ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbast55e02 |
|---|---|
| Clone Library Name | barley_pub |
>gb|M36658.1|MZEH3A Corn histone H3 (H3C3) gene, complete cds Length = 1177 Score = 167 bits (84), Expect = 3e-38 Identities = 90/92 (97%) Strand = Plus / Minus Query: 232 ccgcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatgg 291 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 960 ccgcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatgg 901 Query: 292 tgacgcgcttggcgtgaatggcgcaaaggttg 323 |||||||||||||||| |||||||| |||||| Sbjct: 900 tgacgcgcttggcgtggatggcgcagaggttg 869
>gb|M34928.1|BLYHISH3PA Barley histone H3 mRNA, 3' end Length = 505 Score = 157 bits (79), Expect = 3e-35 Identities = 85/87 (97%) Strand = Plus / Minus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 242 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 183 Query: 297 cgcttggcgtgaatggcgcaaaggttg 323 ||||||||||| |||||||| |||||| Sbjct: 182 cgcttggcgtggatggcgcacaggttg 156 Score = 63.9 bits (32), Expect = 3e-07 Identities = 69/81 (85%), Gaps = 4/81 (4%) Strand = Plus / Minus Query: 51 catcgataatggtcgatcaacagtacattaaccaacaatt----ccacagaaagcatttg 106 |||||||||| ||| ||||||| ||||||||||||||||| ||||| |||||| | Sbjct: 480 catcgataattgtcaatcaacactacattaaccaacaatttgcatcacagtaagcatcgg 421 Query: 107 tttgcatcaccgcaaaccaaa 127 |||||| |||||||||||||| Sbjct: 420 tttgcaacaccgcaaaccaaa 400
>ref|XM_425464.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1 (LOC427890), mRNA Length = 600 Score = 155 bits (78), Expect = 1e-34 Identities = 84/86 (97%) Strand = Plus / Minus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 598 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 539 Query: 298 gcttggcgtgaatggcgcaaaggttg 323 |||||||||| |||||||| |||||| Sbjct: 538 gcttggcgtggatggcgcacaggttg 513
>ref|XM_416198.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417958), mRNA Length = 1512 Score = 155 bits (78), Expect = 1e-34 Identities = 84/86 (97%) Strand = Plus / Plus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 570 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 629 Query: 298 gcttggcgtgaatggcgcaaaggttg 323 |||||||||| |||||||| |||||| Sbjct: 630 gcttggcgtggatggcgcacaggttg 655
>ref|XM_416190.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417949), mRNA Length = 752 Score = 155 bits (78), Expect = 1e-34 Identities = 84/86 (97%) Strand = Plus / Plus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 315 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 374 Query: 298 gcttggcgtgaatggcgcaaaggttg 323 |||||||||| |||||||| |||||| Sbjct: 375 gcttggcgtggatggcgcacaggttg 400
>ref|XM_416186.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417945), mRNA Length = 972 Score = 155 bits (78), Expect = 1e-34 Identities = 84/86 (97%) Strand = Plus / Plus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 378 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 437 Query: 298 gcttggcgtgaatggcgcaaaggttg 323 |||||||||| |||||||| |||||| Sbjct: 438 gcttggcgtggatggcgcacaggttg 463
>emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes Length = 4717 Score = 155 bits (78), Expect = 1e-34 Identities = 84/86 (97%) Strand = Plus / Minus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3244 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 3185 Query: 298 gcttggcgtgaatggcgcaaaggttg 323 |||||||||| |||||||| |||||| Sbjct: 3184 gcttggcgtggatggcgcacaggttg 3159 Score = 155 bits (78), Expect = 1e-34 Identities = 84/86 (97%) Strand = Plus / Plus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1477 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 1536 Query: 298 gcttggcgtgaatggcgcaaaggttg 323 |||||||||| |||||||| |||||| Sbjct: 1537 gcttggcgtggatggcgcacaggttg 1562
>dbj|AB205017.1| Lolium multiflorum gene for replacement histone H3, exon 1-2, complete cds Length = 784 Score = 155 bits (78), Expect = 1e-34 Identities = 87/90 (96%) Strand = Plus / Minus Query: 234 gcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 293 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 577 gcctaggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 518 Query: 294 acgcgcttggcgtgaatggcgcaaaggttg 323 |||||||||||||| |||||||| |||||| Sbjct: 517 acgcgcttggcgtggatggcgcagaggttg 488
>gb|U37579.1|GGU37579 Gallus gallus histone H3-VIII gene, complete cds Length = 1809 Score = 155 bits (78), Expect = 1e-34 Identities = 84/86 (97%) Strand = Plus / Minus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 880 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 821 Query: 298 gcttggcgtgaatggcgcaaaggttg 323 |||||||||| |||||||| |||||| Sbjct: 820 gcttggcgtggatggcgcacaggttg 795
>gb|U37578.1|GGU37578 Gallus gallus histone H3-VII gene, complete cds Length = 1204 Score = 155 bits (78), Expect = 1e-34 Identities = 84/86 (97%) Strand = Plus / Minus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 897 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 838 Query: 298 gcttggcgtgaatggcgcaaaggttg 323 |||||||||| |||||||| |||||| Sbjct: 837 gcttggcgtggatggcgcacaggttg 812
>gb|U37577.1|GGU37577 Gallus gallus histone H3-VI gene, complete cds Length = 1271 Score = 155 bits (78), Expect = 1e-34 Identities = 84/86 (97%) Strand = Plus / Minus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 693 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 634 Query: 298 gcttggcgtgaatggcgcaaaggttg 323 |||||||||| |||||||| |||||| Sbjct: 633 gcttggcgtggatggcgcacaggttg 608
>gb|M61155.1|CHKH3AB Chicken histone H3 gene, complete cds Length = 1017 Score = 155 bits (78), Expect = 1e-34 Identities = 84/86 (97%) Strand = Plus / Minus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 569 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 510 Query: 298 gcttggcgtgaatggcgcaaaggttg 323 |||||||||| |||||||| |||||| Sbjct: 509 gcttggcgtgcatggcgcacaggttg 484
>gb|BT017805.1| Zea mays clone EL01N0506E02.c mRNA sequence Length = 638 Score = 149 bits (75), Expect = 6e-33 Identities = 87/91 (95%) Strand = Plus / Minus Query: 233 cgcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 292 |||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 356 cgcctaagcgcgctccccgcggatgcggcgggcgagctgaatgtccttgggcatgatggt 297 Query: 293 gacgcgcttggcgtgaatggcgcaaaggttg 323 ||||||||||||||| |||||||| |||||| Sbjct: 296 gacgcgcttggcgtggatggcgcagaggttg 266
>emb|X79714.1|LTMRHIS3 L.temulentum mRNA for histone H3 Length = 657 Score = 149 bits (75), Expect = 6e-33 Identities = 84/87 (96%) Strand = Plus / Minus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 461 taggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 402 Query: 297 cgcttggcgtgaatggcgcaaaggttg 323 ||||||||||| |||||||| |||||| Sbjct: 401 cgcttggcgtggatggcgcacaggttg 375
>emb|CR390239.1| Gallus gallus finished cDNA, clone ChEST932d15 Length = 578 Score = 147 bits (74), Expect = 3e-32 Identities = 83/86 (96%) Strand = Plus / Plus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 134 aggcacgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 193 Query: 298 gcttggcgtgaatggcgcaaaggttg 323 |||||||||| |||||||| |||||| Sbjct: 194 gcttggcgtggatggcgcacaggttg 219
>emb|X62291.1|GGHISH3IV G.gallus gene for histone H3-IV Length = 1094 Score = 147 bits (74), Expect = 3e-32 Identities = 83/86 (96%) Strand = Plus / Minus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 823 aggcacgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 764 Query: 298 gcttggcgtgaatggcgcaaaggttg 323 |||||||||| |||||||| |||||| Sbjct: 763 gcttggcgtggatggcgcacaggttg 738
>emb|X62292.1|GGHISH3V G.gallus gene for histone H3-V Length = 1107 Score = 147 bits (74), Expect = 3e-32 Identities = 83/86 (96%) Strand = Plus / Minus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 823 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 764 Query: 298 gcttggcgtgaatggcgcaaaggttg 323 ||||||| || |||||||| |||||| Sbjct: 763 gcttggcatggatggcgcacaggttg 738
>gb|M61154.1|CHKH3AA Chicken histone H3 gene, complete cds Length = 784 Score = 147 bits (74), Expect = 3e-32 Identities = 83/86 (96%) Strand = Plus / Minus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 762 aggcacgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 703 Query: 298 gcttggcgtgaatggcgcaaaggttg 323 |||||||||| |||||||| |||||| Sbjct: 702 gcttggcgtggatggcgcacaggttg 677
>ref|NM_185612.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 411 Score = 145 bits (73), Expect = 1e-31 Identities = 82/85 (96%) Strand = Plus / Minus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 409 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 350 Query: 298 gcttggcgtgaatggcgcaaaggtt 322 |||||||||| |||||||| ||||| Sbjct: 349 gcttggcgtggatggcgcacaggtt 325
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 145 bits (73), Expect = 1e-31 Identities = 82/85 (96%) Strand = Plus / Plus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3054206 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 3054265 Query: 298 gcttggcgtgaatggcgcaaaggtt 322 |||||||||| |||||||| ||||| Sbjct: 3054266 gcttggcgtggatggcgcacaggtt 3054290 Score = 143 bits (72), Expect = 4e-31 Identities = 81/84 (96%) Strand = Plus / Plus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1644700 gcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 1644759 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 1644760 ttggcgtggatggcgcagaggttg 1644783 Score = 131 bits (66), Expect = 2e-27 Identities = 84/90 (93%) Strand = Plus / Minus Query: 234 gcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 293 ||||| |||||||| |||||||| ||||| |||||||||||||||||||||||||||||| Sbjct: 3055575 gcctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtg 3055516 Query: 294 acgcgcttggcgtgaatggcgcaaaggttg 323 |||||||||||||| |||||||| |||||| Sbjct: 3055515 acgcgcttggcgtggatggcgcacaggttg 3055486 Score = 131 bits (66), Expect = 2e-27 Identities = 81/86 (94%) Strand = Plus / Plus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||| Sbjct: 3045559 aggcgcgctcaccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgc 3045618 Query: 298 gcttggcgtgaatggcgcaaaggttg 323 |||||||||| |||||||| |||||| Sbjct: 3045619 gcttggcgtggatggcgcacaggttg 3045644 Score = 125 bits (63), Expect = 9e-26 Identities = 84/91 (92%) Strand = Plus / Plus Query: 233 cgcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 292 |||||| |||||||| |||||||| ||||| ||||||||||||||||||||||||||||| Sbjct: 3039524 cgcctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggt 3039583 Query: 293 gacgcgcttggcgtgaatggcgcaaaggttg 323 ||||||||||||||| ||||| || |||||| Sbjct: 3039584 gacgcgcttggcgtggatggcacacaggttg 3039614
>dbj|AP005828.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0702F05 Length = 145018 Score = 145 bits (73), Expect = 1e-31 Identities = 82/85 (96%) Strand = Plus / Plus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 142155 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 142214 Query: 298 gcttggcgtgaatggcgcaaaggtt 322 |||||||||| |||||||| ||||| Sbjct: 142215 gcttggcgtggatggcgcacaggtt 142239 Score = 131 bits (66), Expect = 2e-27 Identities = 84/90 (93%) Strand = Plus / Minus Query: 234 gcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 293 ||||| |||||||| |||||||| ||||| |||||||||||||||||||||||||||||| Sbjct: 143524 gcctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtg 143465 Query: 294 acgcgcttggcgtgaatggcgcaaaggttg 323 |||||||||||||| |||||||| |||||| Sbjct: 143464 acgcgcttggcgtggatggcgcacaggttg 143435 Score = 131 bits (66), Expect = 2e-27 Identities = 81/86 (94%) Strand = Plus / Plus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||| Sbjct: 133508 aggcgcgctcaccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgc 133567 Query: 298 gcttggcgtgaatggcgcaaaggttg 323 |||||||||| |||||||| |||||| Sbjct: 133568 gcttggcgtggatggcgcacaggttg 133593 Score = 125 bits (63), Expect = 9e-26 Identities = 84/91 (92%) Strand = Plus / Plus Query: 233 cgcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 292 |||||| |||||||| |||||||| ||||| ||||||||||||||||||||||||||||| Sbjct: 127473 cgcctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggt 127532 Query: 293 gacgcgcttggcgtgaatggcgcaaaggttg 323 ||||||||||||||| ||||| || |||||| Sbjct: 127533 gacgcgcttggcgtggatggcacacaggttg 127563
>dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, clone:P0681F10 Length = 170371 Score = 145 bits (73), Expect = 1e-31 Identities = 82/85 (96%) Strand = Plus / Plus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 8391 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 8450 Query: 298 gcttggcgtgaatggcgcaaaggtt 322 |||||||||| |||||||| ||||| Sbjct: 8451 gcttggcgtggatggcgcacaggtt 8475 Score = 131 bits (66), Expect = 2e-27 Identities = 84/90 (93%) Strand = Plus / Minus Query: 234 gcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 293 ||||| |||||||| |||||||| ||||| |||||||||||||||||||||||||||||| Sbjct: 9760 gcctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtg 9701 Query: 294 acgcgcttggcgtgaatggcgcaaaggttg 323 |||||||||||||| |||||||| |||||| Sbjct: 9700 acgcgcttggcgtggatggcgcacaggttg 9671
>gb|U25664.1|OSU25664 Oryza sativa histone H3 gene, complete cds Length = 711 Score = 145 bits (73), Expect = 1e-31 Identities = 82/85 (96%) Strand = Plus / Minus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 639 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 580 Query: 298 gcttggcgtgaatggcgcaaaggtt 322 |||||||||| |||||||| ||||| Sbjct: 579 gcttggcgtggatggcgcacaggtt 555
>gb|M15664.1|RICHIS3 Rice histone 3 gene, complete cds Length = 568 Score = 145 bits (73), Expect = 1e-31 Identities = 82/85 (96%) Strand = Plus / Minus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 546 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 487 Query: 298 gcttggcgtgaatggcgcaaaggtt 322 |||||||||| |||||||| ||||| Sbjct: 486 gcttggcgtggatggcgcacaggtt 462
>ref|XM_493701.1| Oryza sativa (japonica cultivar-group), mRNA Length = 411 Score = 143 bits (72), Expect = 4e-31 Identities = 81/84 (96%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 407 gcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 348 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 347 ttggcgtggatggcgcagaggttg 324
>gb|AC134048.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0076K20, complete sequence Length = 127338 Score = 143 bits (72), Expect = 4e-31 Identities = 81/84 (96%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 118174 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 118115 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 118114 ttggcgtggatggcgcagaggttg 118091
>gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0030I09 map C83B, complete sequence Length = 123477 Score = 143 bits (72), Expect = 4e-31 Identities = 81/84 (96%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 13780 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 13721 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 13720 ttggcgtggatggcgcagaggttg 13697
>ref|XM_845651.1| PREDICTED: Canis familiaris similar to CG31613-PA (LOC608586), mRNA Length = 411 Score = 143 bits (72), Expect = 4e-31 Identities = 84/88 (95%) Strand = Plus / Minus Query: 236 ctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 295 ||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| Sbjct: 411 ctaggcgcgctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 352 Query: 296 gcgcttggcgtgaatggcgcaaaggttg 323 |||||||||||| |||||||| |||||| Sbjct: 351 gcgcttggcgtggatggcgcacaggttg 324
>emb|X13680.1|OSHIS321 Oryza sativa H3 histone H3R-21 clone RH3-2 Length = 1200 Score = 143 bits (72), Expect = 4e-31 Identities = 81/84 (96%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 807 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 748 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 747 ttggcgtggatggcgcagaggttg 724
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 143 bits (72), Expect = 4e-31 Identities = 81/84 (96%) Strand = Plus / Plus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2608624 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 2608683 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 2608684 ttggcgtggatggcgcagaggttg 2608707
>dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, clone:P0493C11 Length = 143113 Score = 143 bits (72), Expect = 4e-31 Identities = 81/84 (96%) Strand = Plus / Plus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 47871 gcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 47930 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 47931 ttggcgtggatggcgcagaggttg 47954
>gb|AF093633.1|AF093633 Oryza sativa histone H3 mRNA, complete cds Length = 793 Score = 143 bits (72), Expect = 4e-31 Identities = 81/84 (96%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 495 gcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 436 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 435 ttggcgtggatggcgcagaggttg 412
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 143 bits (72), Expect = 4e-31 Identities = 81/84 (96%) Strand = Plus / Plus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2617655 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 2617714 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 2617715 ttggcgtggatggcgcagaggttg 2617738
>gb|U77296.1|OSU77296 Oryza sativa histone 3 mRNA, complete cds Length = 642 Score = 143 bits (72), Expect = 4e-31 Identities = 81/84 (96%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 478 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 419 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 418 ttggcgtggatggcgcagaggttg 395
>gb|BT017332.1| Zea mays clone EL01N0320H03.c mRNA sequence Length = 639 Score = 141 bits (71), Expect = 2e-30 Identities = 86/91 (94%) Strand = Plus / Minus Query: 233 cgcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 292 |||||| |||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 413 cgcctacgcgcgctcgccgcggatgcggcgggcgagctggatgtctttgggcatgatggt 354 Query: 293 gacgcgcttggcgtgaatggcgcaaaggttg 323 ||||||||||||||| |||||||| |||||| Sbjct: 353 gacgcgcttggcgtggatggcgcagaggttg 323
>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1 (LOC417953), mRNA Length = 2271 Score = 141 bits (71), Expect = 2e-30 Identities = 77/79 (97%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2262 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 2203 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 2202 gtggatggcgcacaggttg 2184
>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene Length = 8384 Score = 141 bits (71), Expect = 2e-30 Identities = 77/79 (97%) Strand = Plus / Plus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3353 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 3412 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 3413 gtggatggcgcacaggttg 3431
>emb|Y08528.1|OSHISTON3 Oryza sativa mRNA for histone 3 Length = 529 Score = 135 bits (68), Expect = 1e-28 Identities = 80/84 (95%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 479 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggagacgcgc 420 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 419 ttggcgtggatggcgcagaggttg 396
>ref|XM_599846.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted) (LOC521581), mRNA Length = 411 Score = 133 bits (67), Expect = 4e-28 Identities = 76/79 (96%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 402 ctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggc 343 Query: 305 gtgaatggcgcaaaggttg 323 ||| ||||| ||||||||| Sbjct: 342 gtggatggcacaaaggttg 324
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 133 bits (67), Expect = 4e-28 Identities = 85/91 (93%) Strand = Plus / Minus Query: 233 cgcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 292 ||||||||| | ||| || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 37507569 cgcctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggt 37507510 Query: 293 gacgcgcttggcgtgaatggcgcaaaggttg 323 ||||||||||||||| |||||||| |||||| Sbjct: 37507509 gacgcgcttggcgtggatggcgcagaggttg 37507479 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 250 cgcggatgcggcgggcgagct 270 ||||||||||||||||||||| Sbjct: 9911750 cgcggatgcggcgggcgagct 9911730
>dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0505D12 Length = 146951 Score = 133 bits (67), Expect = 4e-28 Identities = 85/91 (93%) Strand = Plus / Minus Query: 233 cgcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 292 ||||||||| | ||| || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 102106 cgcctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggt 102047 Query: 293 gacgcgcttggcgtgaatggcgcaaaggttg 323 ||||||||||||||| |||||||| |||||| Sbjct: 102046 gacgcgcttggcgtggatggcgcagaggttg 102016
>emb|X85102.1|OSRNAHIS3 O.sativa mRNA for histone H3 Length = 274 Score = 133 bits (67), Expect = 4e-28 Identities = 84/90 (93%) Strand = Plus / Minus Query: 234 gcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 293 ||||| ||| |||| |||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 101 gcctaagcgngctcgccgcggatccggcgggcgagctggatgtccttgggcatgatggtg 42 Query: 294 acgcgcttggcgtgaatggcgcaaaggttg 323 |||||||||||||| |||||||| |||||| Sbjct: 41 acgcgcttggcgtggatggcgcacaggttg 12
>dbj|AK108078.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-138-E03, full insert sequence Length = 1296 Score = 133 bits (67), Expect = 4e-28 Identities = 85/91 (93%) Strand = Plus / Minus Query: 233 cgcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 292 ||||||||| | ||| || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 492 cgcctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggt 433 Query: 293 gacgcgcttggcgtgaatggcgcaaaggttg 323 ||||||||||||||| |||||||| |||||| Sbjct: 432 gacgcgcttggcgtggatggcgcagaggttg 402
>ref|NM_185609.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 432 Score = 131 bits (66), Expect = 2e-27 Identities = 81/86 (94%) Strand = Plus / Minus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||| Sbjct: 430 aggcgcgctcaccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgc 371 Query: 298 gcttggcgtgaatggcgcaaaggttg 323 |||||||||| |||||||| |||||| Sbjct: 370 gcttggcgtggatggcgcacaggttg 345
>emb|X00937.1|TAHI02 Wheat histone H3 gene Length = 811 Score = 131 bits (66), Expect = 2e-27 Identities = 84/90 (93%) Strand = Plus / Minus Query: 234 gcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 293 |||||||| | ||| || |||||||||||||||||||||||||||||||||||||||||| Sbjct: 660 gcctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtg 601 Query: 294 acgcgcttggcgtgaatggcgcaaaggttg 323 |||||||||||||| |||||||| |||||| Sbjct: 600 acgcgcttggcgtggatggcgcagaggttg 571
>emb|CR541858.1| Homo sapiens full open reading frame cDNA clone RZPDo834H0632D for gene HIST1H3A, histone 1, H3a; complete cds, incl. stopcodon Length = 411 Score = 131 bits (66), Expect = 2e-27 Identities = 75/78 (96%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 402 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggc 343 Query: 305 gtgaatggcgcaaaggtt 322 ||| |||||||| ||||| Sbjct: 342 gtggatggcgcacaggtt 325
>emb|X13679.1|OSHIS3PS Oryza sativa H3 histone pseudogene H3R-12 Length = 1920 Score = 131 bits (66), Expect = 2e-27 Identities = 81/86 (94%) Strand = Plus / Minus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 |||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||| Sbjct: 1529 aggcgcgctcaccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgc 1470 Query: 298 gcttggcgtgaatggcgcaaaggttg 323 |||||||||| |||||||| |||||| Sbjct: 1469 gcttggcgtggatggcgcacaggttg 1444
>gb|M14396.1|CIIHISH3A Duck H3.4 variant histone gene Length = 921 Score = 131 bits (66), Expect = 2e-27 Identities = 81/86 (94%) Strand = Plus / Minus Query: 238 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 297 ||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| Sbjct: 749 aggcgcgctccccgcggatgcggcgggtgagctggatgtccttgggcatgatggagacgc 690 Query: 298 gcttggcgtgaatggcgcaaaggttg 323 ||||||| || |||||||| |||||| Sbjct: 689 gcttggcatggatggcgcagaggttg 664
>emb|Z46261.1|HSHISH3A H.sapiens DNA for histone H3a Length = 969 Score = 131 bits (66), Expect = 2e-27 Identities = 75/78 (96%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 709 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggc 650 Query: 305 gtgaatggcgcaaaggtt 322 ||| |||||||| ||||| Sbjct: 649 gtggatggcgcacaggtt 632
>ref|XM_540290.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform 2 (LOC483172), mRNA Length = 525 Score = 129 bits (65), Expect = 6e-27 Identities = 77/81 (95%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 |||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| Sbjct: 518 cgctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttg 459 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 458 gcgtggatggcgcacaggttg 438
>ref|XM_540285.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform 2 (LOC483167), mRNA Length = 525 Score = 129 bits (65), Expect = 6e-27 Identities = 77/81 (95%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 |||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| Sbjct: 518 cgctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttg 459 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 458 gcgtggatggcgcacaggttg 438
>gb|AC151366.3| Aotus nancymaae clone CH258-105B22, complete sequence Length = 188026 Score = 127 bits (64), Expect = 2e-26 Identities = 82/88 (93%) Strand = Plus / Plus Query: 235 cctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 294 ||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| || | Sbjct: 183192 cctaggcccgctccccgcggatgcggcgggccagctggatgtccttgggcatgatagtca 183251 Query: 295 cgcgcttggcgtgaatggcgcaaaggtt 322 ||||||||||||| |||||||| ||||| Sbjct: 183252 cgcgcttggcgtggatggcgcacaggtt 183279
>ref|NM_185613.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 411 Score = 127 bits (64), Expect = 2e-26 Identities = 79/84 (94%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||||| Sbjct: 407 gcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 348 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 347 ttggcgtggatggcgcacaggttg 324
>ref|XM_475315.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 411 Score = 127 bits (64), Expect = 2e-26 Identities = 70/72 (97%) Strand = Plus / Minus Query: 252 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgaatg 311 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 395 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336 Query: 312 gcgcaaaggttg 323 ||||| |||||| Sbjct: 335 gcgcagaggttg 324
>ref|XM_527253.1| PREDICTED: Pan troglodytes similar to histone 1, H3g (LOC471875), mRNA Length = 411 Score = 127 bits (64), Expect = 2e-26 Identities = 76/80 (95%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 404 cgctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttg 345 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 344 gcgtggatggcgcacaggtt 325
>ref|NM_190750.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 411 Score = 127 bits (64), Expect = 2e-26 Identities = 70/72 (97%) Strand = Plus / Minus Query: 252 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgaatg 311 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 395 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336 Query: 312 gcgcaaaggttg 323 ||||| |||||| Sbjct: 335 gcgcagaggttg 324
>gb|BT018950.1| Zea mays clone Contig110.F mRNA sequence Length = 636 Score = 127 bits (64), Expect = 2e-26 Identities = 79/84 (94%) Strand = Plus / Plus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 137 gcgcgctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 196 Query: 300 ttggcgtgaatggcgcaaaggttg 323 || ||||| |||||||| |||||| Sbjct: 197 ttagcgtggatggcgcagaggttg 220
>gb|BT018930.1| Zea mays clone Contig60.F mRNA sequence Length = 887 Score = 127 bits (64), Expect = 2e-26 Identities = 70/72 (97%) Strand = Plus / Plus Query: 252 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgaatg 311 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 238 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 297 Query: 312 gcgcaaaggttg 323 ||||| |||||| Sbjct: 298 gcgcagaggttg 309
>ref|XM_870218.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted) (LOC617888), mRNA Length = 714 Score = 127 bits (64), Expect = 2e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 236 ctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 295 |||||| | ||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 714 ctaggccctctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgac 655 Query: 296 gcgcttggcgtgaatggcgcaaaggttg 323 |||||||||||| ||||| || |||||| Sbjct: 654 gcgcttggcgtggatggcacacaggttg 627
>gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0042J17, complete sequence Length = 124139 Score = 127 bits (64), Expect = 2e-26 Identities = 70/72 (97%) Strand = Plus / Plus Query: 252 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgaatg 311 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 72777 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 72836 Query: 312 gcgcaaaggttg 323 ||||| |||||| Sbjct: 72837 gcgcagaggttg 72848
>emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 and H3.2 Length = 2927 Score = 127 bits (64), Expect = 2e-26 Identities = 79/84 (94%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||||||||||||||| ||||| | ||||||||||||||||||||||||||||||| Sbjct: 2762 gcgcgctccccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacgcgc 2703 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 2702 ttggcgtggatggcgcacaggttg 2679
>gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, complete sequence Length = 211945 Score = 127 bits (64), Expect = 2e-26 Identities = 82/88 (93%) Strand = Plus / Plus Query: 236 ctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 295 |||||| ||||||||||||||||||||||| ||||||||||| ||||||||||||||||| Sbjct: 102348 ctaggctcgctccccgcggatgcggcgggccagctggatgtctttgggcatgatggtgac 102407 Query: 296 gcgcttggcgtgaatggcgcaaaggttg 323 ||||||||||| |||||||| |||||| Sbjct: 102408 ccgcttggcgtggatggcgcacaggttg 102435
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 127 bits (64), Expect = 2e-26 Identities = 70/72 (97%) Strand = Plus / Plus Query: 252 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgaatg 311 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 21355455 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 21355514 Query: 312 gcgcaaaggttg 323 ||||| |||||| Sbjct: 21355515 gcgcagaggttg 21355526
>ref|XM_227461.2| PREDICTED: Rattus norvegicus similar to histone protein Hist2h3c1 (LOC310679), mRNA Length = 573 Score = 127 bits (64), Expect = 2e-26 Identities = 79/84 (94%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||||||||||||||| ||||| | ||||||||||||||||||||||||||||||| Sbjct: 569 gcgcgctccccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacgcgc 510 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 509 ttggcgtggatggcgcacaggttg 486
>dbj|AK120955.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023039F20, full insert sequence Length = 735 Score = 127 bits (64), Expect = 2e-26 Identities = 70/72 (97%) Strand = Plus / Minus Query: 252 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgaatg 311 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 480 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 421 Query: 312 gcgcaaaggttg 323 ||||| |||||| Sbjct: 420 gcgcagaggttg 409
>emb|X84377.1|ZMHIS3DNA Z.mays histone H3 gene Length = 1119 Score = 127 bits (64), Expect = 2e-26 Identities = 70/72 (97%) Strand = Plus / Minus Query: 252 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgaatg 311 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 779 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 720 Query: 312 gcgcaaaggttg 323 ||||| |||||| Sbjct: 719 gcgcagaggttg 708
>ref|NM_175653.1| Mus musculus histone1, H3c (Hist1h3c), mRNA Length = 480 Score = 125 bits (63), Expect = 9e-26 Identities = 72/75 (96%) Strand = Plus / Minus Query: 249 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtga 308 ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 422 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggcgtgg 363 Query: 309 atggcgcaaaggttg 323 |||||||| |||||| Sbjct: 362 atggcgcacaggttg 348
>ref|XM_871261.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted) (LOC618948), mRNA Length = 484 Score = 125 bits (63), Expect = 9e-26 Identities = 75/79 (94%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 402 ctccccgcgaatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggc 343 Query: 305 gtgaatggcgcaaaggttg 323 ||| ||||| ||||||||| Sbjct: 342 gtggatggcacaaaggttg 324
>ref|XM_603864.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted) (LOC525511), mRNA Length = 448 Score = 125 bits (63), Expect = 9e-26 Identities = 75/79 (94%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 402 ctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggc 343 Query: 305 gtgaatggcgcaaaggttg 323 ||| ||||| || |||||| Sbjct: 342 gtggatggcacacaggttg 324
>ref|XM_591827.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted) (LOC540148), mRNA Length = 484 Score = 125 bits (63), Expect = 9e-26 Identities = 75/79 (94%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 402 ctccccgcgaatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggc 343 Query: 305 gtgaatggcgcaaaggttg 323 ||| ||||| ||||||||| Sbjct: 342 gtggatggcacaaaggttg 324
>ref|XM_601510.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted) (LOC523214), mRNA Length = 1459 Score = 125 bits (63), Expect = 9e-26 Identities = 72/75 (96%) Strand = Plus / Minus Query: 249 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtga 308 ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 918 ccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 859 Query: 309 atggcgcaaaggttg 323 ||||| ||||||||| Sbjct: 858 atggcacaaaggttg 844
>ref|NM_178206.2| Mus musculus histone 1, H3h (Hist1h3h), mRNA Length = 488 Score = 125 bits (63), Expect = 9e-26 Identities = 75/79 (94%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 433 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 374 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 373 gtggatggcgcacaggttg 355
>ref|XM_849194.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted) (LOC611519), mRNA Length = 471 Score = 125 bits (63), Expect = 9e-26 Identities = 75/79 (94%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| Sbjct: 462 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 403 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 402 gtggatggcgcagaggttg 384
>ref|XM_545420.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted) (LOC488298), mRNA Length = 411 Score = 125 bits (63), Expect = 9e-26 Identities = 75/79 (94%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 342 gtggatggcgcagaggttg 324
>ref|XM_545399.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted) (LOC488277), mRNA Length = 411 Score = 125 bits (63), Expect = 9e-26 Identities = 75/79 (94%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 342 gtggatggcgcagaggttg 324
>ref|XM_545397.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted) (LOC488275), mRNA Length = 459 Score = 125 bits (63), Expect = 9e-26 Identities = 75/79 (94%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| Sbjct: 450 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 391 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 390 gtggatggcgcagaggttg 372
>ref|XM_848810.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted) (LOC611167), mRNA Length = 504 Score = 125 bits (63), Expect = 9e-26 Identities = 75/79 (94%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| Sbjct: 495 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 436 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 435 gtggatggcgcagaggttg 417
>ref|XM_848782.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted) (LOC611138), mRNA Length = 411 Score = 125 bits (63), Expect = 9e-26 Identities = 75/79 (94%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 342 gtggatggcgcagaggttg 324
>ref|XM_545429.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted) (LOC488307), mRNA Length = 411 Score = 125 bits (63), Expect = 9e-26 Identities = 75/79 (94%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 342 gtggatggcgcagaggttg 324
>ref|XM_545385.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted) (LOC488263), mRNA Length = 411 Score = 125 bits (63), Expect = 9e-26 Identities = 75/79 (94%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 342 gtggatggcgcagaggttg 324
>ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted), transcript variant 3 (LOC480760), mRNA Length = 862 Score = 125 bits (63), Expect = 9e-26 Identities = 75/79 (94%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 342 gtggatggcgcagaggttg 324
>ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted), transcript variant 1 (LOC480760), mRNA Length = 1422 Score = 125 bits (63), Expect = 9e-26 Identities = 75/79 (94%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 342 gtggatggcgcagaggttg 324
>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143 Length = 3210 Score = 125 bits (63), Expect = 9e-26 Identities = 72/75 (96%) Strand = Plus / Minus Query: 249 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtga 308 ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 3032 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggcgtgg 2973 Query: 309 atggcgcaaaggttg 323 |||||||| |||||| Sbjct: 2972 atggcgcacaggttg 2958
>emb|X80325.1|MPMPH315 M.pahari mpH315 gene Length = 974 Score = 125 bits (63), Expect = 9e-26 Identities = 75/79 (94%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 583 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 524 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 523 gtggatggcgcacaggttg 505
>emb|X13678.1|OSHIS311 Oryza sativa H3 histone gene H3R-11 Length = 1200 Score = 125 bits (63), Expect = 9e-26 Identities = 84/91 (92%) Strand = Plus / Minus Query: 233 cgcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 292 |||||| |||||||| |||||||| ||||| ||||||||||||||||||||||||||||| Sbjct: 814 cgcctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggt 755 Query: 293 gacgcgcttggcgtgaatggcgcaaaggttg 323 ||||||||||||||| ||||| || |||||| Sbjct: 754 gacgcgcttggcgtggatggcacacaggttg 724
>emb|X06964.1|VCHIS34A Volvox carteri H3-II and H4-II genes for histones H3 and H4 Length = 1504 Score = 125 bits (63), Expect = 9e-26 Identities = 78/83 (93%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| || |||||||| ||||| ||||||||||||||||||||||||||||||||| Sbjct: 1157 gcgcgctcgccacggatgcgacgggccagctggatgtccttgggcatgatggtgacgcgc 1098 Query: 300 ttggcgtgaatggcgcaaaggtt 322 |||||||| |||||||||||||| Sbjct: 1097 ttggcgtggatggcgcaaaggtt 1075
>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five genes for olfactory receptors, a novel gene, the H1f5 gene for H1 histone family member 5, three genes and one pseudogene for H2a histone family members, four genes for H2b, two genes for H4, and two genes for H3 histone family members and seven CpG islands, complete sequence Length = 222823 Score = 125 bits (63), Expect = 9e-26 Identities = 75/79 (94%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 139050 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 138991 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 138990 gtggatggcgcacaggttg 138972 Score = 109 bits (55), Expect = 6e-21 Identities = 73/79 (92%) Strand = Plus / Plus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 203959 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 204018 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 204019 gtggatggcgcacaggttg 204037
>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the Slc17a1 gene for solute carrier family 17 (vesicular glutamate transporter) member 1, two genes for novel solute carrier family 17 (Slc17) members, two novel genes, the gene for a novel C3HC4 type zinc finger (ring finger) protein, the gene for an H2a, an H2b, two genes for H3 and two genes for H4 histone family members, a H2a histone family pseudogene, the H1f1 and H1f2 genes for H1 histone family members 1 and 2, the H3f2 gene for H3 histone family, member 2 (H3.2), a novel pseudogene, the Hfe gene for hemochromatosis protein (Mr2) and two CpG islands, complete sequence Length = 186062 Score = 125 bits (63), Expect = 9e-26 Identities = 72/75 (96%) Strand = Plus / Minus Query: 249 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtga 308 ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 143278 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggcgtgg 143219 Query: 309 atggcgcaaaggttg 323 |||||||| |||||| Sbjct: 143218 atggcgcacaggttg 143204 Score = 117 bits (59), Expect = 2e-23 Identities = 74/79 (93%) Strand = Plus / Plus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||| || ||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 135597 ctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggc 135656 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 135657 gtggatggcgcacaggttg 135675 Score = 117 bits (59), Expect = 2e-23 Identities = 74/79 (93%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||| Sbjct: 126426 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 126367 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 126366 gtggatggcgcacaggttg 126348
>ref|XM_227460.3| PREDICTED: Rattus norvegicus histone 2, H3c2 (predicted) (Hist2h3c2_predicted), mRNA Length = 411 Score = 125 bits (63), Expect = 9e-26 Identities = 81/87 (93%) Strand = Plus / Minus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||||||||||||||||||||| ||||| | |||||||||||||||||||||||||||| Sbjct: 410 taggcgcgctccccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacg 351 Query: 297 cgcttggcgtgaatggcgcaaaggttg 323 || |||||||| |||||||| |||||| Sbjct: 350 cgtttggcgtggatggcgcacaggttg 324
>gb|AY158950.1| Mus musculus histone protein Hist1h3c gene, complete cds Length = 1408 Score = 125 bits (63), Expect = 9e-26 Identities = 72/75 (96%) Strand = Plus / Minus Query: 249 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtga 308 ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 898 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggcgtgg 839 Query: 309 atggcgcaaaggttg 323 |||||||| |||||| Sbjct: 838 atggcgcacaggttg 824
>gb|AY158944.1| Mus musculus histone protein Hist1h3h gene, complete cds Length = 1408 Score = 125 bits (63), Expect = 9e-26 Identities = 75/79 (94%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 902 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 843 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 842 gtggatggcgcacaggttg 824
>gb|M32462.1|MUSHIS3D Mouse histone H3 (H3.1-291) gene, complete cds Length = 927 Score = 125 bits (63), Expect = 9e-26 Identities = 75/79 (94%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 740 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 681 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 680 gtggatggcgcacaggttg 662
>ref|XM_472456.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 411 Score = 123 bits (62), Expect = 4e-25 Identities = 68/70 (97%) Strand = Plus / Minus Query: 254 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgaatggc 313 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 393 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 334 Query: 314 gcaaaggttg 323 ||| |||||| Sbjct: 333 gcagaggttg 324
>gb|BC069303.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:97421 IMAGE:7262697), complete cds Length = 461 Score = 123 bits (62), Expect = 4e-25 Identities = 71/74 (95%) Strand = Plus / Minus Query: 249 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtga 308 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 398 ccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggcgtgg 339 Query: 309 atggcgcaaaggtt 322 |||||||| ||||| Sbjct: 338 atggcgcacaggtt 325
>gb|BC067490.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79343 IMAGE:7002071), complete cds Length = 465 Score = 123 bits (62), Expect = 4e-25 Identities = 71/74 (95%) Strand = Plus / Minus Query: 249 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtga 308 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 398 ccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggcgtgg 339 Query: 309 atggcgcaaaggtt 322 |||||||| ||||| Sbjct: 338 atggcgcacaggtt 325
>gb|BC067491.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79344 IMAGE:7002072), complete cds Length = 464 Score = 123 bits (62), Expect = 4e-25 Identities = 71/74 (95%) Strand = Plus / Minus Query: 249 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtga 308 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 398 ccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggcgtgg 339 Query: 309 atggcgcaaaggtt 322 |||||||| ||||| Sbjct: 338 atggcgcacaggtt 325
>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on chromosome 6 Length = 269712 Score = 123 bits (62), Expect = 4e-25 Identities = 71/74 (95%) Strand = Plus / Minus Query: 249 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtga 308 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 4829 ccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggcgtgg 4770 Query: 309 atggcgcaaaggtt 322 |||||||| ||||| Sbjct: 4769 atggcgcacaggtt 4756 Score = 93.7 bits (47), Expect = 3e-16 Identities = 71/79 (89%) Strand = Plus / Plus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||| || |||||||| || ||||||||||||||||||||||| || || |||||||| Sbjct: 180849 ctccccacgaatgcggcgagcaagctggatgtccttgggcatgatagtcactcgcttggc 180908 Query: 305 gtgaatggcgcaaaggttg 323 |||||||||||| |||||| Sbjct: 180909 gtgaatggcgcataggttg 180927 Score = 77.8 bits (39), Expect = 2e-11 Identities = 54/59 (91%) Strand = Plus / Plus Query: 249 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtg 307 ||||| |||||||| |||||||||||||||||||||||||| || || ||||||||||| Sbjct: 234208 ccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgcttggcgtg 234266 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||| || ||||||||||| ||||||||||| || ||||||||||| ||||| ||||| Sbjct: 209556 ctccccacgaatgcggcgggcaagctggatgtctttaggcatgatggtcacgcgtttggc 209497 Query: 305 gtgaatggcgcaaaggttg 323 ||||| ||||| |||||| Sbjct: 209496 atgaatagcgcacaggttg 209478 Score = 69.9 bits (35), Expect = 5e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 246 tccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcg 305 ||||| |||||||| || || |||||||| || |||||||||||||||||||| || ||| Sbjct: 29753 tccccacggatgcgacgtgccagctggatatctttgggcatgatggtgacgcgtttagcg 29694 Query: 306 tgaatggcgca 316 ||||| ||||| Sbjct: 29693 tgaatagcgca 29683 Score = 67.9 bits (34), Expect = 2e-08 Identities = 64/74 (86%) Strand = Plus / Plus Query: 249 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtga 308 ||||| |||||||| |||||||||||||| |||||||| || || || ||||| || || Sbjct: 15605 ccgcgaatgcggcgagcgagctggatgtctttgggcataatagtcactcgcttagcatgg 15664 Query: 309 atggcgcaaaggtt 322 |||||||||||||| Sbjct: 15665 atggcgcaaaggtt 15678 Score = 61.9 bits (31), Expect = 1e-06 Identities = 67/79 (84%) Strand = Plus / Plus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||| || |||||||| |||||||| ||||||||||||||||| || || ||||| || Sbjct: 254983 ctccccacgaatgcggcgagcgagctgaatgtccttgggcatgatagtcactcgcttagc 255042 Query: 305 gtgaatggcgcaaaggttg 323 || ||||| || |||||| Sbjct: 255043 atggatggcacacaggttg 255061
>ref|NM_003529.2| Homo sapiens histone 1, H3a (HIST1H3A), mRNA Length = 469 Score = 123 bits (62), Expect = 4e-25 Identities = 71/74 (95%) Strand = Plus / Minus Query: 249 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtga 308 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 398 ccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggcgtgg 339 Query: 309 atggcgcaaaggtt 322 |||||||| ||||| Sbjct: 338 atggcgcacaggtt 325
>ref|XM_545428.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted) (LOC488306), mRNA Length = 411 Score = 123 bits (62), Expect = 4e-25 Identities = 74/78 (94%) Strand = Plus / Minus Query: 246 tccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcg 305 ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| Sbjct: 401 tccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcg 342 Query: 306 tgaatggcgcaaaggttg 323 || |||||||| |||||| Sbjct: 341 tggatggcgcagaggttg 324
>gb|AF531274.1| Homo sapiens histone H3 (HIST1H3A) gene, complete cds Length = 1227 Score = 123 bits (62), Expect = 4e-25 Identities = 71/74 (95%) Strand = Plus / Minus Query: 249 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtga 308 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 808 ccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggcgtgg 749 Query: 309 atggcgcaaaggtt 322 |||||||| ||||| Sbjct: 748 atggcgcacaggtt 735
>gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, histone 2A-like protein gene, hereditary haemochromatosis (HLA-H) gene, RoRet gene, and sodium phosphate transporter (NPT3) gene, complete cds Length = 246282 Score = 123 bits (62), Expect = 4e-25 Identities = 71/74 (95%) Strand = Plus / Plus Query: 249 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtga 308 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 120172 ccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggcgtgg 120231 Query: 309 atggcgcaaaggtt 322 |||||||| ||||| Sbjct: 120232 atggcgcacaggtt 120245 Score = 69.9 bits (35), Expect = 5e-09 Identities = 62/71 (87%) Strand = Plus / Plus Query: 246 tccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcg 305 ||||| |||||||| || || |||||||| || |||||||||||||||||||| || ||| Sbjct: 95248 tccccacggatgcgacgtgccagctggatatctttgggcatgatggtgacgcgtttagcg 95307 Query: 306 tgaatggcgca 316 ||||| ||||| Sbjct: 95308 tgaatagcgca 95318 Score = 67.9 bits (34), Expect = 2e-08 Identities = 64/74 (86%) Strand = Plus / Minus Query: 249 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtga 308 ||||| |||||||| |||||||||||||| |||||||| || || || ||||| || || Sbjct: 109396 ccgcgaatgcggcgagcgagctggatgtctttgggcataatagtcactcgcttagcatgg 109337 Query: 309 atggcgcaaaggtt 322 |||||||||||||| Sbjct: 109336 atggcgcaaaggtt 109323
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 123 bits (62), Expect = 4e-25 Identities = 68/70 (97%) Strand = Plus / Minus Query: 254 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgaatggc 313 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 20749045 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 20748986 Query: 314 gcaaaggttg 323 ||| |||||| Sbjct: 20748985 gcagaggttg 20748976 Score = 65.9 bits (33), Expect = 7e-08 Identities = 51/57 (89%) Strand = Plus / Minus Query: 267 agctggatgtccttgggcatgatggtgacgcgcttggcgtgaatggcgcaaaggttg 323 ||||| |||||||||||||||||||| || |||||||| || |||||||| |||||| Sbjct: 22438361 agctgaatgtccttgggcatgatggtcacacgcttggcatggatggcgcacaggttg 22438305
>dbj|AB185026.1| Conocephalum conicum H3 gene for histone 3, complete cds, clone: T135 Length = 473 Score = 123 bits (62), Expect = 4e-25 Identities = 77/82 (93%) Strand = Plus / Minus Query: 242 gcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgctt 301 |||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 467 gcgctcgcctcggatgcggcgggccagctggatgtccttgggcatgatggtgacgcgctt 408 Query: 302 ggcgtgaatggcgcaaaggttg 323 |||||| |||||||| |||||| Sbjct: 407 ggcgtggatggcgcagaggttg 386
>dbj|AB185023.1| Conocephalum conicum H3 gene for histone 3, complete cds, clone: T117 Length = 474 Score = 123 bits (62), Expect = 4e-25 Identities = 77/82 (93%) Strand = Plus / Minus Query: 242 gcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgctt 301 |||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 468 gcgctcgcctcggatgcggcgggccagctggatgtccttgggcatgatggtgacgcgctt 409 Query: 302 ggcgtgaatggcgcaaaggttg 323 |||||| |||||||| |||||| Sbjct: 408 ggcgtggatggcgcagaggttg 387
>emb|Z61129.1|HS45E8R H.sapiens CpG island DNA genomic Mse1 fragment, clone 45e8, reverse read cpg45e8.rt1d Length = 257 Score = 123 bits (62), Expect = 4e-25 Identities = 71/74 (95%) Strand = Plus / Minus Query: 249 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtga 308 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 160 ccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggcgtgg 101 Query: 309 atggcgcaaaggtt 322 |||||||| ||||| Sbjct: 100 atggcgcacaggtt 87
>gb|BC066246.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79341 IMAGE:7002069), complete cds Length = 465 Score = 123 bits (62), Expect = 4e-25 Identities = 71/74 (95%) Strand = Plus / Minus Query: 249 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtga 308 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 398 ccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggcgtgg 339 Query: 309 atggcgcaaaggtt 322 |||||||| ||||| Sbjct: 338 atggcgcacaggtt 325
>gb|BC066245.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79340 IMAGE:7002068), complete cds Length = 465 Score = 123 bits (62), Expect = 4e-25 Identities = 71/74 (95%) Strand = Plus / Minus Query: 249 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtga 308 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 398 ccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggcgtgg 339 Query: 309 atggcgcaaaggtt 322 |||||||| ||||| Sbjct: 338 atggcgcacaggtt 325
>gb|BC066247.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79342 IMAGE:7002070), complete cds Length = 465 Score = 123 bits (62), Expect = 4e-25 Identities = 71/74 (95%) Strand = Plus / Minus Query: 249 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtga 308 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 398 ccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggcgtgg 339 Query: 309 atggcgcaaaggtt 322 |||||||| ||||| Sbjct: 338 atggcgcacaggtt 325
>emb|AL606618.4|OSJN00062 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0108J11, complete sequence Length = 124629 Score = 123 bits (62), Expect = 4e-25 Identities = 68/70 (97%) Strand = Plus / Minus Query: 254 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgaatggc 313 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 95196 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 95137 Query: 314 gcaaaggttg 323 ||| |||||| Sbjct: 95136 gcagaggttg 95127
>ref|NM_019469.1| Mus musculus histone 2, H3c1 (Hist2h3c1), transcript variant 1, mRNA Length = 411 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 407 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 348 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 347 ttggcgtgcatggcgcacaggttg 324
>ref|NM_178216.1| Mus musculus histone 2, H3c1 (Hist2h3c1), transcript variant 2, mRNA Length = 546 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 542 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 483 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 482 ttggcgtggatggcgcacaggttg 459
>ref|NM_185607.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 411 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||||| Sbjct: 407 gcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 348 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| ||||| || |||||| Sbjct: 347 ttggcgtggatggcacacaggttg 324
>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339 Length = 2972 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 1739 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 1680 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 1679 ttggcgtggatggcgcacaggttg 1656
>gb|BC015270.1| Mus musculus histone 2, H3c2, mRNA (cDNA clone MGC:18559 IMAGE:4240748), complete cds Length = 1124 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 593 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 534 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 533 ttggcgtggatggcgcacaggttg 510
>ref|XM_590015.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted) (LOC539875), mRNA Length = 411 Score = 119 bits (60), Expect = 6e-24 Identities = 69/72 (95%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| Sbjct: 402 ctccccgcggatgcggcgagcaagctggatgtccttgggcatgatggtgacgcgcttggc 343 Query: 305 gtgaatggcgca 316 ||| |||||||| Sbjct: 342 gtggatggcgca 331
>ref|NM_054045.2| Mus musculus histone 2, H3c2 (Hist2h3c2), mRNA Length = 1124 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 593 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 534 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 533 ttggcgtggatggcgcacaggttg 510
>ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h3c1), mRNA Length = 2956 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 1739 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 1680 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 1679 ttggcgtggatggcgcacaggttg 1656
>emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes Length = 3098 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 2579 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 2520 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 2519 ttggcgtgcatggcgcacaggttg 2496
>dbj|AK134918.1| Mus musculus adult male olfactory brain cDNA, RIKEN full-length enriched library, clone:6430517B15 product:unclassifiable, full insert sequence Length = 3217 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Plus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 1191 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 1250 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 1251 ttggcgtggatggcgcacaggttg 1274
>ref|XM_686806.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC563445), mRNA Length = 444 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| | | Sbjct: 440 gcgcgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctc 381 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 380 ttggcgtggatggcgcacaggttg 357
>ref|XM_684297.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC560897), mRNA Length = 471 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| | | Sbjct: 467 gcgcgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctc 408 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 407 ttggcgtggatggcgcacaggttg 384
>gb|U62675.1|MMU62675 Mus musculus histone H3.2-616 (H3-616), and histone H2b-616 (H2b-616) genes, complete cds Length = 2371 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 987 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 928 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 927 ttggcgtggatggcgcacaggttg 904
>gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), and histone H3.2-615 (H3-615) genes, complete cds Length = 2997 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 2722 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 2663 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 2662 ttggcgtggatggcgcacaggttg 2639
>ref|NG_002616.1| Homo sapiens histone 2, H3b (HIST2H3B) pseudogene on chromosome 1 Length = 1411 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 907 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 848 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 847 ttggcgtggatggcgcacaggttg 824
>gb|BC094041.1| Mus musculus histone 2, H3c1, mRNA (cDNA clone MGC:102454 IMAGE:5099464), complete cds Length = 1831 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 608 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 549 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 548 ttggcgtggatggcgcacaggttg 525
>gb|AF531306.1| Homo sapiens histone H3 (HIST2H3B) pseudogene, complete sequence Length = 1411 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 907 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 848 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 847 ttggcgtggatggcgcacaggttg 824
>gb|AY158955.1| Mus musculus histone protein Hist2h3b gene, complete cds Length = 1411 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 907 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 848 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 847 ttggcgtggatggcgcacaggttg 824
>gb|AY158954.1| Mus musculus histone protein Hist2h3c1 gene, complete cds Length = 1675 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 1093 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 1034 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 1033 ttggcgtggatggcgcacaggttg 1010
>gb|AY158941.1| Mus musculus histone protein Hist2h2bb gene, complete cds Length = 1500 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Plus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 514 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 573 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 574 ttggcgtggatggcgcacaggttg 597
>ref|XM_318362.1| Anopheles gambiae str. PEST ENSANGP00000016005 (ENSANGG00000013516), partial mRNA Length = 411 Score = 119 bits (60), Expect = 6e-24 Identities = 75/80 (93%) Strand = Plus / Minus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||| ||||| ||||||||||| ||||| |||||||||||||||||||||||||||||| Sbjct: 410 taggcacgctctccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacg 351 Query: 297 cgcttggcgtgaatggcgca 316 ||||||||||| |||||||| Sbjct: 350 cgcttggcgtggatggcgca 331
>ref|XM_307081.1| Anopheles gambiae str. PEST ENSANGP00000001387 (ENSANGG00000001186), partial mRNA Length = 408 Score = 119 bits (60), Expect = 6e-24 Identities = 75/80 (93%) Strand = Plus / Minus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||| ||||| ||||||||||| ||||| |||||||||||||||||||||||||||||| Sbjct: 407 taggcacgctctccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacg 348 Query: 297 cgcttggcgtgaatggcgca 316 ||||||||||| |||||||| Sbjct: 347 cgcttggcgtggatggcgca 328
>ref|XM_305996.1| Anopheles gambiae str. PEST ENSANGP00000012784 (ENSANGG00000010295), partial mRNA Length = 411 Score = 119 bits (60), Expect = 6e-24 Identities = 75/80 (93%) Strand = Plus / Minus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||| ||||| ||||||||||| ||||| |||||||||||||||||||||||||||||| Sbjct: 410 taggcacgctctccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacg 351 Query: 297 cgcttggcgtgaatggcgca 316 ||||||||||| |||||||| Sbjct: 350 cgcttggcgtggatggcgca 331
>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence Length = 200326 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 93739 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 93680 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 93679 ttggcgtggatggcgcacaggttg 93656 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 71931 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 71872 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 71871 ttggcgtggatggcgcacaggttg 71848 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Plus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 63174 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 63233 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 63234 ttggcgtggatggcgcacaggttg 63257
>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence Length = 166720 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 37519 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 37460 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 37459 ttggcgtggatggcgcacaggttg 37436 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Plus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 28762 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 28821 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 28822 ttggcgtggatggcgcacaggttg 28845 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Plus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 6954 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 7013 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 7014 ttggcgtggatggcgcacaggttg 7037
>emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 in linkage group 25, complete sequence Length = 167326 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Plus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| | | Sbjct: 79273 gcgcgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctc 79332 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 79333 ttggcgtggatggcgcacaggttg 79356 Score = 111 bits (56), Expect = 1e-21 Identities = 77/84 (91%) Strand = Plus / Plus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | | Sbjct: 116388 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 116447 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 116448 ttggcgtggatggcgcacaggttg 116471 Score = 111 bits (56), Expect = 1e-21 Identities = 74/80 (92%) Strand = Plus / Plus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| ||||||||||||||||| ||||||||||||||||||||||||||||| | |||| Sbjct: 99227 cgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttg 99286 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 99287 gcgtggatggcgcacaggtt 99306 Score = 111 bits (56), Expect = 1e-21 Identities = 77/84 (91%) Strand = Plus / Plus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | | Sbjct: 85972 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 86031 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 86032 ttggcgtggatggcgcacaggttg 86055 Score = 111 bits (56), Expect = 1e-21 Identities = 77/84 (91%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | | Sbjct: 63682 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 63623 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 63622 ttggcgtggatggcgcacaggttg 63599
>ref|NM_178215.1| Mus musculus histone 2, H3b (Hist2h3b), mRNA Length = 411 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 407 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 348 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 347 ttggcgtggatggcgcacaggttg 324
>gb|M32461.1|MUSHIS3C Mouse histone H3 (H3.2-614) gene, complete cds Length = 1110 Score = 119 bits (60), Expect = 6e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 746 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 687 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 686 ttggcgtggatggcgcacaggttg 663
>ref|NM_013550.3| Mus musculus histone 1, H3a (Hist1h3a), mRNA Length = 535 Score = 117 bits (59), Expect = 2e-23 Identities = 74/79 (93%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||| Sbjct: 436 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 377 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 376 gtggatggcgcacaggttg 358
>ref|NM_178203.1| Mus musculus histone 1, H3b (Hist1h3b), mRNA Length = 411 Score = 117 bits (59), Expect = 2e-23 Identities = 74/79 (93%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||| || ||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 402 ctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggc 343 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 342 gtggatggcgcacaggttg 324
>ref|XM_871299.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted) (LOC618987), partial mRNA Length = 521 Score = 117 bits (59), Expect = 2e-23 Identities = 71/75 (94%) Strand = Plus / Minus Query: 249 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtga 308 ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 401 ccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 342 Query: 309 atggcgcaaaggttg 323 ||||| || |||||| Sbjct: 341 atggcacacaggttg 327
>ref|XM_865002.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted) (LOC613840), partial mRNA Length = 547 Score = 117 bits (59), Expect = 2e-23 Identities = 71/75 (94%) Strand = Plus / Minus Query: 249 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtga 308 ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 427 ccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 368 Query: 309 atggcgcaaaggttg 323 ||||| || |||||| Sbjct: 367 atggcacacaggttg 353
>ref|NM_145073.2| Mus musculus histone 1, H3g (Hist1h3g), mRNA Length = 492 Score = 117 bits (59), Expect = 2e-23 Identities = 74/79 (93%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 430 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 371 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 370 gtggatggcgcacaggttg 352
>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence Length = 209720 Score = 117 bits (59), Expect = 2e-23 Identities = 74/79 (93%) Strand = Plus / Plus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 99531 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 99590 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 99591 gtggatggcgcacaggttg 99609 Score = 113 bits (57), Expect = 4e-22 Identities = 75/81 (92%) Strand = Plus / Plus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 90490 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 90549 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 90550 gcgtggatggcgcacaggttg 90570 Score = 113 bits (57), Expect = 4e-22 Identities = 75/81 (92%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 73416 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 73357 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 73356 gcgtggatggcgcacaggttg 73336 Score = 93.7 bits (47), Expect = 3e-16 Identities = 71/79 (89%) Strand = Plus / Plus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||| || ||||| ||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 59175 ctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 59234 Query: 305 gtgaatggcgcaaaggttg 323 ||| ||||| || |||||| Sbjct: 59235 gtggatggcacacaggttg 59253
>emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, histone H3 and histone H1.1 Length = 5597 Score = 117 bits (59), Expect = 2e-23 Identities = 74/79 (93%) Strand = Plus / Plus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||| Sbjct: 2135 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 2194 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 2195 gtggatggcgcacaggttg 2213
>emb|X80324.1|MPMPH3110 M.pahari mpH3110 gene Length = 990 Score = 117 bits (59), Expect = 2e-23 Identities = 74/79 (93%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||||||||| |||||||||||||| |||||||||||||| |||||||| Sbjct: 842 ctccccgcggatgcggcgggccagctggatgtccttaggcatgatggtgacacgcttggc 783 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 782 gtggatggcgcacaggttg 764
>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a novel gene, the genes for three H1, four H2a, five H2b, four H3 and four H4 histone family members, the 3' end of a variant of the Hfe gene for hemochromatosis protein (Mr2) and ten CpG islands, complete sequence Length = 184730 Score = 117 bits (59), Expect = 2e-23 Identities = 74/79 (93%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 16449 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 16390 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 16389 gtggatggcgcacaggttg 16371 Score = 113 bits (57), Expect = 4e-22 Identities = 75/81 (92%) Strand = Plus / Plus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 42568 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 42627 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 42628 gcgtggatggcgcacaggttg 42648 Score = 113 bits (57), Expect = 4e-22 Identities = 75/81 (92%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 25490 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 25431 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 25430 gcgtggatggcgcacaggttg 25410 Score = 93.7 bits (47), Expect = 3e-16 Identities = 71/79 (89%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||| || ||||| ||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 56809 ctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 56750 Query: 305 gtgaatggcgcaaaggttg 323 ||| ||||| || |||||| Sbjct: 56749 gtggatggcacacaggttg 56731
>ref|XM_693458.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570028), mRNA Length = 725 Score = 117 bits (59), Expect = 2e-23 Identities = 77/83 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| | | Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctc 348 Query: 300 ttggcgtgaatggcgcaaaggtt 322 |||||||| |||||||| ||||| Sbjct: 347 ttggcgtggatggcgcacaggtt 325
>dbj|AK006742.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:1700049H14 product:H3 HISTONE homolog [Rattus norvegicus], full insert sequence Length = 514 Score = 117 bits (59), Expect = 2e-23 Identities = 74/79 (93%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||| Sbjct: 415 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 356 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 355 gtggatggcgcacaggttg 337
>gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and histone H4-D (H4-D) genes, complete cds Length = 2321 Score = 117 bits (59), Expect = 2e-23 Identities = 74/79 (93%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||| Sbjct: 753 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 694 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 693 gtggatggcgcacaggttg 675
>dbj|AK018952.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:1700111A06 product:H3 HISTONE homolog [Rattus norvegicus], full insert sequence Length = 535 Score = 117 bits (59), Expect = 2e-23 Identities = 74/79 (93%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||| Sbjct: 436 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 377 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 376 gtggatggcgcacaggttg 358
>gb|AY158952.1| Mus musculus histone protein Hist1h3a gene, complete cds Length = 1408 Score = 117 bits (59), Expect = 2e-23 Identities = 74/79 (93%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||| Sbjct: 902 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 843 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 842 gtggatggcgcacaggttg 824
>gb|AY158951.1| Mus musculus histone protein Hist1h3b gene, complete cds Length = 1411 Score = 117 bits (59), Expect = 2e-23 Identities = 74/79 (93%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||| || ||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 902 ctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggc 843 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 842 gtggatggcgcacaggttg 824
>gb|AY158946.1| Mus musculus histone protein Hist1h3g gene, complete cds Length = 1405 Score = 117 bits (59), Expect = 2e-23 Identities = 74/79 (93%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 899 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 840 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 839 gtggatggcgcacaggttg 821
>emb|X01684.1|MMHISH31 Mouse gene (H3.1) for histone H3 Length = 1244 Score = 117 bits (59), Expect = 2e-23 Identities = 74/79 (93%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 754 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 695 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 694 gtggatggcgcacaggttg 676
>gb|M33989.1|MUSH2AX1X Mouse histone H3.2 gene, complete cds Length = 693 Score = 117 bits (59), Expect = 2e-23 Identities = 74/79 (93%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||| || ||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 552 ctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggc 493 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 492 gtggatggcgcacaggttg 474
>gb|M32460.1|MUSHIS3B Mouse histone H3 (H3.1-221) gene, complete cds Length = 1125 Score = 117 bits (59), Expect = 2e-23 Identities = 74/79 (93%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 754 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 695 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 694 gtggatggcgcacaggttg 676
>ref|XM_524859.1| PREDICTED: Pan troglodytes LOC469476 (LOC469476), mRNA Length = 576 Score = 115 bits (58), Expect = 9e-23 Identities = 79/86 (91%) Strand = Plus / Minus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||| ||||||||||||||||||||||| | |||||||||||||||||||||||| ||| Sbjct: 575 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 516 Query: 297 cgcttggcgtgaatggcgcaaaggtt 322 |||||||| || |||||||| ||||| Sbjct: 515 cgcttggcatggatggcgcacaggtt 490
>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of IgG, high affinity Ia, receptor for (CD64), a novel gene similar to histone 2, H2be (HIST2H2BE), a novel gene similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for histone 2, H4, the HIST2H3C gene for histone 2, H3c, the HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene (HIST2H2BC), a novel gene similar to histone 2, H2aa (HIST2H2AA), a novel gene similar to histone 2, H3c (HIST2H3C), a novel gene similar to histone 1, H4 (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for histone 2, H2ab, a novel protein similar to histone 2, a novel gene, the SV2A gene for synaptic vesicle glycoprotein 2A, the 3' end of the SF3B4 gene for splicing factor 3b, subunit 4, 49kDa and five CpG islands, complete sequence Length = 188956 Score = 115 bits (58), Expect = 9e-23 Identities = 79/86 (91%) Strand = Plus / Plus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||| ||||||||||||||||||||||| | |||||||||||||||||||||||| ||| Sbjct: 74987 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 75046 Query: 297 cgcttggcgtgaatggcgcaaaggtt 322 |||||||| || |||||||| ||||| Sbjct: 75047 cgcttggcatggatggcgcacaggtt 75072 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || |||||||||||||| |||||||||||||||||||| ||||| ||||||||| Sbjct: 114780 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 114721 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 114720 gcgtggatggcgcacaggtt 114701 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Plus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || |||||||||||||| |||||||||||||||||||| ||||| ||||||||| Sbjct: 102486 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 102545 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 102546 gcgtggatggcgcacaggtt 102565
>ref|XM_497711.2| PREDICTED: Homo sapiens similar to H3 histone, family 2 isoform 2 (LOC653604), mRNA Length = 543 Score = 115 bits (58), Expect = 9e-23 Identities = 79/86 (91%) Strand = Plus / Minus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||| ||||||||||||||||||||||| | |||||||||||||||||||||||| ||| Sbjct: 542 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 483 Query: 297 cgcttggcgtgaatggcgcaaaggtt 322 |||||||| || |||||||| ||||| Sbjct: 482 cgcttggcatggatggcgcacaggtt 457
>gb|AF140033.1|AF140033 Phreatamoeba balamuthi histone H3 mRNA, complete cds Length = 626 Score = 115 bits (58), Expect = 9e-23 Identities = 82/90 (91%) Strand = Plus / Minus Query: 234 gcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 293 |||||||||||||| || |||||||||||||| ||||||||||||||||||||||| || Sbjct: 424 gcctaggcgcgctcgccacggatgcggcgggccagctggatgtccttgggcatgatcgtc 365 Query: 294 acgcgcttggcgtgaatggcgcaaaggttg 323 || ||||||||||| |||||||| |||||| Sbjct: 364 acacgcttggcgtggatggcgcacaggttg 335
>gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I) and histone H4 (ch4-I) genes, complete cds Length = 1338 Score = 115 bits (58), Expect = 9e-23 Identities = 79/86 (91%) Strand = Plus / Plus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||||||||| || |||||||||||||| |||||||||||||||||||||||||| || Sbjct: 201 taggcgcgctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcaca 260 Query: 297 cgcttggcgtgaatggcgcaaaggtt 322 ||||||||||| |||||||| ||||| Sbjct: 261 cgcttggcgtggatggcgcacaggtt 286
>gb|M35388.1|MZEHISH3A Zea mays histone H3 gene, complete cds Length = 411 Score = 115 bits (58), Expect = 9e-23 Identities = 67/70 (95%) Strand = Plus / Minus Query: 254 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgaatggc 313 ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 393 gatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 334 Query: 314 gcaaaggttg 323 ||| |||||| Sbjct: 333 gcagaggttg 324
>gb|M13378.1|MZEH3C2 Maize (Zea mays) histone H3 gene (H3C2), complete cds Length = 1001 Score = 115 bits (58), Expect = 9e-23 Identities = 67/70 (95%) Strand = Plus / Minus Query: 254 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgaatggc 313 ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 814 gatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 755 Query: 314 gcaaaggttg 323 ||| |||||| Sbjct: 754 gcagaggttg 745
>ref|NM_013548.2| Mus musculus histone 1, H3f (Hist1h3f), mRNA Length = 1851 Score = 113 bits (57), Expect = 4e-22 Identities = 75/81 (92%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 924 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 865 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 864 gcgtggatggcgcacaggttg 844
>gb|BC107285.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMAGE:40053006), partial cds Length = 417 Score = 113 bits (57), Expect = 4e-22 Identities = 75/81 (92%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 402 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 343 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 342 gcgtggatggcgcacaggttg 322
>ref|NM_178205.1| Mus musculus histone 1, H3e (Hist1h3e), mRNA Length = 411 Score = 113 bits (57), Expect = 4e-22 Identities = 75/81 (92%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 404 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 345 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 344 gcgtggatggcgcacaggttg 324
>gb|BC103549.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123925 IMAGE:40044771), complete cds Length = 1003 Score = 113 bits (57), Expect = 4e-22 Identities = 75/81 (92%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 837 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 778 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 777 gcgtggatggcgcacaggttg 757
>dbj|AK010121.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched library, clone:2310069A13 product:HISTONE H3-VI homolog [Gallus gallus], full insert sequence Length = 852 Score = 113 bits (57), Expect = 4e-22 Identities = 75/81 (92%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 426 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 367 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 366 gcgtggatggcgcacaggttg 346
>gb|U62671.1|MMU62671 Mus musculus histone H3.2-B (H3-B) gene, complete cds Length = 1100 Score = 113 bits (57), Expect = 4e-22 Identities = 75/81 (92%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 890 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 831 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 830 gcgtggatggcgcacaggttg 810
>gb|AY158948.1| Mus musculus histone protein Hist1h3e gene, complete cds Length = 1408 Score = 113 bits (57), Expect = 4e-22 Identities = 75/81 (92%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 904 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 845 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 844 gcgtggatggcgcacaggttg 824
>gb|AY158947.1| Mus musculus histone protein Hist1h3f gene, complete cds Length = 1851 Score = 113 bits (57), Expect = 4e-22 Identities = 75/81 (92%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 924 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 865 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 864 gcgtggatggcgcacaggttg 844
>gb|BC101955.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123923 IMAGE:40044769), complete cds Length = 1004 Score = 113 bits (57), Expect = 4e-22 Identities = 75/81 (92%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 837 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 778 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 777 gcgtggatggcgcacaggttg 757
>gb|BC101956.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123922 IMAGE:40044765), complete cds Length = 1004 Score = 113 bits (57), Expect = 4e-22 Identities = 75/81 (92%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 837 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 778 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 777 gcgtggatggcgcacaggttg 757
>gb|BC101954.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123924 IMAGE:40044770), complete cds Length = 1004 Score = 113 bits (57), Expect = 4e-22 Identities = 75/81 (92%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 837 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 778 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 777 gcgtggatggcgcacaggttg 757
>emb|X01685.1|MMHISH32 Mouse gene (H3.2) for histone H3 Length = 702 Score = 113 bits (57), Expect = 4e-22 Identities = 75/81 (92%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 555 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 496 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 495 gcgtggatggcgcacaggttg 475
>gb|M32459.1|MUSHIS3A Mouse histone H3 (H3.2-221) gene, complete cds Length = 982 Score = 113 bits (57), Expect = 4e-22 Identities = 75/81 (92%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 812 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 753 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 752 gcgtggatggcgcacaggttg 732
>gb|J01175.1|SULHISL34 Sea urchin (L.pictus) late-stage histone H3 and H4 genes Length = 2133 Score = 113 bits (57), Expect = 4e-22 Identities = 75/81 (92%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 1917 cgctcgccacggatacggcgggcaagctggatgtccttgggcatgatggtgacacgcttg 1858 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| ||||||||||||||| Sbjct: 1857 gcgtggatggcgcaaaggttg 1837
>ref|XM_871486.1| PREDICTED: Bos taurus similar to H3 histone, family 2 isoform 2 (LOC619165), partial mRNA Length = 552 Score = 111 bits (56), Expect = 1e-21 Identities = 74/80 (92%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 |||||||||||||||||||| || ||||||||||| |||||||||||||| ||||||||| Sbjct: 469 cgctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtcacgcgcttg 410 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 409 gcgtggatggcgcacaggtt 390
>ref|XM_871460.1| PREDICTED: Bos taurus similar to H3 histone, family 2 isoform 2 (LOC619141), partial mRNA Length = 552 Score = 111 bits (56), Expect = 1e-21 Identities = 74/80 (92%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 |||||||||||||||||||| || ||||||||||| |||||||||||||| ||||||||| Sbjct: 469 cgctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtcacgcgcttg 410 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 409 gcgtggatggcgcacaggtt 390
>gb|BC054666.1| Danio rerio zgc:66241, mRNA (cDNA clone MGC:66241 IMAGE:3818929), complete cds Length = 2172 Score = 111 bits (56), Expect = 1e-21 Identities = 77/84 (91%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | | Sbjct: 419 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgactctc 360 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 359 ttggcgtggatggcgcacaggttg 336
>ref|XM_866756.1| PREDICTED: Bos taurus similar to H3 histone, family 2 isoform 2 (LOC615056), mRNA Length = 1029 Score = 111 bits (56), Expect = 1e-21 Identities = 74/80 (92%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 |||||||||||||||||||| || ||||||||||| |||||||||||||| ||||||||| Sbjct: 1022 cgctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtcacgcgcttg 963 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 962 gcgtggatggcgcacaggtt 943
>ref|XM_866686.1| PREDICTED: Bos taurus similar to H3 histone, family 2 isoform 2 (LOC615006), mRNA Length = 886 Score = 111 bits (56), Expect = 1e-21 Identities = 74/80 (92%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 |||||||||||||||||||| || ||||||||||| |||||||||||||| ||||||||| Sbjct: 803 cgctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtcacgcgcttg 744 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 743 gcgtggatggcgcacaggtt 724
>emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23 Length = 2724 Score = 111 bits (56), Expect = 1e-21 Identities = 77/84 (91%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| || |||||||||||| | | ||||||||||||||||||||||||||||||| Sbjct: 2548 gcgcgctcaccacggatgcggcggaccaactggatgtccttgggcatgatggtgacgcgc 2489 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 2488 ttggcgtggatggcgcacaggttg 2465
>emb|X80326.1|MPMPH312 M.pahari mpH312 gene Length = 580 Score = 111 bits (56), Expect = 1e-21 Identities = 68/72 (94%) Strand = Plus / Minus Query: 252 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgaatg 311 |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||| Sbjct: 440 cggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 381 Query: 312 gcgcaaaggttg 323 ||||| |||||| Sbjct: 380 gcgcacaggttg 369
>ref|NM_199745.1| Danio rerio zgc:66241 (zgc:66241), mRNA Length = 2172 Score = 111 bits (56), Expect = 1e-21 Identities = 77/84 (91%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | | Sbjct: 419 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgactctc 360 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 359 ttggcgtggatggcgcacaggttg 336
>ref|XM_684517.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC561114), mRNA Length = 411 Score = 111 bits (56), Expect = 1e-21 Identities = 77/84 (91%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | | Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 348 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 347 ttggcgtggatggcgcacaggttg 324
>ref|XM_684015.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC560616), mRNA Length = 411 Score = 111 bits (56), Expect = 1e-21 Identities = 77/84 (91%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | | Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 348 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 347 ttggcgtggatggcgcacaggttg 324
>ref|XM_683485.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC560090), mRNA Length = 411 Score = 111 bits (56), Expect = 1e-21 Identities = 74/80 (92%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| ||||||||||||||||| ||||||||||||||||||||||||||||| | |||| Sbjct: 404 cgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttg 345 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 344 gcgtggatggcgcacaggtt 325
>ref|XM_683134.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC559765), mRNA Length = 411 Score = 111 bits (56), Expect = 1e-21 Identities = 77/84 (91%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | | Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 348 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 347 ttggcgtggatggcgcacaggttg 324
>ref|XM_694149.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570644), mRNA Length = 411 Score = 111 bits (56), Expect = 1e-21 Identities = 77/84 (91%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | | Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 348 Query: 300 ttggcgtgaatggcgcaaaggttg 323 |||||||| |||||||| |||||| Sbjct: 347 ttggcgtggatggcgcacaggttg 324
>ref|XM_560604.1| Anopheles gambiae str. PEST ENSANGP00000025641 (ENSANGG00000024840), partial mRNA Length = 411 Score = 111 bits (56), Expect = 1e-21 Identities = 74/80 (92%) Strand = Plus / Minus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||| ||||| ||||| ||||| ||||| |||||||||||||||||||||||||||||| Sbjct: 410 taggcacgctctccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacg 351 Query: 297 cgcttggcgtgaatggcgca 316 ||||||||||| |||||||| Sbjct: 350 cgcttggcgtggatggcgca 331
>ref|XM_307606.1| Anopheles gambiae str. PEST ENSANGP00000016172 (ENSANGG00000013683), partial mRNA Length = 411 Score = 111 bits (56), Expect = 1e-21 Identities = 74/80 (92%) Strand = Plus / Minus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||| ||||| ||||||||||| ||||| | |||||||||||||||||||||||||||| Sbjct: 410 taggcacgctctccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacg 351 Query: 297 cgcttggcgtgaatggcgca 316 ||||||||||| |||||||| Sbjct: 350 cgcttggcgtggatggcgca 331
>gb|BC107287.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMAGE:40053019), partial cds Length = 415 Score = 109 bits (55), Expect = 6e-21 Identities = 73/79 (92%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 398 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 339 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 338 gtggatggcgcacaggttg 320
>gb|BT018179.1| Zea mays clone EL01N0557G06.c mRNA sequence Length = 716 Score = 109 bits (55), Expect = 6e-21 Identities = 61/63 (96%) Strand = Plus / Minus Query: 254 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgaatggc 313 ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 453 gatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 394 Query: 314 gca 316 ||| Sbjct: 393 gca 391
>ref|XM_870476.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted) (LOC618149), mRNA Length = 411 Score = 109 bits (55), Expect = 6e-21 Identities = 73/79 (92%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||||| Sbjct: 402 ctccccgcggatccggcgggcaagctggatgtctttgggcatgatggtgacgcgcttggc 343 Query: 305 gtgaatggcgcaaaggttg 323 ||| ||||| || |||||| Sbjct: 342 gtggatggcacacaggttg 324
>ref|XM_868935.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted) (LOC616819), mRNA Length = 411 Score = 109 bits (55), Expect = 6e-21 Identities = 73/79 (92%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||||||||||||||| || ||||||||||||||||||||||| |||||||||||||| Sbjct: 402 ctccccgcggatgcggcgagcaagctggatgtccttgggcatgatagtgacgcgcttggc 343 Query: 305 gtgaatggcgcaaaggttg 323 ||| ||||| || |||||| Sbjct: 342 gtggatggcacacaggttg 324
>ref|XM_868913.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted) (LOC616800), mRNA Length = 411 Score = 109 bits (55), Expect = 6e-21 Identities = 73/79 (92%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||||||||||||||| || ||||||||||||||||||||||| |||||||||||||| Sbjct: 402 ctccccgcggatgcggcgagcaagctggatgtccttgggcatgatagtgacgcgcttggc 343 Query: 305 gtgaatggcgcaaaggttg 323 ||| ||||| || |||||| Sbjct: 342 gtggatggcacacaggttg 324
>ref|XM_686609.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC563243), mRNA Length = 411 Score = 109 bits (55), Expect = 6e-21 Identities = 76/83 (91%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | | Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgactctc 348 Query: 300 ttggcgtgaatggcgcaaaggtt 322 |||||||| |||||||| ||||| Sbjct: 347 ttggcgtggatggcgcacaggtt 325
>dbj|AK155722.1| Mus musculus B6-derived CD11 +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F730210F11 product:histone 1, H3h, full insert sequence Length = 1806 Score = 109 bits (55), Expect = 6e-21 Identities = 73/79 (92%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 430 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 371 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 370 gtggatggcgcacaggttg 352
>ref|XM_694120.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570618), mRNA Length = 411 Score = 109 bits (55), Expect = 6e-21 Identities = 79/87 (90%) Strand = Plus / Minus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||||||||| || ||||||||||| || ||||||||||||||||||||||||||||| Sbjct: 410 taggcgcgctctccacggatgcggcgagccagctggatgtccttgggcatgatggtgacc 351 Query: 297 cgcttggcgtgaatggcgcaaaggttg 323 | ||||||||| |||||||| |||||| Sbjct: 350 ctcttggcgtggatggcgcacaggttg 324
>ref|XM_694212.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570703), mRNA Length = 411 Score = 109 bits (55), Expect = 6e-21 Identities = 76/83 (91%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | | Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 348 Query: 300 ttggcgtgaatggcgcaaaggtt 322 |||||||| |||||||| ||||| Sbjct: 347 ttggcgtggatggcgcacaggtt 325
>ref|XM_688339.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC565028), mRNA Length = 411 Score = 109 bits (55), Expect = 6e-21 Identities = 76/83 (91%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | | Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 348 Query: 300 ttggcgtgaatggcgcaaaggtt 322 |||||||| |||||||| ||||| Sbjct: 347 ttggcgtggatggcgcacaggtt 325
>gb|U62670.1|MMU62670 Mus musculus histone H3.1-I (H3-I) gene, complete cds Length = 727 Score = 109 bits (55), Expect = 6e-21 Identities = 73/79 (92%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 548 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 489 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 488 gtggatggcgcacaggttg 470
>gb|AY158945.1| Mus musculus histone protein Hist1h3i gene, complete cds Length = 1408 Score = 109 bits (55), Expect = 6e-21 Identities = 73/79 (92%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 902 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 843 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 842 gtggatggcgcacaggttg 824
>ref|NM_178207.2| Mus musculus histone 1, H3i (Hist1h3i), mRNA Length = 483 Score = 109 bits (55), Expect = 6e-21 Identities = 73/79 (92%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 ||||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 429 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 370 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 369 gtggatggcgcacaggttg 351
>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4 (ch4-III), histone H2B (ch2b-III) and histone H2A (ch2a-III) genes, complete cds Length = 4582 Score = 109 bits (55), Expect = 6e-21 Identities = 79/87 (90%) Strand = Plus / Plus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||| ||||| || |||||||||||||| |||||||||||||||||||||||||| || Sbjct: 465 taggcacgctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcaca 524 Query: 297 cgcttggcgtgaatggcgcaaaggttg 323 ||||||||||| |||||||| |||||| Sbjct: 525 cgcttggcgtggatggcgcacaggttg 551
>gb|BT016934.1| Zea mays clone E04912703G10.c mRNA sequence Length = 663 Score = 107 bits (54), Expect = 2e-20 Identities = 66/70 (94%) Strand = Plus / Plus Query: 254 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgaatggc 313 |||||||||||||||||||||||||||||||||||||||||| | ||||||||| ||||| Sbjct: 168 gatgcggcgggcgagctggatgtccttgggcatgatggtgaccctcttggcgtggatggc 227 Query: 314 gcaaaggttg 323 ||| |||||| Sbjct: 228 gcagaggttg 237
>ref|XM_782287.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA (LOC582332), mRNA Length = 411 Score = 105 bits (53), Expect = 9e-20 Identities = 74/81 (91%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 404 cgctcgccacggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 345 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 344 gcgtggatggcgcacaggttg 324
>emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for histones H3 and H4 Length = 1898 Score = 105 bits (53), Expect = 9e-20 Identities = 65/69 (94%) Strand = Plus / Minus Query: 255 atgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgaatggcg 314 |||||||| || ||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 1495 atgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcg 1436 Query: 315 caaaggttg 323 || |||||| Sbjct: 1435 cacaggttg 1427
>ref|XM_780236.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA (LOC580163), mRNA Length = 363 Score = 105 bits (53), Expect = 9e-20 Identities = 74/81 (91%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || |||||||| ||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 356 cgctcgccacggatgcgacgggcaagctggatgtccttgggcatgatggtgacacgcttg 297 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 296 gcgtggatggcgcacaggttg 276
>ref|XM_780065.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA (LOC579977), mRNA Length = 411 Score = 105 bits (53), Expect = 9e-20 Identities = 74/81 (91%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || |||||||| ||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 404 cgctcgccacggatgcgacgggcaagctggatgtccttgggcatgatggtgacacgcttg 345 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 344 gcgtggatggcgcacaggttg 324
>ref|XM_777897.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA (LOC577682), mRNA Length = 411 Score = 105 bits (53), Expect = 9e-20 Identities = 74/81 (91%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 404 cgctcgccacggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 345 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 344 gcgtggatggcgcacaggttg 324
>emb|X03952.1|SPHISH34 Sea urchin (S. purpuratus) late embryonic H3 and H4 histone genes Length = 2506 Score = 105 bits (53), Expect = 9e-20 Identities = 74/81 (91%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || |||||||||||||| |||||||||||||| ||||||||||| || |||||| Sbjct: 2409 cgctcgccacggatgcggcgggccagctggatgtcctttggcatgatggtaacacgcttg 2350 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| ||||||||||||||| Sbjct: 2349 gcgtggatggcgcaaaggttg 2329
>ref|XM_687893.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC564560), mRNA Length = 411 Score = 105 bits (53), Expect = 9e-20 Identities = 74/81 (91%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | |||| Sbjct: 404 cgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttg 345 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| |||||||| |||||| Sbjct: 344 gcgtggatggcgcacaggttg 324
>ref|XM_694088.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570590), mRNA Length = 411 Score = 105 bits (53), Expect = 9e-20 Identities = 71/77 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| || |||||||||||||| ||||||||||||||||||||||||||||| | | Sbjct: 407 gcgcgctctccacggatgcggcgggctagctggatgtccttgggcatgatggtgaccctc 348 Query: 300 ttggcgtgaatggcgca 316 |||||||| |||||||| Sbjct: 347 ttggcgtggatggcgca 331
>ref|XM_701573.1| PREDICTED: Danio rerio similar to CG31613-PA, transcript variant 2 (LOC556568), mRNA Length = 411 Score = 105 bits (53), Expect = 9e-20 Identities = 71/77 (92%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | | Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgactctc 348 Query: 300 ttggcgtgaatggcgca 316 |||||||| |||||||| Sbjct: 347 ttggcgtggatggcgca 331
>ref|NM_214547.1| Strongylocentrotus purpuratus late embryonic histone H3 (LOC373340), mRNA Length = 411 Score = 105 bits (53), Expect = 9e-20 Identities = 74/81 (91%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || |||||||||||||| |||||||||||||| ||||||||||| || |||||| Sbjct: 404 cgctcgccacggatgcggcgggccagctggatgtcctttggcatgatggtaacacgcttg 345 Query: 303 gcgtgaatggcgcaaaggttg 323 ||||| ||||||||||||||| Sbjct: 344 gcgtggatggcgcaaaggttg 324
>gb|M13379.1|MZEH3C4 Maize (Zea mays) histone H3 gene (H3C4), complete cds Length = 1264 Score = 105 bits (53), Expect = 9e-20 Identities = 65/69 (94%) Strand = Plus / Minus Query: 254 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgaatggc 313 ||||||||| |||||||| ||||||||||||||||||||||||||||||||||| ||||| Sbjct: 918 gatgcggcgcgcgagctgaatgtccttgggcatgatggtgacgcgcttggcgtggatggc 859 Query: 314 gcaaaggtt 322 ||| ||||| Sbjct: 858 gcagaggtt 850
>ref|NM_021059.2| Homo sapiens histone 2, H3c (HIST2H3C), mRNA Length = 507 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || |||||||||||||| |||||||||||||||||||| ||||| ||||||||| Sbjct: 440 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 381 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 380 gcgtggatggcgcacaggtt 361
>gb|AY648851.1| Homo sapiens histone H3/o gene, complete cds Length = 1227 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || |||||||||||||| |||||||||||||||||||| ||||| ||||||||| Sbjct: 813 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 754 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 753 gcgtggatggcgcacaggtt 734
>ref|XM_580747.2| PREDICTED: Bos taurus similar to CG31613-PA (LOC504599), mRNA Length = 411 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||||||||||||||| || || ||||||||||| |||||||||||||| ||||||||| Sbjct: 404 cgctccccgcggatgcgacgagccagctggatgtctttgggcatgatggtcacgcgcttg 345 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 344 gcgtggatggcgcacaggtt 325
>emb|CR733515.2|CNS0GSRE Tetraodon nigroviridis full-length cDNA Length = 1545 Score = 103 bits (52), Expect = 3e-19 Identities = 76/84 (90%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||| Sbjct: 520 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtaacgcgc 461 Query: 300 ttggcgtgaatggcgcaaaggttg 323 ||||| || ||||| || |||||| Sbjct: 460 ttggcatggatggcacacaggttg 437
>emb|CR716243.2|CNS0GFLO Tetraodon nigroviridis full-length cDNA Length = 844 Score = 103 bits (52), Expect = 3e-19 Identities = 79/88 (89%) Strand = Plus / Minus Query: 236 ctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 295 |||||| | |||||||||||||||||| || ||||||||||| ||||||||||||||||| Sbjct: 648 ctaggccctctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtgac 589 Query: 296 gcgcttggcgtgaatggcgcaaaggttg 323 | ||||||||| |||||||| |||||| Sbjct: 588 cctcttggcgtggatggcgcacaggttg 561
>gb|BC063540.1| Homo sapiens cDNA clone IMAGE:4523373, **** WARNING: chimeric clone **** Length = 1047 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || |||||||||||||| |||||||||||||||||||| ||||| ||||||||| Sbjct: 417 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 358 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 357 gcgtggatggcgcacaggtt 338
>gb|BC015544.1| Homo sapiens histone 2, H3c, mRNA (cDNA clone IMAGE:3913365) Length = 1672 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || |||||||||||||| |||||||||||||||||||| ||||| ||||||||| Sbjct: 440 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 381 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 380 gcgtggatggcgcacaggtt 361
>ref|XM_781054.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA (LOC581030), mRNA Length = 411 Score = 103 bits (52), Expect = 3e-19 Identities = 67/72 (93%) Strand = Plus / Minus Query: 252 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgaatg 311 ||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||| ||| Sbjct: 395 cggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 336 Query: 312 gcgcaaaggttg 323 ||||| |||||| Sbjct: 335 gcgcacaggttg 324
>emb|X82257.1|DMH33A D.melanogaster mRNA for histone H3.3 variant Length = 772 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||| ||||| || |||||||| | ||| |||||||||||||||||||| ||||||||| Sbjct: 507 taggcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacg 448 Query: 297 cgcttggcgtgaatggcgca 316 |||||||||||||||||||| Sbjct: 447 cgcttggcgtgaatggcgca 428
>gb|AY119629.1| Drosophila melanogaster RE21618 full insert cDNA Length = 824 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||| ||||| || |||||||| | ||| |||||||||||||||||||| ||||||||| Sbjct: 572 taggcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacg 513 Query: 297 cgcttggcgtgaatggcgca 316 |||||||||||||||||||| Sbjct: 512 cgcttggcgtgaatggcgca 493
>ref|NM_078755.2| Drosophila melanogaster Histone H3.3A CG5825-RA, transcript variant A (His3.3A), mRNA Length = 853 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||| ||||| || |||||||| | ||| |||||||||||||||||||| ||||||||| Sbjct: 611 taggcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacg 552 Query: 297 cgcttggcgtgaatggcgca 316 |||||||||||||||||||| Sbjct: 551 cgcttggcgtgaatggcgca 532
>gb|AY071057.1| Drosophila melanogaster RE14004 full length cDNA Length = 824 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||| ||||| || |||||||| | ||| |||||||||||||||||||| ||||||||| Sbjct: 572 taggcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacg 513 Query: 297 cgcttggcgtgaatggcgca 316 |||||||||||||||||||| Sbjct: 512 cgcttggcgtgaatggcgca 493
>ref|XM_928391.1| PREDICTED: Homo sapiens similar to CG31613-PA (LOC653611), mRNA Length = 824 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || |||||||||||||| |||||||||||||||||||| ||||| ||||||||| Sbjct: 693 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 634 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 633 gcgtggatggcgcacaggtt 614
>ref|NG_002617.1| Homo sapiens histone 2, H3a (HIST2H3A) pseudogene on chromosome 1 Length = 1323 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || |||||||||||||| |||||||||||||||||||| ||||| ||||||||| Sbjct: 927 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 868 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 867 gcgtggatggcgcacaggtt 848
>gb|AC008233.3|AC008233 Drosophila melanogaster, chromosome 2L, region 25C-25C, BAC clone BACR13M11, complete sequence Length = 162387 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||| ||||| || |||||||| | ||| |||||||||||||||||||| ||||||||| Sbjct: 112061 taggcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacg 112002 Query: 297 cgcttggcgtgaatggcgca 316 |||||||||||||||||||| Sbjct: 112001 cgcttggcgtgaatggcgca 111982
>ref|NM_001005464.1| Homo sapiens histone H3/o (H3/o), mRNA Length = 411 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || |||||||||||||| |||||||||||||||||||| ||||| ||||||||| Sbjct: 404 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 345 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 344 gcgtggatggcgcacaggtt 325
>gb|BC074969.2| Homo sapiens histone H3/o, mRNA (cDNA clone IMAGE:30915509), partial cds Length = 481 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || |||||||||||||| |||||||||||||||||||| ||||| ||||||||| Sbjct: 432 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 373 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 372 gcgtggatggcgcacaggtt 353
>gb|AF531307.1| Homo sapiens histone H3 (HIST2H3C) gene, complete cds Length = 1227 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || |||||||||||||| |||||||||||||||||||| ||||| ||||||||| Sbjct: 813 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 754 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 753 gcgtggatggcgcacaggtt 734
>gb|AF531305.1| Homo sapiens histone H3 (HIST2H3A) pseudogene, complete sequence Length = 1323 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || |||||||||||||| |||||||||||||||||||| ||||| ||||||||| Sbjct: 927 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 868 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 867 gcgtggatggcgcacaggtt 848
>ref|XM_320335.2| Anopheles gambiae str. PEST ENSANGP00000014183 (ENSANGG00000011694), partial mRNA Length = 411 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||| ||||| || ||||| |||||||| ||||||||||||||||||||||| |||||| Sbjct: 410 taggcacgctcgccacggatacggcgggccagctggatgtccttgggcatgatcgtgacg 351 Query: 297 cgcttggcgtgaatggcgca 316 ||||||||||| |||||||| Sbjct: 350 cgcttggcgtggatggcgca 331
>ref|XM_314446.2| Anopheles gambiae str. PEST ENSANGP00000016066 (ENSANGG00000013577), partial mRNA Length = 411 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||| ||||| || ||||| |||||||| |||||||||||||||||||||||||||||| Sbjct: 410 taggcacgctcgccacggatacggcgggccagctggatgtccttgggcatgatggtgacg 351 Query: 297 cgcttggcgtgaatggcgca 316 |||||||| || |||||||| Sbjct: 350 cgcttggcatggatggcgca 331
>emb|Z56112.1|HS89C12R H.sapiens CpG island DNA genomic Mse1 fragment, clone 89c12, reverse read cpg89c12.rt1a Length = 172 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Plus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || |||||||||||||| |||||||||||||||||||| ||||| ||||||||| Sbjct: 5 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 64 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 65 gcgtggatggcgcacaggtt 84
>emb|Z56111.1|HS89C12F H.sapiens CpG island DNA genomic Mse1 fragment, clone 89c12, forward read cpg89c12.ft1a Length = 171 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || |||||||||||||| |||||||||||||||||||| ||||| ||||||||| Sbjct: 168 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 109 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 108 gcgtggatggcgcacaggtt 89
>emb|Z63365.1|HS81H7R H.sapiens CpG island DNA genomic Mse1 fragment, clone 81h7, reverse read cpg81h7.rt1a Length = 171 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Plus Query: 243 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 302 ||||| || |||||||||||||| |||||||||||||||||||| ||||| ||||||||| Sbjct: 5 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 64 Query: 303 gcgtgaatggcgcaaaggtt 322 ||||| |||||||| ||||| Sbjct: 65 gcgtggatggcgcacaggtt 84
>gb|AE003608.5| Drosophila melanogaster chromosome 2L, section 17 of 83 of the complete sequence Length = 174887 Score = 103 bits (52), Expect = 3e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||| ||||| || |||||||| | ||| |||||||||||||||||||| ||||||||| Sbjct: 114334 taggcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacg 114275 Query: 297 cgcttggcgtgaatggcgca 316 |||||||||||||||||||| Sbjct: 114274 cgcttggcgtgaatggcgca 114255
>gb|BC107980.1| Danio rerio zgc:123334, mRNA (cDNA clone MGC:123334 IMAGE:7396478), complete cds Length = 2575 Score = 101 bits (51), Expect = 1e-18 Identities = 75/83 (90%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||| ||||||||||| || |||||||||||||| | | Sbjct: 464 gcgcgctctccgcggatgcggcgggccagctggatgtcttttggcatgatggtgaccctc 405 Query: 300 ttggcgtgaatggcgcaaaggtt 322 |||||||| |||||||| ||||| Sbjct: 404 ttggcgtggatggcgcacaggtt 382
>ref|NM_001040004.1| Danio rerio zgc:123334 (zgc:123334), mRNA Length = 2575 Score = 101 bits (51), Expect = 1e-18 Identities = 75/83 (90%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||| ||||||||||| || |||||||||||||| | | Sbjct: 464 gcgcgctctccgcggatgcggcgggccagctggatgtcttttggcatgatggtgaccctc 405 Query: 300 ttggcgtgaatggcgcaaaggtt 322 |||||||| |||||||| ||||| Sbjct: 404 ttggcgtggatggcgcacaggtt 382
>emb|Z30939.1|MDH3HIST Mus domesticus partial mRNA for histone H3, CD-1 Length = 287 Score = 101 bits (51), Expect = 1e-18 Identities = 72/79 (91%) Strand = Plus / Minus Query: 245 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 304 |||||| || ||||| ||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 168 ctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 109 Query: 305 gtgaatggcgcaaaggttg 323 ||| |||||||| |||||| Sbjct: 108 gtggatggcgcacaggttg 90
>ref|XM_688063.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC564732), mRNA Length = 441 Score = 101 bits (51), Expect = 1e-18 Identities = 75/83 (90%) Strand = Plus / Minus Query: 240 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 299 |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | | Sbjct: 437 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 378 Query: 300 ttggcgtgaatggcgcaaaggtt 322 || ||||| |||||||| ||||| Sbjct: 377 ttagcgtggatggcgcacaggtt 355
>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and histone H2A genes, complete cds Length = 4358 Score = 101 bits (51), Expect = 1e-18 Identities = 78/87 (89%) Strand = Plus / Plus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||||||||| || |||||||||||||| |||||||||||||||||||||||||| || Sbjct: 267 taggcgcgctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcaca 326 Query: 297 cgcttggcgtgaatggcgcaaaggttg 323 ||||||||| |||||||| |||||| Sbjct: 327 cgcttggcggtgatggcgcacaggttg 353
>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II), histone H2B (ch2b-II) and histone H2A (ch2a-II) genes, complete cds Length = 3777 Score = 101 bits (51), Expect = 1e-18 Identities = 78/87 (89%) Strand = Plus / Plus Query: 237 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 296 ||||| ||||| || |||||||||||||| ||||||||||||||||||||||| || || Sbjct: 245 taggcacgctcgccacggatgcggcgggccagctggatgtccttgggcatgatcgtcaca 304 Query: 297 cgcttggcgtgaatggcgcaaaggttg 323 ||||||||||| |||||||| |||||| Sbjct: 305 cgcttggcgtggatggcgcacaggttg 331
>gb|AF520775.1| Hypocrea jecorina histone H3 gene, complete cds Length = 497 Score = 99.6 bits (50), Expect = 5e-18 Identities = 74/82 (90%) Strand = Plus / Minus Query: 242 gcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgctt 301 |||||| ||||||| |||||||||||||||||||||||||| | ||||||||| ||||| Sbjct: 491 gcgctcaccgcggaggcggcgggcgagctggatgtccttggactggatggtgacacgctt 432 Query: 302 ggcgtgaatggcgcaaaggttg 323 |||||| |||||||| |||||| Sbjct: 431 ggcgtggatggcgcacaggttg 410 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,110,789 Number of Sequences: 3902068 Number of extensions: 2110789 Number of successful extensions: 44868 Number of sequences better than 10.0: 1628 Number of HSP's better than 10.0 without gapping: 1630 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 42666 Number of HSP's gapped (non-prelim): 2195 length of query: 323 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 301 effective length of database: 17,147,199,772 effective search space: 5161307131372 effective search space used: 5161307131372 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
