| Clone Name | rbast57g11 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | emb|AL939110.1|SCO939110 Streptomyces coelicolor A3(2) complete ... | 46 | 0.060 | 2 | gb|AE012280.1| Xanthomonas campestris pv. campestris str. ATCC 3... | 44 | 0.24 | 3 | gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... | 44 | 0.24 | 4 | gb|CP000081.1| Leishmania major chromosome 35, complete sequence | 40 | 3.7 | 5 | gb|AY109276.1| Zea mays PCO138516 mRNA sequence | 40 | 3.7 |
|---|
>emb|AL939110.1|SCO939110 Streptomyces coelicolor A3(2) complete genome; segment 7/29 Length = 283100 Score = 46.1 bits (23), Expect = 0.060 Identities = 23/23 (100%) Strand = Plus / Plus Query: 259 gcgcagggcgttggggctgaagc 281 ||||||||||||||||||||||| Sbjct: 20456 gcgcagggcgttggggctgaagc 20478
>gb|AE012280.1| Xanthomonas campestris pv. campestris str. ATCC 33913, section 188 of 460 of the complete genome Length = 10801 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 246 cggtgtcgatggcgcgcagggc 267 |||||||||||||||||||||| Sbjct: 9466 cggtgtcgatggcgcgcagggc 9487
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome Length = 5148708 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 246 cggtgtcgatggcgcgcagggc 267 |||||||||||||||||||||| Sbjct: 2961888 cggtgtcgatggcgcgcagggc 2961867
>gb|CP000081.1| Leishmania major chromosome 35, complete sequence Length = 2090491 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 acacgcacacacgcgagcag 143 |||||||||||||||||||| Sbjct: 469966 acacgcacacacgcgagcag 469947
>gb|AY109276.1| Zea mays PCO138516 mRNA sequence Length = 697 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 232 gccggcctagacgacggtgt 251 |||||||||||||||||||| Sbjct: 249 gccggcctagacgacggtgt 230 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,352,627 Number of Sequences: 3902068 Number of extensions: 2352627 Number of successful extensions: 43794 Number of sequences better than 10.0: 5 Number of HSP's better than 10.0 without gapping: 5 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 43717 Number of HSP's gapped (non-prelim): 77 length of query: 284 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 262 effective length of database: 17,147,199,772 effective search space: 4492566340264 effective search space used: 4492566340264 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)