ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast57e05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AJ224324.1|HVH224324 Hordeum vulgare cv. Haisa mRNA for cp31... 402 e-109
2gb|AC167172.3| Mus musculus BAC clone RP23-166M7 from chromosome... 42 0.94
3emb|AL645985.30| Mouse DNA sequence from clone DN-240H8 on chrom... 42 0.94
4gb|AC013410.5| Homo sapiens BAC clone RP11-495I2 from 2, complet... 42 0.94
5gb|AC092614.2| Homo sapiens BAC clone RP11-192M8 from 2, complet... 42 0.94
6gb|AC092380.4| Homo sapiens chromosome 16 clone RP11-727M7, comp... 42 0.94
7gb|AY107260.1| Zea mays PCO071008 mRNA sequence 42 0.94
8emb|AL606749.13| Mouse DNA sequence from clone RP23-325J22 on ch... 42 0.94
9gb|AC132367.3| Mus musculus BAC clone RP23-465K21 from chromosom... 40 3.7
10emb|BX649569.5| Human DNA sequence from clone RP11-204I2 on chro... 40 3.7
11emb|AL627164.8| Zebrafish DNA sequence from clone RP71-1I20 in l... 40 3.7
12gb|AC092562.4| Papio hamadryas BAC RP41-285I13 (Rosewell Park Ca... 40 3.7
13gb|DQ139261.1| Vibro sp. DAT722 inDAT722 integron, complete sequ... 40 3.7
14dbj|AP002827.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 3.7
15gb|AC154237.1| Mus musculus BAC clone RP24-162O18 from 17, compl... 40 3.7
16gb|AC157955.2| Gallus gallus BAC clone TAM31-4B17 from chromosom... 40 3.7
17gb|AC158368.2| Gallus gallus BAC clone CH261-77E11 from chromoso... 40 3.7
18emb|BX005035.9| Human DNA sequence from clone RP11-133G22 on chr... 40 3.7
19dbj|AP006535.1| Lotus japonicus genomic DNA, chromosome 2, clone... 40 3.7 
>emb|AJ224324.1|HVH224324 Hordeum vulgare cv. Haisa mRNA for cp31BHv protein
          Length = 1139

 Score =  402 bits (203), Expect = e-109
 Identities = 218/223 (97%)
 Strand = Plus / Minus

                                                                        
Query: 63   aaaagttgaactcatggtattgacaagaaattaacatgattacaccagcagcgaacgaaa 122
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1133 aaaagttgaactcatggtattgacaagaaattaacatgattacaccagcagcgaacgaaa 1074

                                                                        
Query: 123  gcatgaaaagaatatgggatgggaggagagccagcatcaggaggctaatgcgggagtttc 182
            ||||||||| ||||||||||||||||||||||| |||| |||||||||||||||||||||
Sbjct: 1073 gcatgaaaaaaatatgggatgggaggagagccaccatcgggaggctaatgcgggagtttc 1014

                                                                        
Query: 183  aagtggtgacatgcttcagtcttctgcagtaacatttcagcagtgttcccatgtgtccac 242
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1013 aagtggtgacatgcttcagtcttctgcagtaacatttcagcagtgttcccatgtgtccac 954

                                                       
Query: 243  gagaaacgccaagccatgctctccgccgctgcgccgaatcaga 285
            |||||||||||||||||||||||||||||||| ||| ||||||
Sbjct: 953  gagaaacgccaagccatgctctccgccgctgcaccgcatcaga 911
to top
>gb|AC167172.3| Mus musculus BAC clone RP23-166M7 from chromosome 3, complete sequence
          Length = 204419

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 128   aaaagaatatgggatgggaggagag 152
             ||||||| |||||||||||||||||
Sbjct: 30351 aaaagaaaatgggatgggaggagag 30327
to top
>emb|AL645985.30| Mouse DNA sequence from clone DN-240H8 on chromosome 3 Contains part of
             a novel gene, a ribosomal protein L36 (Rpl36) pseudogene
             and a pseudogene similar to part of ribosomal protein S2
             (Rps2), complete sequence
          Length = 141661

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 128   aaaagaatatgggatgggaggagag 152
             ||||||| |||||||||||||||||
Sbjct: 49495 aaaagaaaatgggatgggaggagag 49519
to top
>gb|AC013410.5| Homo sapiens BAC clone RP11-495I2 from 2, complete sequence
          Length = 200900

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 29     agaacactagggcatcattacagtagcct 57
              |||||||||||||  ||||||||||||||
Sbjct: 170126 agaacactagggctgcattacagtagcct 170154
to top
>gb|AC092614.2| Homo sapiens BAC clone RP11-192M8 from 2, complete sequence
          Length = 106992

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 73   ctcatggtattgacaagaaattaac 97
            |||||||| ||||||||||||||||
Sbjct: 5863 ctcatggttttgacaagaaattaac 5887
to top
>gb|AC092380.4| Homo sapiens chromosome 16 clone RP11-727M7, complete sequence
          Length = 167071

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 56     ctacttgaaaagttgaactca 76
              |||||||||||||||||||||
Sbjct: 141210 ctacttgaaaagttgaactca 141190
to top
>gb|AY107260.1| Zea mays PCO071008 mRNA sequence
          Length = 737

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 255 gccatgctctccgccgctgcg 275
           |||||||||||||||||||||
Sbjct: 62  gccatgctctccgccgctgcg 82
to top
>emb|AL606749.13| Mouse DNA sequence from clone RP23-325J22 on chromosome 3, complete
             sequence
          Length = 89111

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 128   aaaagaatatgggatgggaggagag 152
             ||||||| |||||||||||||||||
Sbjct: 12511 aaaagaaaatgggatgggaggagag 12535
to top
>gb|AC132367.3| Mus musculus BAC clone RP23-465K21 from chromosome 17, complete sequence
          Length = 192971

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 139    ggatgggaggagagccagcatcag 162
              |||||||||||||||||| |||||
Sbjct: 159538 ggatgggaggagagccagaatcag 159515
to top
>emb|BX649569.5| Human DNA sequence from clone RP11-204I2 on chromosome 9 Contains part
             of the gene for a novel protein similar to contactin
             associated protein-like 3 (CNTNAP3), complete sequence
          Length = 162657

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 159   tcaggaggctaatgcgggag 178
             ||||||||||||||||||||
Sbjct: 27901 tcaggaggctaatgcgggag 27882
to top
>emb|AL627164.8| Zebrafish DNA sequence from clone RP71-1I20 in linkage group 11,
             complete sequence
          Length = 84892

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 53    agcctacttgaaaagttgaa 72
             ||||||||||||||||||||
Sbjct: 58928 agcctacttgaaaagttgaa 58909
to top
>gb|AC092562.4| Papio hamadryas BAC RP41-285I13 (Rosewell Park Cancer Institute BAC
             Library) complete sequence
          Length = 183586

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 159   tcaggaggctaatgcgggag 178
             ||||||||||||||||||||
Sbjct: 18864 tcaggaggctaatgcgggag 18883
to top
>gb|DQ139261.1| Vibro sp. DAT722 inDAT722 integron, complete sequence and flanking
             sequences
          Length = 136095

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 4     aacaaaaccttcttcgatta 23
             ||||||||||||||||||||
Sbjct: 98969 aacaaaaccttcttcgatta 98950
to top
>dbj|AP002827.4| Homo sapiens genomic DNA, chromosome 11q, clone:CTD-2589O24, complete
             sequence
          Length = 64281

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 202   tcttctgcagtaacatttca 221
             ||||||||||||||||||||
Sbjct: 59392 tcttctgcagtaacatttca 59373
to top
>gb|AC154237.1| Mus musculus BAC clone RP24-162O18 from 17, complete sequence
          Length = 168481

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 139    ggatgggaggagagccagcatcag 162
              |||||||||||||||||| |||||
Sbjct: 145026 ggatgggaggagagccagaatcag 145049
to top
>gb|AC157955.2| Gallus gallus BAC clone TAM31-4B17 from chromosome unknown, complete
             sequence
          Length = 181590

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 146   aggagagccagcatcaggag 165
             ||||||||||||||||||||
Sbjct: 38930 aggagagccagcatcaggag 38911
to top
>gb|AC158368.2| Gallus gallus BAC clone CH261-77E11 from chromosome unknown, complete
              sequence
          Length = 180657

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 146    aggagagccagcatcaggag 165
              ||||||||||||||||||||
Sbjct: 165604 aggagagccagcatcaggag 165585
to top
>emb|BX005035.9| Human DNA sequence from clone RP11-133G22 on chromosome 9, complete
              sequence
          Length = 146143

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 159    tcaggaggctaatgcgggag 178
              ||||||||||||||||||||
Sbjct: 118302 tcaggaggctaatgcgggag 118321
to top
>dbj|AP006535.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT02D13, TM0546,
             complete sequence
          Length = 107979

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 80    tattgacaagaaattaacat 99
             ||||||||||||||||||||
Sbjct: 79592 tattgacaagaaattaacat 79573


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,668,572
Number of Sequences: 3902068
Number of extensions: 2668572
Number of successful extensions: 51097
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51071
Number of HSP's gapped (non-prelim): 26
length of query: 285
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 263
effective length of database: 17,147,199,772
effective search space: 4509713540036
effective search space used: 4509713540036
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top