



to top

>gb|AC124991.14| Mus musculus chromosome 12, clone RP23-138M19, complete sequence
          Length = 179111

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 134   gaactctgcattgatggagaaaaa 157
             |||||||| |||||||||||||||
Sbjct: 83946 gaactctggattgatggagaaaaa 83923



to top

>dbj|AB216702.1| Equus caballus DNA, microsatellite TKY2759
          Length = 518

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 182 tcagaagcctcctcacttgt 201
           ||||||||||||||||||||
Sbjct: 271 tcagaagcctcctcacttgt 290



to top

>dbj|AP001595.1| Homo sapiens genomic DNA, chromosome 21, clone:KB1622E1, APP-D21S292
             region, complete sequence
          Length = 154686

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 134   gaactctgcattgatggagaaaaa 157
             ||||||||||||| ||||||||||
Sbjct: 96278 gaactctgcattgttggagaaaaa 96255


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,132,066
Number of Sequences: 3902068
Number of extensions: 3132066
Number of successful extensions: 59917
Number of sequences better than 10.0: 44
Number of HSP's better than 10.0 without gapping: 44
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 59791
Number of HSP's gapped (non-prelim): 126
length of query: 374
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 352
effective length of database: 17,147,199,772
effective search space: 6035814319744
effective search space used: 6035814319744
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top