ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast58e09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC129583.15| Mus musculus chromosome 15, clone RP23-197P10, c... 38 8.4
2gb|AC169510.1| Mus musculus BAC clone RP23-121E6 from chromosome... 38 8.4
3gb|BC072744.1| Xenopus laevis MGC79099 protein, mRNA (cDNA clone... 38 8.4
4emb|CT009532.6| Mouse DNA sequence from clone RP23-122B16 on chr... 38 8.4
5gb|AC162907.5| Mus musculus BAC clone RP24-286I24 from chromosom... 38 8.4
6gb|AC126780.18| Medicago truncatula clone mth2-10n4, complete se... 38 8.4
7emb|AL606462.5| Human DNA sequence from clone CTD-2090I13 on chr... 38 8.4
8emb|AL132794.25|HSJ343I24 Human DNA sequence from clone RP3-343I... 38 8.4
9emb|AL031286.2|HS681J21 Human DNA sequence from clone RP4-681J21... 38 8.4
10gb|AC078852.5| Homo sapiens BAC clone RP11-386I15 from 4, comple... 38 8.4
11gb|AC159538.20| Medicago truncatula clone mth2-48f16, complete s... 38 8.4
12gb|AC010242.7| Homo sapiens chromosome 5 clone CTC-359E10, compl... 38 8.4
13gb|AC008816.8| Homo sapiens chromosome 5 clone CTD-2122K17, comp... 38 8.4
14gb|S51392.1| gag...rev [maedi-visna-like virus EV1, Genomic RNA ... 38 8.4
15emb|BX276119.8| Zebrafish DNA sequence from clone CH211-200N10 i... 38 8.4
16gb|AC010280.7| Homo sapiens chromosome 5 clone CTC-537E7, comple... 38 8.4
17tpg|BK005589.1| TPA: TPA_exp: Xenopus tropicalis peroxidasin (Px... 38 8.4
18gb|AC017093.3|AC017093 Homo sapiens BAC clone RP11-511G7 from 5,... 38 8.4
19gb|AC018693.8| Homo sapiens BAC clone RP11-555N21 from 2, comple... 38 8.4
20gb|AC132195.4| Polypterus bichir, clone -164C2, complete sequence 38 8.4
21gb|AC092833.4| Homo sapiens BAC clone RP13-490C19 from 2, comple... 38 8.4
22dbj|BA000039.2| Thermosynechococcus elongatus BP-1 DNA, complete... 38 8.4
23emb|BX072561.8| Zebrafish DNA sequence from clone CH211-157C18 i... 38 8.4
24dbj|BS000201.1| Pan troglodytes chromosome 22 clone:PTB-047A24, ... 38 8.4
25dbj|AP001725.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 38 8.4
26gb|AC124553.4| Mus musculus BAC clone RP23-223I5 from 1, complet... 38 8.4
27gb|AC126445.5| Mus musculus BAC clone RP23-307P24 from 8, comple... 38 8.4
28emb|Z31646.1|MVVLTR40 Maedi-visna virus (clone ltr-ev1-8) long t... 38 8.4
29emb|Z31644.1|MVVLTR38 Maedi-visna virus (clone ltr-ev1-6) long t... 38 8.4
30emb|Z31643.1|MVVLTR37 Maedi-visna virus (clone ltr-ev1-46) long ... 38 8.4
31emb|Z31639.1|MVVLTR33 Maedi-visna virus (clone ltr-ev1-30) long ... 38 8.4
32emb|Z31636.1|MVVLTR30 Maedi-visna virus (clone ltr-ev1-28) long ... 38 8.4
33emb|Z31635.1|MVVLTR29 Maedi-visna virus (clone ltr-ev1-2) long t... 38 8.4
34emb|Z31632.1|MVVLTR26 Maedi-visna virus (clone ltr-ev1-17) long ... 38 8.4
35emb|Z31629.1|MVVLTR23 Maedi-visna virus (clone ltr-848b-67) long... 38 8.4
36emb|Z31625.1|MVVLTR19 Maedi-visna virus (clone ltr-848b-61) long... 38 8.4
37dbj|AP000689.1| Homo sapiens genomic DNA, chromosome 21q22.2, BA... 38 8.4
38dbj|AB003151.1| Homo sapiens DNA, chromosome 21q22.2, PAC clone ... 38 8.4

>gb|AC129583.15| Mus musculus chromosome 15, clone RP23-197P10, complete sequence
          Length = 206094

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 110   acataaaaatgtccaaatc 128
             |||||||||||||||||||
Sbjct: 49636 acataaaaatgtccaaatc 49618



to top

>gb|AC169510.1| Mus musculus BAC clone RP23-121E6 from chromosome 14, complete sequence
          Length = 214403

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 125    aatccagactaagagaatg 143
              |||||||||||||||||||
Sbjct: 124150 aatccagactaagagaatg 124168



to top

>gb|BC072744.1| Xenopus laevis MGC79099 protein, mRNA (cDNA clone MGC:79099
           IMAGE:5048305), complete cds
          Length = 2158

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 55  agcaaatgtacactcttca 73
           |||||||||||||||||||
Sbjct: 838 agcaaatgtacactcttca 820



to top

>emb|CT009532.6| Mouse DNA sequence from clone RP23-122B16 on chromosome 14, complete
              sequence
          Length = 187658

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 125    aatccagactaagagaatg 143
              |||||||||||||||||||
Sbjct: 157906 aatccagactaagagaatg 157888



to top

>gb|AC162907.5| Mus musculus BAC clone RP24-286I24 from chromosome 1, complete sequence
          Length = 190513

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 150    agagcatttcatttcattg 168
              |||||||||||||||||||
Sbjct: 187542 agagcatttcatttcattg 187560



to top

>gb|AC126780.18| Medicago truncatula clone mth2-10n4, complete sequence
          Length = 139213

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 50    gacatagcaaatgtacact 68
             |||||||||||||||||||
Sbjct: 15857 gacatagcaaatgtacact 15875



to top

>emb|AL606462.5| Human DNA sequence from clone CTD-2090I13 on chromosome 1 Contains a
            novel gene, a nuclear ubiquitous casein kinase and
            cyclin-dependent kinase substrate (NUCKS) pseudogene, a
            ribosomal protein S18 (RPS18) pseudogene and a pseudogene
            similar to part ofbasic transcription factor 3 (BTF3),
            complete sequence
          Length = 112401

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 27   caaggagaataaatctcgt 45
            |||||||||||||||||||
Sbjct: 4018 caaggagaataaatctcgt 4000



to top

>emb|AL132794.25|HSJ343I24 Human DNA sequence from clone RP3-343I24 on chromosome 6q13-14.1,
             complete sequence
          Length = 114728

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 48    atgacatagcaaatgtaca 66
             |||||||||||||||||||
Sbjct: 68063 atgacatagcaaatgtaca 68045



to top

>emb|AL031286.2|HS681J21 Human DNA sequence from clone RP4-681J21 on chromosome 1q23.2-24.3
             Contains the 5' end of a novel gene, the 5' end of the
             gene for expressed in hematopoietic cells (heart, liver)
             (HLL) and a CpG island, complete sequence
          Length = 68770

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 112   ataaaaatgtccaaatcca 130
             |||||||||||||||||||
Sbjct: 46200 ataaaaatgtccaaatcca 46218



to top

>gb|AC078852.5| Homo sapiens BAC clone RP11-386I15 from 4, complete sequence
          Length = 86981

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 111   cataaaaatgtccaaatcc 129
             |||||||||||||||||||
Sbjct: 82131 cataaaaatgtccaaatcc 82113



to top

>gb|AC159538.20| Medicago truncatula clone mth2-48f16, complete sequence
          Length = 123581

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 50    gacatagcaaatgtacact 68
             |||||||||||||||||||
Sbjct: 13875 gacatagcaaatgtacact 13857



to top

>gb|AC010242.7| Homo sapiens chromosome 5 clone CTC-359E10, complete sequence
          Length = 174293

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 149   aagagcatttcatttcatt 167
             |||||||||||||||||||
Sbjct: 41765 aagagcatttcatttcatt 41747



to top

>gb|AC008816.8| Homo sapiens chromosome 5 clone CTD-2122K17, complete sequence
          Length = 174293

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 149   aagagcatttcatttcatt 167
             |||||||||||||||||||
Sbjct: 41765 aagagcatttcatttcatt 41747



to top

>gb|S51392.1| gag...rev [maedi-visna-like virus EV1, Genomic RNA Complete, 6 genes,
            9203 nt]
          Length = 9203

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 46   ggatgacatagcaaatgta 64
            |||||||||||||||||||
Sbjct: 9016 ggatgacatagcaaatgta 9034



to top

>emb|BX276119.8| Zebrafish DNA sequence from clone CH211-200N10 in linkage group 8,
            complete sequence
          Length = 38280

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 49   tgacatagcaaatgtacactctt 71
            ||||||||||||||||| |||||
Sbjct: 6818 tgacatagcaaatgtactctctt 6796



to top

>gb|AC010280.7| Homo sapiens chromosome 5 clone CTC-537E7, complete sequence
          Length = 133790

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 149   aagagcatttcatttcatt 167
             |||||||||||||||||||
Sbjct: 30950 aagagcatttcatttcatt 30968



to top

>tpg|BK005589.1| TPA: TPA_exp: Xenopus tropicalis peroxidasin (Pxn) gene, complete cds
          Length = 68792

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 112   ataaaaatgtccaaatcca 130
             |||||||||||||||||||
Sbjct: 37858 ataaaaatgtccaaatcca 37840



to top

>gb|AC017093.3|AC017093 Homo sapiens BAC clone RP11-511G7 from 5, complete sequence
          Length = 203043

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 149    aagagcatttcatttcatt 167
              |||||||||||||||||||
Sbjct: 104126 aagagcatttcatttcatt 104108



to top

>gb|AC018693.8| Homo sapiens BAC clone RP11-555N21 from 2, complete sequence
          Length = 164125

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 149   aagagcatttcatttcatt 167
             |||||||||||||||||||
Sbjct: 99635 aagagcatttcatttcatt 99653



to top

>gb|AC132195.4| Polypterus bichir, clone -164C2, complete sequence
          Length = 115022

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 151   gagcatttcatttcattgc 169
             |||||||||||||||||||
Sbjct: 85577 gagcatttcatttcattgc 85559



to top

>gb|AC092833.4| Homo sapiens BAC clone RP13-490C19 from 2, complete sequence
          Length = 143506

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 149    aagagcatttcatttcatt 167
              |||||||||||||||||||
Sbjct: 105095 aagagcatttcatttcatt 105113



to top

>dbj|BA000039.2| Thermosynechococcus elongatus BP-1 DNA, complete genome
          Length = 2593857

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 69      cttcaaagcgaaagatgga 87
               |||||||||||||||||||
Sbjct: 2516681 cttcaaagcgaaagatgga 2516663



to top

>emb|BX072561.8| Zebrafish DNA sequence from clone CH211-157C18 in linkage group 8,
             complete sequence
          Length = 179087

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 49    tgacatagcaaatgtacactctt 71
             ||||||||||||||||| |||||
Sbjct: 58593 tgacatagcaaatgtactctctt 58571



to top

>dbj|BS000201.1| Pan troglodytes chromosome 22 clone:PTB-047A24, map 22, complete
              sequences
          Length = 165662

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 18     ccacatttgcaaggagaat 36
              |||||||||||||||||||
Sbjct: 120534 ccacatttgcaaggagaat 120552



to top

>dbj|AP001725.1| Homo sapiens genomic DNA, chromosome 21q, section 69/105
          Length = 340000

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 18    ccacatttgcaaggagaat 36
             |||||||||||||||||||
Sbjct: 23379 ccacatttgcaaggagaat 23397



to top

>gb|AC124553.4| Mus musculus BAC clone RP23-223I5 from 1, complete sequence
          Length = 179316

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 150    agagcatttcatttcattg 168
              |||||||||||||||||||
Sbjct: 178391 agagcatttcatttcattg 178373



to top

>gb|AC126445.5| Mus musculus BAC clone RP23-307P24 from 8, complete sequence
          Length = 167770

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 113   taaaaatgtccaaatccag 131
             |||||||||||||||||||
Sbjct: 75855 taaaaatgtccaaatccag 75873



to top

>emb|Z31646.1|MVVLTR40 Maedi-visna virus (clone ltr-ev1-8) long terminal repeat
          Length = 240

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 46 ggatgacatagcaaatgta 64
          |||||||||||||||||||
Sbjct: 63 ggatgacatagcaaatgta 81



to top

>emb|Z31644.1|MVVLTR38 Maedi-visna virus (clone ltr-ev1-6) long terminal repeat
          Length = 209

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 46 ggatgacatagcaaatgta 64
          |||||||||||||||||||
Sbjct: 63 ggatgacatagcaaatgta 81



to top

>emb|Z31643.1|MVVLTR37 Maedi-visna virus (clone ltr-ev1-46) long terminal repeat
          Length = 253

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 46  ggatgacatagcaaatgta 64
           |||||||||||||||||||
Sbjct: 140 ggatgacatagcaaatgta 158



 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 46 ggatgacatagcaaatgta 64
          |||||||||||||||||||
Sbjct: 63 ggatgacatagcaaatgta 81



to top

>emb|Z31639.1|MVVLTR33 Maedi-visna virus (clone ltr-ev1-30) long terminal repeat
          Length = 238

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 46 ggatgacatagcaaatgta 64
          |||||||||||||||||||
Sbjct: 63 ggatgacatagcaaatgta 81



to top

>emb|Z31636.1|MVVLTR30 Maedi-visna virus (clone ltr-ev1-28) long terminal repeat
          Length = 253

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 46  ggatgacatagcaaatgta 64
           |||||||||||||||||||
Sbjct: 140 ggatgacatagcaaatgta 158



 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 46 ggatgacatagcaaatgta 64
          |||||||||||||||||||
Sbjct: 63 ggatgacatagcaaatgta 81



to top

>emb|Z31635.1|MVVLTR29 Maedi-visna virus (clone ltr-ev1-2) long terminal repeat
          Length = 227

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 46  ggatgacatagcaaatgta 64
           |||||||||||||||||||
Sbjct: 114 ggatgacatagcaaatgta 132



to top

>emb|Z31632.1|MVVLTR26 Maedi-visna virus (clone ltr-ev1-17) long terminal repeat
          Length = 238

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 46 ggatgacatagcaaatgta 64
          |||||||||||||||||||
Sbjct: 63 ggatgacatagcaaatgta 81



to top

>emb|Z31629.1|MVVLTR23 Maedi-visna virus (clone ltr-848b-67) long terminal repeat
          Length = 241

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 46 ggatgacatagcaaatgta 64
          |||||||||||||||||||
Sbjct: 63 ggatgacatagcaaatgta 81



to top

>emb|Z31625.1|MVVLTR19 Maedi-visna virus (clone ltr-848b-61) long terminal repeat
          Length = 241

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 46 ggatgacatagcaaatgta 64
          |||||||||||||||||||
Sbjct: 63 ggatgacatagcaaatgta 81



to top

>dbj|AP000689.1| Homo sapiens genomic DNA, chromosome 21q22.2, BAC clone:KB795B7,
             CBR1-HLCS region
          Length = 126546

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 18    ccacatttgcaaggagaat 36
             |||||||||||||||||||
Sbjct: 34368 ccacatttgcaaggagaat 34386



to top

>dbj|AB003151.1| Homo sapiens DNA, chromosome 21q22.2, PAC clone 25P16 complete sequence,
              encoding carbonyl reductase and carbonyl reductase 3
              (complete cds)
          Length = 170529

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 18     ccacatttgcaaggagaat 36
              |||||||||||||||||||
Sbjct: 112392 ccacatttgcaaggagaat 112410


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,618,991
Number of Sequences: 3902068
Number of extensions: 1618991
Number of successful extensions: 127462
Number of sequences better than 10.0: 38
Number of HSP's better than 10.0 without gapping: 38
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 127356
Number of HSP's gapped (non-prelim): 106
length of query: 173
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 151
effective length of database: 17,147,199,772
effective search space: 2589227165572
effective search space used: 2589227165572
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top