ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbast57b08 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 123 bits (62), Expect = 5e-25 Identities = 71/74 (95%) Strand = Plus / Minus Query: 319 actagatggagcaggtgtagctggggggaggggtcttgccgcaggtgaggaggagctgga 378 ||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| Sbjct: 25844315 actagatggagcaggtgtagccggggggagggttcttgccgcaggtgaggaggagctgga 25844256 Query: 379 gggcgaggggcagg 392 | |||||||||||| Sbjct: 25844255 gcgcgaggggcagg 25844242
>dbj|AP003523.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0416A11 Length = 171519 Score = 123 bits (62), Expect = 5e-25 Identities = 71/74 (95%) Strand = Plus / Minus Query: 319 actagatggagcaggtgtagctggggggaggggtcttgccgcaggtgaggaggagctgga 378 ||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| Sbjct: 126519 actagatggagcaggtgtagccggggggagggttcttgccgcaggtgaggaggagctgga 126460 Query: 379 gggcgaggggcagg 392 | |||||||||||| Sbjct: 126459 gcgcgaggggcagg 126446
>dbj|AK103715.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033137N14, full insert sequence Length = 1338 Score = 123 bits (62), Expect = 5e-25 Identities = 71/74 (95%) Strand = Plus / Minus Query: 319 actagatggagcaggtgtagctggggggaggggtcttgccgcaggtgaggaggagctgga 378 ||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| Sbjct: 860 actagatggagcaggtgtagccggggggagggttcttgccgcaggtgaggaggagctgga 801 Query: 379 gggcgaggggcagg 392 | |||||||||||| Sbjct: 800 gcgcgaggggcagg 787
>gb|AY105889.1| Zea mays PCO106909 mRNA sequence Length = 1420 Score = 71.9 bits (36), Expect = 2e-09 Identities = 66/76 (86%) Strand = Plus / Minus Query: 329 gcaggtgtagctggggggaggggtcttgccgcaggtgaggaggagctggagggcgagggg 388 ||||||||||| || || || ||||||||||||||||||||||||||||| || || || Sbjct: 953 gcaggtgtagcccggcggcggcgtcttgccgcaggtgaggaggagctggagcgccagtgg 894 Query: 389 caggacgaggttgatg 404 |||| |||||||||| Sbjct: 893 caggtagaggttgatg 878
>ref|XM_795529.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein LOC590804 (LOC590804), mRNA Length = 675 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Plus Query: 377 gagggcgaggggcaggacgaggttga 402 |||||||||||||||||||||||||| Sbjct: 268 gagggcgaggggcaggacgaggttga 293
>gb|AC161052.2| Mus musculus BAC clone RP23-393J15 from chromosome 12, complete sequence Length = 201284 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 365 gaggaggagctggagggcgaggggcagga 393 ||||||||||||||||| ||||||||||| Sbjct: 7974 gaggaggagctggagggggaggggcagga 8002
>gb|AC024329.9| Homo sapiens, clone RP11-30P9, complete sequence Length = 158921 Score = 48.1 bits (24), Expect = 0.022 Identities = 30/32 (93%) Strand = Plus / Minus Query: 126 accaaacacaaaaaggaaaccacaagaaatga 157 |||| ||||||||||||||||||| ||||||| Sbjct: 72280 accacacacaaaaaggaaaccacatgaaatga 72249
>gb|AE017221.1| Thermus thermophilus HB27, complete genome Length = 1894877 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 376 ggagggcgaggggcaggacgag 397 |||||||||||||||||||||| Sbjct: 1429857 ggagggcgaggggcaggacgag 1429836
>gb|AC147628.4| Mus musculus BAC clone RP24-476D20 from chromosome 14, complete sequence Length = 170642 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 119 taatataaccaaacacaaaaa 139 ||||||||||||||||||||| Sbjct: 140589 taatataaccaaacacaaaaa 140569
>gb|AC132322.3| Mus musculus BAC clone RP24-262F3 from chromosome 13, complete sequence Length = 155179 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggtgaggaggagctggagggc 382 ||||||||||||||||||||| Sbjct: 126436 ggtgaggaggagctggagggc 126456
>emb|Z68132.1|CEF09C8 Caenorhabditis elegans Cosmid F09C8, complete sequence Length = 30140 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 141 gaaaccacaagaaatgacgaa 161 ||||||||||||||||||||| Sbjct: 28321 gaaaccacaagaaatgacgaa 28301
>gb|AC147641.3| Mus musculus BAC clone RP23-43L22 from 14, complete sequence Length = 247999 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 119 taatataaccaaacacaaaaa 139 ||||||||||||||||||||| Sbjct: 22797 taatataaccaaacacaaaaa 22777
>dbj|AP004468.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT09A24, TM0003, complete sequence Length = 88828 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 249 ttgacatcctctcatgtcgat 269 ||||||||||||||||||||| Sbjct: 55096 ttgacatcctctcatgtcgat 55076
>ref|XM_529043.1| PREDICTED: Pan troglodytes similar to zinc finger, CCHC domain containing 13; cellular nucleic acid binding protein-like; 4930513O09RIK (LOC473670), mRNA Length = 1041 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 365 gaggaggagctggagggcga 384 |||||||||||||||||||| Sbjct: 62 gaggaggagctggagggcga 81
>ref|XM_419244.1| PREDICTED: Gallus gallus similar to steerin1 protein (LOC421164), mRNA Length = 4986 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 367 ggaggagctggagggcgagg 386 |||||||||||||||||||| Sbjct: 1605 ggaggagctggagggcgagg 1624
>gb|AC136976.5| Mus musculus BAC clone RP23-362K12 from chromosome 13, complete sequence Length = 147695 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 198 tctctttcttcttcttgctc 217 |||||||||||||||||||| Sbjct: 115188 tctctttcttcttcttgctc 115207
>emb|CR769776.8| Human DNA sequence from clone RP11-793G16 on chromosome 9 Contains three novel pseudogenes, the gene for a novel protein similar to ankyrin repeat domain 20A (ANKRD20A), the gene for a novel protein similar to Ankyrin repeat domain protein 18A (LOC441424), a pseudogene similar to part of cytochrome P450 family protein, a novel zinc finger pseudogene and a CpG island, complete sequence Length = 161157 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 130 aacacaaaaaggaaaccaca 149 |||||||||||||||||||| Sbjct: 130960 aacacaaaaaggaaaccaca 130979
>emb|BX664718.7| Human DNA sequence from clone RP11-175I6 on chromosome 9 Conatins a pseudogene similar to part of fibroblast growth factor 7 (keratinocyte growth factor) (FGF7), two novel pseudogenes, a pseudogene similar to part of G protein-coupled receptor 116 (GPR116), a novel gene and a pseudogene similar to part of meprin A, alpha (PABA peptide hydrolase) (MEP1A), complete sequence Length = 167646 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 130 aacacaaaaaggaaaccaca 149 |||||||||||||||||||| Sbjct: 166770 aacacaaaaaggaaaccaca 166751
>emb|CR848007.6| Human DNA sequence from clone RP11-115C9 on chromosome 9 Contains a calponin 2 (CNN2) pseudogene, a novel zinc finger pseudogene, a pseudogene similar to part of cytochrome P450, subfamily IVF, a chromosome 2 open reading frame 14 (C2orf14) pseudogene, a pseudogene similar to part of sorting nexin associated golgi protein 1 (SNAG1), a melanoma antigen (LOC51152) pseudogene, four novel pseudogenes and an ankyrin repeat domain 20A (ANKRD20A) pseudogene, complete sequence Length = 149891 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 130 aacacaaaaaggaaaccaca 149 |||||||||||||||||||| Sbjct: 145418 aacacaaaaaggaaaccaca 145437
>emb|AL773545.13| Human DNA sequence from clone RP11-216M21 on chromosome 9 Contains three novel pseudogenes, a pseudogene similar to part of meprin A, alpha (PABA peptide hydrolase) (MEP1A), a pseudogene similar to part of G protein-coupled receptor 116 (GPR116), two novel genes, the 5' end of a novel gene similar to ankyrin repeat domain 20A (ANKRD20A) and three CpG islands, complete sequence Length = 165886 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 130 aacacaaaaaggaaaccaca 149 |||||||||||||||||||| Sbjct: 130697 aacacaaaaaggaaaccaca 130678
>emb|BX649567.3| Human DNA sequence from clone RP11-195B21 on chromosome 9 Contains a novel pseudogene, the gene for a novel protein similar to ankyrin repeat domain 20A (ANKRD20A), a novel gene and a CpG island, complete sequence Length = 99502 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 130 aacacaaaaaggaaaccaca 149 |||||||||||||||||||| Sbjct: 14856 aacacaaaaaggaaaccaca 14837
>emb|AL513478.10| Human DNA sequence from clone RP11-327I22 on chromosome 9 Contains a pseudogene similar to part of sorting nexin associated golgi protein 1 (SNAG1), the ANKRD20A gene for ankyrin repeat domain 20A, five novel genes, a pseudogene similar to part of eprin A, alpha (PABA peptide hydrolase) (MEP1A) and a CpG island, complete sequence Length = 180498 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 130 aacacaaaaaggaaaccaca 149 |||||||||||||||||||| Sbjct: 123782 aacacaaaaaggaaaccaca 123801
>gb|AC073553.5| Mus musculus strain C57BL/6J chromosome 12 clone RP23-270B12, complete sequence Length = 187523 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 198 tctctttcttcttcttgctc 217 |||||||||||||||||||| Sbjct: 15846 tctctttcttcttcttgctc 15827
>gb|BC021176.2| Homo sapiens zinc finger, CCHC domain containing 13, mRNA (cDNA clone MGC:33185 IMAGE:5269882), complete cds Length = 856 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 365 gaggaggagctggagggcga 384 |||||||||||||||||||| Sbjct: 139 gaggaggagctggagggcga 158
>emb|BX649563.5| Human DNA sequence from clone RP11-213O5 on chromosome 9 Contains a pseudogene similar to part of a novel protein (DKFZp434A171), a pseudogene similar to part of meprin A, alpha (PABA peptide hydrolase) (MEP1A), a pseudogene similar to part of a novel transmembrane receptor protein and two novel pseudogenes, complete sequence Length = 189495 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 130 aacacaaaaaggaaaccaca 149 |||||||||||||||||||| Sbjct: 29390 aacacaaaaaggaaaccaca 29409
>gb|AC008661.6| Homo sapiens chromosome 5 clone CTB-28J9, complete sequence Length = 188548 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 334 tgtagctggggggaggggtc 353 |||||||||||||||||||| Sbjct: 52199 tgtagctggggggaggggtc 52218
>gb|AC090887.3| Mus musculus strain C57BL/6J clone RP23-404D8, complete sequence Length = 161153 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 198 tctctttcttcttcttgctc 217 |||||||||||||||||||| Sbjct: 3693 tctctttcttcttcttgctc 3712
>dbj|AK160437.1| Mus musculus 10 day old male pancreas cDNA, RIKEN full-length enriched library, clone:1810005K16 product:unclassifiable, full insert sequence Length = 1288 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 14 aatcaattggtcatcagttgtgac 37 |||||||||||||||||| ||||| Sbjct: 704 aatcaattggtcatcagtggtgac 681
>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome Length = 6260361 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 193 atcgatctctttcttcttct 212 |||||||||||||||||||| Sbjct: 734098 atcgatctctttcttcttct 734117
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 198 tctctttcttcttcttgctc 217 |||||||||||||||||||| Sbjct: 16371003 tctctttcttcttcttgctc 16370984
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 201 ctttcttcttcttgctcgct 220 |||||||||||||||||||| Sbjct: 19339264 ctttcttcttcttgctcgct 19339283
>dbj|AP006878.1| Thermococcus kodakarensis KOD1 DNA, complete genome Length = 2088737 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 366 aggaggagctggagggcgag 385 |||||||||||||||||||| Sbjct: 294574 aggaggagctggagggcgag 294593
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 367 ggaggagctggagggcgagg 386 |||||||||||||||||||| Sbjct: 4913509 ggaggagctggagggcgagg 4913490
>emb|BX276117.5| Zebrafish DNA sequence from clone CH211-112K18 in linkage group 17, complete sequence Length = 181677 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 aatataaccaaacacaaaaa 139 |||||||||||||||||||| Sbjct: 170122 aatataaccaaacacaaaaa 170103
>dbj|AP005419.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0046G12 Length = 189391 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 198 tctctttcttcttcttgctc 217 |||||||||||||||||||| Sbjct: 59550 tctctttcttcttcttgctc 59531
>emb|AL355000.11| Human DNA sequence from clone RP11-78N10 on chromosome 22, complete sequence Length = 219376 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 130 aacacaaaaaggaaaccaca 149 |||||||||||||||||||| Sbjct: 137216 aacacaaaaaggaaaccaca 137197
>dbj|AP004879.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0475F05 Length = 147522 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 201 ctttcttcttcttgctcgct 220 |||||||||||||||||||| Sbjct: 24755 ctttcttcttcttgctcgct 24774
>dbj|AP004777.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0458B05 Length = 144917 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 201 ctttcttcttcttgctcgct 220 |||||||||||||||||||| Sbjct: 107062 ctttcttcttcttgctcgct 107081
>gb|AE001439.1| Helicobacter pylori J99, complete genome Length = 1643831 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 198 tctctttcttcttcttgctc 217 |||||||||||||||||||| Sbjct: 987088 tctctttcttcttcttgctc 987107
>gb|AC140346.4| Mus musculus BAC clone RP24-260I8 from 16, complete sequence Length = 185587 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 14 aatcaattggtcatcagttgtgac 37 |||||||||||||||||| ||||| Sbjct: 106887 aatcaattggtcatcagtggtgac 106910
>emb|AL132990.4|CNS01DTY Human chromosome 14 DNA sequence BAC R-262P9 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 181004 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 329 gcaggtgtagctggggggag 348 |||||||||||||||||||| Sbjct: 110639 gcaggtgtagctggggggag 110658
>gb|AC004386.1|AC004386 Homo Sapiens Chromosome X clone bWXD691, complete sequence Length = 172657 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 365 gaggaggagctggagggcga 384 |||||||||||||||||||| Sbjct: 90928 gaggaggagctggagggcga 90947
>gb|AC002418.1|AC002418 Human Chromosome X, complete sequence Length = 128915 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 365 gaggaggagctggagggcga 384 |||||||||||||||||||| Sbjct: 79731 gaggaggagctggagggcga 79712
>emb|AJ851868.2| Mus musculus immunoglobulin heavy chain locus constant region and partial variable region, strain 129/Sv Length = 1382053 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 198 tctctttcttcttcttgctc 217 |||||||||||||||||||| Sbjct: 1074405 tctctttcttcttcttgctc 1074386
>ref|NM_203303.1| Homo sapiens zinc finger, CCHC domain containing 13 (ZCCHC13), mRNA Length = 856 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 365 gaggaggagctggagggcga 384 |||||||||||||||||||| Sbjct: 139 gaggaggagctggagggcga 158
>emb|AL662925.12| Mouse DNA sequence from clone RP23-226M12 on chromosome X, complete sequence Length = 199774 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gtgtagctggggggaggggtcttg 356 |||||||||||||| ||||||||| Sbjct: 170725 gtgtagctgggggggggggtcttg 170702 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,645,401 Number of Sequences: 3902068 Number of extensions: 4645401 Number of successful extensions: 105591 Number of sequences better than 10.0: 46 Number of HSP's better than 10.0 without gapping: 46 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 105257 Number of HSP's gapped (non-prelim): 334 length of query: 404 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 382 effective length of database: 17,147,199,772 effective search space: 6550230312904 effective search space used: 6550230312904 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
