| Clone Name | rbast57a12 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY506529.1| Zea mays strain NB mitochondrion, complete genome Length = 569630 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 328860 tttccgatctcaatgcatttcaccgctc 328887
>gb|AC078977.6| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0496H07, complete sequence Length = 164477 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 88903 tttccgatctcaatgcatttcaccgctc 88930
>gb|AY522330.1| Oryza sativa (japonica cultivar-group) cultivar Nipponbare chloroplast, complete genome Length = 134551 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 123189 tttccgatctcaatgcatttcaccgctc 123216 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 91967 tttccgatctcaatgcatttcaccgctc 91940
>gb|AY522331.1| Oryza sativa (japonica cultivar-group) isolate PA64S chloroplast, complete genome Length = 134551 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 123189 tttccgatctcaatgcatttcaccgctc 123216 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 91967 tttccgatctcaatgcatttcaccgctc 91940
>gb|AY522329.1| Oryza sativa (indica cultivar-group) isolate 93-11 chloroplast, complete genome Length = 134496 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 123138 tttccgatctcaatgcatttcaccgctc 123165 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 91912 tttccgatctcaatgcatttcaccgctc 91885
>gb|AC136521.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone OSJNBa0034M22, complete sequence Length = 149435 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 126725 tttccgatctcaatgcatttcaccgctc 126752
>gb|AF493288.2| Uncultured bacterium clone pHS20 16S ribosomal RNA gene, partial sequence Length = 422 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 221 tttccgatctcaatgcatttcaccgctc 248
>emb|X86563.2|ZMA86563 Zea mays complete chloroplast genome Length = 140384 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 126916 tttccgatctcaatgcatttcaccgctc 126943 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 95821 tttccgatctcaatgcatttcaccgctc 95794
>emb|X15901.1|CHOSXX Oryza sativa (japonica cultivar-group) chloroplast genome Length = 134525 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 123159 tttccgatctcaatgcatttcaccgctc 123186 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 91959 tttccgatctcaatgcatttcaccgctc 91932
>gb|DQ129641.1| Uncultured bacterium clone AKIW1139 16S ribosomal RNA gene, partial sequence Length = 1444 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 649 tttccgatctcaatgcatttcaccgctc 622
>emb|BX569685.1|OSJN00291 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0061C08, complete sequence Length = 145980 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 119012 tttccgatctcaatgcatttcaccgctc 118985 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 87137 tttccgatctcaatgcatttcaccgctc 87110 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 10734 tttccgatctcaatgcatttcaccgctc 10707
>emb|AL731605.3|OSJN00246 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0042F21, complete sequence Length = 167113 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 137542 tttccgatctcaatgcatttcaccgctc 137515
>emb|AL606447.3|OSJN00011 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0022F23, complete sequence Length = 130273 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 62277 tttccgatctcaatgcatttcaccgctc 62304
>emb|AJ271079.2|OEL271079 Oenothera elata subsp. hookeri chloroplast plastome I, complete sequence Length = 163935 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||||||||| Sbjct: 146666 tttccgatctcaacgcatttcatcgctc 146693 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||||||||| Sbjct: 106662 tttccgatctcaacgcatttcatcgctc 106635
>dbj|AB254251.1| Uncultured bacterium gene for 16S rRNA, partial sequence, clone: 3m Length = 617 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 550 tttccgatctcaatgcatttcaccgctc 523
>gb|DQ417650.1| Festuca ovina 16S ribosomal RNA gene, partial sequence; plastid Length = 1409 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 625 tttccgatctcaatgcatttcaccgctc 598
>gb|DQ417649.1| Agrostis capillaris 16S ribosomal RNA gene, partial sequence; plastid Length = 1406 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 625 tttccgatctcaatgcatttcaccgctc 598
>gb|AC122148.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNAb0075K12, complete sequence Length = 125936 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 90150 tttccgatctcaatgcatttcaccgctc 90123
>gb|AE009947.2| Saccharum hybrid cultivar SP-80-3280 chloroplast, complete genome Length = 141182 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 48146 tttccgatctcaatgcatttcaccgctc 48173 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 16972 tttccgatctcaatgcatttcaccgctc 16945
>dbj|AB240470.1| Uncultured bacterium gene for 16S rRNA, partial sequence, clone: SRRT24 Length = 1478 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 678 tttccgatctcaatgcatttcaccgctc 651
>gb|AC092750.2| Oryza sativa (japonica cultivar-group) cultivar Nipponbare from chromosome 10, complete sequence Length = 134933 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 61869 tttccgatctcaatgcatttcaccgctc 61896
>gb|AC099402.2| Oryza sativa chromosome 10 clone OSJNBa0022D10, complete sequence Length = 144459 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 24214 tttccgatctcaatgcatttcaccgctc 24187
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 23619596 tttccgatctcaatgcatttcaccgctc 23619623 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 9264892 tttccgatctcaatgcatttcaccgctc 9264865 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 9224392 tttccgatctcaatgcatttcaccgctc 9224365 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 9206064 tttccgatctcaatgcatttcaccgctc 9206037 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 9160986 tttccgatctcaatgcatttcaccgctc 9160959 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 9129111 tttccgatctcaatgcatttcaccgctc 9129084 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 9052808 tttccgatctcaatgcatttcaccgctc 9052781
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 19934879 tttccgatctcaatgcatttcaccgctc 19934852 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 10383758 tttccgatctcaatgcatttcaccgctc 10383731 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 10280544 tttccgatctcaatgcatttcaccgctc 10280571
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 9245103 tttccgatctcaatgcatttcaccgctc 9245130
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 14179805 tttccgatctcaatgcatttcaccgctc 14179832
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 26646176 tttccgatctcaatgcatttcaccgctc 26646149
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 12829266 tttccgatctcaatgcatttcaccgctc 12829293 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 884479 tttccgatctcaatgcatttcaccgctc 884506
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 14346152 tttccgatctcaatgcatttcaccgctc 14346125 Score = 46.1 bits (23), Expect = 0.060 Identities = 26/27 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgct 102 |||||||||||||||||||||| |||| Sbjct: 811567 tttccgatctcaatgcatttcaccgct 811593
>gb|AC074232.11| Oryza sativa chromosome 10 BAC OSJNBb0005J14 genomic sequence, complete sequence Length = 116932 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 51164 tttccgatctcaatgcatttcaccgctc 51191
>gb|AY928077.1| Zea mays cultivar B73 chloroplast, complete genome Length = 140454 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 126985 tttccgatctcaatgcatttcaccgctc 127012 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 95852 tttccgatctcaatgcatttcaccgctc 95825
>dbj|AP005161.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0036E18 Length = 141148 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 56316 tttccgatctcaatgcatttcaccgctc 56343
>gb|DQ344624.1| Triticum aestivum vacuolar ATP synthase subunit E (VATE) mRNA, complete cds Length = 1970 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 1608 tttccgatctcaatgcatttcaccgctc 1581
>gb|AF176637.1|AF176637 Plastid transformation vector pMSK49 plastid targeting region Length = 5270 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 672 tttccgatctcaatgcatttcaccgctc 699
>dbj|AP005760.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:B1047G05 Length = 145431 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 3639 tttccgatctcaatgcatttcaccgctc 3612
>dbj|AP004803.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0677B10 Length = 134423 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 62606 tttccgatctcaatgcatttcaccgctc 62579
>dbj|AP006052.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0067K15 Length = 160162 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 64686 tttccgatctcaatgcatttcaccgctc 64713
>emb|AJ308294.1|UMA308294 Uncultured bacterium partial 16S rRNA gene, clone F99_10b_maize_chloroplast Length = 371 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 177 tttccgatctcaatgcatttcaccgctc 150
>dbj|AP005408.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0022A24 Length = 148347 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 68074 tttccgatctcaatgcatttcaccgctc 68047
>emb|Z00028.1|CHZMRRNA Zea mays chloroplast rRNA-operon Length = 8862 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 2174 tttccgatctcaatgcatttcaccgctc 2147
>dbj|AK105027.2| Oryza sativa (japonica cultivar-group) cDNA clone:001-012-A03, full insert sequence Length = 1247 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 225 tttccgatctcaatgcatttcaccgctc 198
>dbj|AK108725.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-150-C09, full insert sequence Length = 1602 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 322 tttccgatctcaatgcatttcaccgctc 295
>dbj|AK105341.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-118-G10, full insert sequence Length = 1448 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 236 tttccgatctcaatgcatttcaccgctc 209
>dbj|AK060799.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-F03, full insert sequence Length = 1769 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 73 tttccgatctcaatgcatttcaccgctc 46
>dbj|AK059639.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-031-B03, full insert sequence Length = 1569 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 606 tttccgatctcaatgcatttcaccgctc 579
>dbj|AK059310.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-025-G07, full insert sequence Length = 1098 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 336 tttccgatctcaatgcatttcaccgctc 309
>dbj|AK058774.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-002-A07, full insert sequence Length = 591 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 65 tttccgatctcaatgcatttcaccgctc 38
>emb|AJ239003.1|TAE239003 Triticum aestivum (L.) partial chloroplast 16S rRNA gene Length = 1482 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 652 tttccgatctcaatgcatttcaccgctc 625
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 19946155 tttccgatctcaatgcatttcaccgctc 19946128 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 10389797 tttccgatctcaatgcatttcaccgctc 10389770 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 10286583 tttccgatctcaatgcatttcaccgctc 10286610
>emb|AJ555400.1|TTU555400 Triticum turgidum subsp. dicoccum partial chloroplast 16S rRNA gene Length = 1483 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 653 tttccgatctcaatgcatttcaccgctc 626
>emb|AJ555402.1|ATA555402 Aegilops tauschii partial chloroplast 16S rRNA gene Length = 1483 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 653 tttccgatctcaatgcatttcaccgctc 626
>emb|AJ555401.1|ASP555401 Aegilops speltoides partial chloroplast 16S rRNA gene Length = 1483 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 653 tttccgatctcaatgcatttcaccgctc 626
>emb|AM159498.1| Uncultured bacterium 16S rRNA gene, clone RB90b-72 Length = 997 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 647 tttccgatctcaatgcatttcaccgctc 620
>emb|AM159495.1| Uncultured bacterium 16S rRNA gene, clone RB90b-49 Length = 1008 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 658 tttccgatctcaatgcatttcaccgctc 631
>emb|AM159480.1| Uncultured bacterium 16S rRNA gene, clone RB90b-43 Length = 1095 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 753 tttccgatctcaatgcatttcaccgctc 726
>emb|AM159434.1| Uncultured bacterium 16S rRNA gene, clone RB45-28 Length = 995 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 647 tttccgatctcaatgcatttcaccgctc 620
>emb|AM159431.1| Uncultured bacterium 16S rRNA gene, clone RB45-25e Length = 984 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 650 tttccgatctcaatgcatttcaccgctc 623
>emb|AM159430.1| Uncultured bacterium 16S rRNA gene, clone RB45-24e Length = 991 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 649 tttccgatctcaatgcatttcaccgctc 622
>emb|AM159428.1| Uncultured bacterium 16S rRNA gene, clone RB45-22e Length = 997 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 651 tttccgatctcaatgcatttcaccgctc 624
>emb|AM159403.1| Uncultured bacterium 16S rRNA gene, clone RB45-20 Length = 993 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 647 tttccgatctcaatgcatttcaccgctc 620
>dbj|AP006714.1| Saccharum officinarum chloroplast DNA, complete genome Length = 141182 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 127702 tttccgatctcaatgcatttcaccgctc 127729 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 96529 tttccgatctcaatgcatttcaccgctc 96502
>dbj|AP006728.1| Oryza nivara chloroplast DNA, complete genome Length = 134494 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 123132 tttccgatctcaatgcatttcaccgctc 123159 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 91907 tttccgatctcaatgcatttcaccgctc 91880
>dbj|AB042240.3| Triticum aestivum chloroplast DNA, complete genome Length = 134545 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 123182 tttccgatctcaatgcatttcaccgctc 123209 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 91712 tttccgatctcaatgcatttcaccgctc 91685
>emb|AJ431195.1|ZMA431195 Zea mays partial 16S rRNA gene, clone 1_42 Length = 371 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 177 tttccgatctcaatgcatttcaccgctc 150
>emb|AM039608.1| Pinus taeda partial 16S rRNA gene, clone 3A Length = 566 Score = 48.1 bits (24), Expect = 0.015 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||||||||||||||||||||| ||||| Sbjct: 352 tttccgatctcaatgcatttcaccgctc 325
>gb|AE014827.1| Plasmodium falciparum 3D7 chromosome 14 section 12 of 13 of the complete sequence Length = 254436 Score = 46.1 bits (23), Expect = 0.060 Identities = 23/23 (100%) Strand = Plus / Plus Query: 187 gaatatataataagataacaaaa 209 ||||||||||||||||||||||| Sbjct: 228108 gaatatataataagataacaaaa 228130
>dbj|AP004121.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1442_E05 Length = 162407 Score = 46.1 bits (23), Expect = 0.060 Identities = 26/27 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgct 102 |||||||||||||||||||||| |||| Sbjct: 20775 tttccgatctcaatgcatttcaccgct 20801
>dbj|AP004867.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0036E06 Length = 137926 Score = 46.1 bits (23), Expect = 0.060 Identities = 26/27 (96%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttcatcgct 102 |||||||||||||||||||||| |||| Sbjct: 89698 tttccgatctcaatgcatttcaccgct 89724
>gb|AC141644.6| Mus musculus BAC clone RP23-115F21 from chromosome 6, complete sequence Length = 187643 Score = 46.1 bits (23), Expect = 0.060 Identities = 23/23 (100%) Strand = Plus / Plus Query: 186 tgaatatataataagataacaaa 208 ||||||||||||||||||||||| Sbjct: 72174 tgaatatataataagataacaaa 72196
>ref|XM_469143.1| Oryza sativa (japonica cultivar-group), mRNA Length = 456 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttca 97 |||||||||||||||||||||| Sbjct: 62 tttccgatctcaatgcatttca 41
>gb|AC131079.11| Mus musculus chromosome 14, clone RP23-434L17, complete sequence Length = 203276 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 192 tataataagataacaaaagaat 213 |||||||||||||||||||||| Sbjct: 119342 tataataagataacaaaagaat 119321
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttca 97 |||||||||||||||||||||| Sbjct: 25722670 tttccgatctcaatgcatttca 25722649
>gb|AC137991.3| Oryza sativa chromosome 3 BAC OSJNBa0034D21 genomic sequence, complete sequence Length = 190834 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 76 tttccgatctcaatgcatttca 97 |||||||||||||||||||||| Sbjct: 122226 tttccgatctcaatgcatttca 122247
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttca 97 |||||||||||||||||||||| Sbjct: 25813979 tttccgatctcaatgcatttca 25813958
>dbj|AK110704.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-C05, full insert sequence Length = 694 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttca 97 |||||||||||||||||||||| Sbjct: 22 tttccgatctcaatgcatttca 1
>gb|U35602.1|UEU35602 Unidentified embryophyte clone 94R6 from Wisconsin agricultural soil, chloroplast gene encoding chlorplast protein, 16S ribosomal RNA gene, partial sequence Length = 305 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttc 96 ||||||||||||||||||||| Sbjct: 189 tttccgatctcaatgcatttc 169
>gb|AY952420.1| Asarum caudigerum tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast Length = 2613 Score = 42.1 bits (21), Expect = 0.93 Identities = 24/25 (96%) Strand = Plus / Minus Query: 189 atatataataagataacaaaagaat 213 |||||||||||||||| |||||||| Sbjct: 694 atatataataagataagaaaagaat 670
>gb|AE014846.1| Plasmodium falciparum 3D7 chromosome 12, section 3 of 9 of the complete sequence Length = 253132 Score = 42.1 bits (21), Expect = 0.93 Identities = 24/25 (96%) Strand = Plus / Minus Query: 188 aatatataataagataacaaaagaa 212 ||||||||||||||||| ||||||| Sbjct: 70926 aatatataataagataataaaagaa 70902
>ref|XM_452594.1| Kluyveromyces lactis NRRL Y-1140, KLLA0C08866g predicted mRNA Length = 1935 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 gacagacgtgatatgaatat 192 |||||||||||||||||||| Sbjct: 61 gacagacgtgatatgaatat 80
>gb|AY387369.1| Uncultured eukaryote clone OT124 16S ribosomal RNA gene, partial sequence Length = 1056 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 654 tttccgatctcaacgcatttcaccgctc 627
>gb|AY795633.2| Uncultured Oscillatoriales cyanobacterium clone Veg.-frei_9_29.07 16S ribosomal RNA gene, partial sequence Length = 646 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 632 tttccgatctcaacgcatttcaccgctc 605
>emb|AM086239.1| Pinus thunbergii plastid 16S rRNA gene, isolate 20 0D6 Length = 924 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 575 tttccgatctcaacgcatttcaccgctc 548
>emb|AJ889116.1| Uncultured cyanobacterium partial 16S rRNA gene, isolate DGGE band C Length = 370 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 297 tttccgatctcaacgcatttcaccgctc 270
>emb|CR382123.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome C of strain NRRL Y-1140 of Kluyveromyces lactis Length = 1753957 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 173 gacagacgtgatatgaatat 192 |||||||||||||||||||| Sbjct: 773593 gacagacgtgatatgaatat 773574
>emb|BX530077.4| Zebrafish DNA sequence from clone CH211-22D5 in linkage group 21, complete sequence Length = 200625 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 173 gacagacgtgatatgaatatataa 196 ||||||||||||||||| |||||| Sbjct: 20025 gacagacgtgatatgaaaatataa 20002
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||| ||||||||||||||||| ||||| Sbjct: 19234574 tttctgatctcaatgcatttcaccgctc 19234547
>gb|AY228468.1| Pinus Koraiensis chloroplast, complete genome Length = 116866 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 82911 tttccgatctcaacgcatttcaccgctc 82884
>gb|DQ004284.1| Uncultured cyanobacterium clone AEN23 16S ribosomal RNA gene, partial sequence Length = 528 Score = 40.1 bits (20), Expect = 3.7 Identities = 29/32 (90%) Strand = Plus / Minus Query: 72 gttttttccgatctcaatgcatttcatcgctc 103 ||||||||||||||| | |||||||| ||||| Sbjct: 321 gttttttccgatctctacgcatttcaccgctc 290
>gb|AC008171.3| Homo sapiens BAC clone RP11-326D7 from 2, complete sequence Length = 127646 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 24 atatatacttatcacataac 43 |||||||||||||||||||| Sbjct: 85076 atatatacttatcacataac 85057
>gb|AF393602.1| Mesotaenium caldariorum small subunit ribosomal RNA (rrs) gene, partial sequence; chloroplast gene for chloroplast product Length = 1461 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 637 tttccgatctcaacgcatttcaccgctc 610
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||| ||||||||||||||||| ||||| Sbjct: 19160801 tttctgatctcaatgcatttcaccgctc 19160774
>emb|AL731751.4|CNS08C80 Oryza sativa chromosome 12, . BAC OJ1510_A06 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 136155 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 |||| ||||||||||||||||| ||||| Sbjct: 67904 tttctgatctcaatgcatttcaccgctc 67877
>gb|U47845.1|CRU47845 Cytinus ruber 16S ribosomal RNA gene, chloroplast gene for chloroplast RNA, partial sequence Length = 1418 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||| |||||||| ||||||| Sbjct: 626 tttccgatctctatgcattttatcgctc 599
>emb|AJ867654.1| Uncultured phototrophic eukaryote partial 16S rRNA gene, clone RS 8-Bact63 Length = 1442 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 634 tttccgatctcaacgcatttcaccgctc 607
>emb|AJ867653.1| Uncultured phototrophic eukaryote partial 16S rRNA gene, clone RS 8-Bact62 Length = 1448 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 634 tttccgatctcaacgcatttcaccgctc 607
>emb|AJ867652.1| Uncultured phototrophic eukaryote partial 16S rRNA gene, clone RS 8-Bact35 Length = 1441 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 632 tttccgatctcaacgcatttcaccgctc 605
>emb|AJ867651.1| Uncultured phototrophic eukaryote partial 16S rRNA gene, clone RS 8-Bact33 Length = 1476 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 667 tttccgatctcaacgcatttcaccgctc 640
>emb|AJ867649.1| Uncultured phototrophic eukaryote partial 16S rRNA gene, clone RS 8-Bact22 Length = 1416 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 747 tttccgatctcaacgcatttcaccgctc 720
>emb|AJ867648.1| Uncultured phototrophic eukaryote partial 16S rRNA gene, clone RS 8-Bact02 Length = 1503 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 682 tttccgatctcaacgcatttcaccgctc 655
>emb|AM039622.1| Pinus taeda partial 16S rRNA gene, clone 87A Length = 566 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 352 tttccgatctcaacgcatttcaccgctc 325
>emb|AM039621.1| Pinus taeda partial 16S rRNA gene, clone 73A Length = 566 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 352 tttccgatctcaacgcatttcaccgctc 325
>emb|AM039620.1| Pinus taeda partial 16S rRNA gene, clone 67A Length = 566 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 352 tttccgatctcaacgcatttcaccgctc 325
>emb|AM039619.1| Pinus taeda partial 16S rRNA gene, clone 63A Length = 556 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 352 tttccgatctcaacgcatttcaccgctc 325
>emb|AM039618.1| Pinus taeda partial 16S rRNA gene, clone 61S Length = 566 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 352 tttccgatctcaacgcatttcaccgctc 325
>emb|AM039617.1| Pinus taeda partial 16S rRNA gene, clone 55A Length = 566 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 352 tttccgatctcaacgcatttcaccgctc 325
>emb|AM039616.1| Pinus taeda partial 16S rRNA gene, clone 54A Length = 566 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 352 tttccgatctcaacgcatttcaccgctc 325
>emb|AM039615.1| Pinus taeda partial 16S rRNA gene, clone 45A Length = 566 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 352 tttccgatctcaacgcatttcaccgctc 325
>emb|AM039614.1| Pinus taeda partial 16S rRNA gene, clone 47A Length = 566 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 352 tttccgatctcaacgcatttcaccgctc 325
>emb|AM039613.1| Pinus taeda partial 16S rRNA gene, clone 44A Length = 566 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 352 tttccgatctcaacgcatttcaccgctc 325
>emb|AM039612.1| Pinus taeda partial 16S rRNA gene, clone 41A Length = 566 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 352 tttccgatctcaacgcatttcaccgctc 325
>emb|AM039611.1| Pinus taeda partial 16S rRNA gene, clone 31A Length = 566 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 352 tttccgatctcaacgcatttcaccgctc 325
>emb|AM039610.1| Pinus taeda partial 16S rRNA gene, clone 29A Length = 566 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 352 tttccgatctcaacgcatttcaccgctc 325
>dbj|D17510.1|PINCPTRPG Pinus thunbergii chloroplast DNA, complete sequence Length = 119707 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 76 tttccgatctcaatgcatttcatcgctc 103 ||||||||||||| |||||||| ||||| Sbjct: 85000 tttccgatctcaacgcatttcaccgctc 84973 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,993,466 Number of Sequences: 3902068 Number of extensions: 1993466 Number of successful extensions: 39881 Number of sequences better than 10.0: 114 Number of HSP's better than 10.0 without gapping: 118 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 39507 Number of HSP's gapped (non-prelim): 375 length of query: 283 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 261 effective length of database: 17,147,199,772 effective search space: 4475419140492 effective search space used: 4475419140492 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)