ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast48h09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC157917.4| Mus musculus chromosome 3, clone RP23-120L6, comp... 40 0.44
2emb|CR388137.8| Zebrafish DNA sequence from clone DKEY-17M13 in ... 40 0.44
3gb|AC161601.4| Mus musculus BAC clone RP23-333L19 from chromosom... 40 0.44
4emb|AJ325646.1|HSA325646 Homo sapiens genomic sequence surroundi... 40 0.44
5gb|AC009731.6|AC009731 Homo sapiens 12 BAC RP11-438N16 (Roswell ... 40 0.44
6emb|Z84492.2|HSLUCA11 Human DNA sequence from clone XXcos-11 on ... 40 0.44
7gb|AC102910.13| Mus musculus chromosome 15, clone RP24-280E23, c... 38 1.7
8gb|AC084385.5| Mus musculus chromosome 15 clone RP23-54K18, comp... 38 1.7
9gb|AC163657.3| Mus musculus BAC clone RP24-302A24 from chromosom... 38 1.7
10gb|AC121517.7| Mus musculus chromosome 15, clone RP23-120A12, co... 38 1.7
11ref|XM_589946.2| PREDICTED: Bos taurus similar to protein phosph... 38 1.7
12gb|AC148004.3| Mus musculus BAC clone RP23-352J18 from chromosom... 38 1.7
13gb|AC145992.2| Pan troglodytes BAC clone RP43-172K3 from 7, comp... 38 1.7
14gb|AC015884.15| Homo sapiens chromosome 17, clone RP11-216P6, co... 38 1.7
15gb|AC117191.4| Mus musculus BAC clone RP23-58O15 from 18, comple... 38 1.7
16emb|BX321878.4| Human DNA sequence from clone XXyac-13CF11 on ch... 38 1.7
17emb|AL365223.19| Human DNA sequence from clone RP11-55K22 on chr... 38 1.7
18emb|AL137793.16| Human DNA sequence from clone RP5-1065P14 on ch... 38 1.7
19gb|AC078828.12| Homo sapiens 3 BAC RP11-779P15 (Roswell Park Can... 38 1.7
20gb|AC112169.2| Homo sapiens chromosome 5 clone CTD-2016H11, comp... 38 1.7
21gb|AC107029.4| Homo sapiens 3 BAC RP11-550H20 (Roswell Park Canc... 38 1.7
22gb|AC010163.8| Homo sapiens chromosome 10 clone RP11-90J7, compl... 38 1.7
23gb|AC147213.3| Pan troglodytes BAC clone RP43-127I22 from chromo... 38 1.7
24emb|AJ342863.1|HSA342863 Homo sapiens genomic sequence surroundi... 38 1.7
25emb|AL732600.4| Human DNA sequence from clone RP11-184E11 on chr... 38 1.7
26gb|AC124828.14| Mus musculus chromosome 5, clone RP24-126A19, co... 36 6.9
27gb|AY663392.1| Triticum aestivum cultivar Renan clone BAC 930H14... 36 6.9
28gb|AY485644.1| Triticum monococcum phosphatidylserine decarboxyl... 36 6.9
29gb|AF488415.1| Triticum monococcum chromosome 7Am BAC 5K14 compl... 36 6.9
30gb|AF326781.1| Triticum monococcum actin (ACT-1) gene, partial c... 36 6.9
31gb|AY146588.1| Triticum monococcum BAC clone 453N11, complete se... 36 6.9
32gb|AY491681.1| Triticum monococcum DV92 BAC 109N23, complete seq... 36 6.9
33gb|AC145905.4| Pan troglodytes BAC clone RP43-9I21 from 7, compl... 36 6.9
34gb|CP000080.1| Leishmania major strain Friedlin chromosome 29, c... 36 6.9
35gb|DQ484013.1| Gymnogyps californianus clone 179G microsatellite... 36 6.9
36gb|DQ483304.1| Gymnogyps californianus clone 7H microsatellite s... 36 6.9
37gb|AC146159.2| Pan troglodytes BAC clone RP43-36O19 from 7, comp... 36 6.9
38gb|AC107664.8| Mus musculus chromosome 17, clone RP23-103F2, com... 36 6.9
39gb|AC122248.5| Mus musculus BAC clone RP23-156N18 from 7, comple... 36 6.9
40gb|AC074359.2| Mus musculus strain C57BL6/J chromosome 5 clone R... 36 6.9
41gb|AC122832.4| Mus musculus BAC clone RP23-179D3 from 12, comple... 36 6.9
42gb|AC112663.9| Mus musculus chromosome 5, clone RP23-465J5, comp... 36 6.9
43gb|AC116479.14| Mus musculus, clone RP23-397F3, complete sequence 36 6.9
44emb|AL513325.13| Human DNA sequence from clone RP11-332L8 on chr... 36 6.9
45gb|AC124158.3| Macaca mulatta clone CH250-337A5, complete sequence 36 6.9
46gb|AC087525.6| Homo sapiens chromosome 15, clone RP11-321G12, co... 36 6.9
47gb|AC015878.7| Homo sapiens, clone RP11-296E23, complete sequence 36 6.9
48gb|AF389851.1| Homo sapiens solute carrier family 12 member 8 (S... 36 6.9
49gb|AC093863.3| Homo sapiens BAC clone RP11-552I10 from 4, comple... 36 6.9
50gb|AC016207.9| Homo sapiens, clone RP11-25H20, complete sequence 36 6.9
51gb|AC092067.2| Homo sapiens chromosome 19 clone CTB-184G21, comp... 36 6.9
52ref|XM_940150.1| PREDICTED: Homo sapiens KIAA1305 (KIAA1305), mRNA 36 6.9
53ref|XM_370756.3| PREDICTED: Homo sapiens KIAA1305 (KIAA1305), mRNA 36 6.9
54dbj|AK156599.1| Mus musculus activated spleen cDNA, RIKEN full-l... 36 6.9
55gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome 36 6.9
56gb|AY951945.1| Triticum monococcum TmBAC 60J11 FR-Am2 locus, gen... 36 6.9
57gb|DP000005.1| Macaca mulatta target 1 genomic scaffold 36 6.9
58gb|DQ267106.1| Triticum urartu clone BAC 210J24 chromosome 4A, c... 36 6.9
59dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 36 6.9
60gb|AC147283.3| Pan troglodytes BAC clone RP43-94K2 from chromoso... 36 6.9
61gb|AC154515.2| Mus musculus BAC clone RP24-81I13 from chromosome... 36 6.9
62gb|AC103736.5| Homo sapiens chromosome 11, clone RP11-703E9, com... 36 6.9
63gb|AC083861.2|AC083861 Homo sapiens chromosome 7 clone RP11-164E... 36 6.9
64gb|AC078843.2|AC078843 Homo sapiens chromosome 7 clone RP11-59F6... 36 6.9
65gb|AC026736.4|AC026736 Homo sapiens chromosome 5 clone CTD-2350M... 36 6.9
66gb|AC091582.17| Homo sapiens chromosome 15, clone RP11-483O19, c... 36 6.9
67gb|AC008080.1|AC008080 Homo sapiens clone RP11-89N17 from 7p14-1... 36 6.9
68gb|AY663391.1| Triticum turgidum cultivar Langdon clone BAC 1156... 36 6.9
69emb|AL844532.18| Mouse DNA sequence from clone RP23-221O14 on ch... 36 6.9
70emb|BX005164.9| Mouse DNA sequence from clone RP23-257P3 on chro... 36 6.9
71emb|BX294161.8| Mouse DNA sequence from clone RP24-205E7 on chro... 36 6.9
72emb|BX511192.4| Zebrafish DNA sequence from clone DKEYP-89C11 in... 36 6.9
73emb|AL132800.4|CNS01DTM Human chromosome 14 DNA sequence BAC R-8... 36 6.9
74gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 36 6.9
75emb|AL928775.2|CNS08CC5 Oryza sativa chromosome 12, . BAC OSJNBa... 36 6.9
76emb|CT010429.11| Mouse DNA sequence from clone RP23-306H20 on ch... 36 6.9
77emb|AL049631.7|HSDJ513M9 Human DNA sequence from clone RP3-513M9... 36 6.9
78emb|AL671901.14| Mouse DNA sequence from clone RP23-238B14 on ch... 36 6.9
79dbj|AB037726.2| Homo sapiens mRNA for KIAA1305 protein, partial cds 36 6.9 
>gb|AC157917.4| Mus musculus chromosome 3, clone RP23-120L6, complete sequence
          Length = 206959

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      aaaaaaaagggggcaggggg 21
              ||||||||||||||||||||
Sbjct: 143976 aaaaaaaagggggcaggggg 143995
to top
>emb|CR388137.8| Zebrafish DNA sequence from clone DKEY-17M13 in linkage group 5,
             complete sequence
          Length = 181599

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 1     caaaaaaaagggggcagggg 20
             ||||||||||||||||||||
Sbjct: 56250 caaaaaaaagggggcagggg 56231
to top
>gb|AC161601.4| Mus musculus BAC clone RP23-333L19 from chromosome 3, complete sequence
          Length = 200393

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      aaaaaaaagggggcaggggg 21
              ||||||||||||||||||||
Sbjct: 100410 aaaaaaaagggggcaggggg 100391
to top
>emb|AJ325646.1|HSA325646 Homo sapiens genomic sequence surrounding NotI site, clone NB6-236S
          Length = 1057

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 7   aaagggggcagggggcaccccctttttt 34
           ||||||| | ||||||||||||||||||
Sbjct: 878 aaaggggccggggggcaccccctttttt 851
to top
>gb|AC009731.6|AC009731 Homo sapiens 12 BAC RP11-438N16 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 172749

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     aaaaaaaagggggcaggggg 21
             ||||||||||||||||||||
Sbjct: 38521 aaaaaaaagggggcaggggg 38502
to top
>emb|Z84492.2|HSLUCA11 Human DNA sequence from clone XXcos-11 on chromosome 3 Contains the 3'
             part of the gene for calcium channel, voltage-dependent, L
             type, alpha 2D subunit (KIAA0558) and the first exon of
             the gene for PL6 protein (deleted in Small Cell Lung
             Carcinoma). Contains ESTs, GSSs and a putative CpG island,
             complete sequence
          Length = 27844

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     aaaaaaaagggggcaggggg 21
             ||||||||||||||||||||
Sbjct: 25551 aaaaaaaagggggcaggggg 25570
to top
>gb|AC102910.13| Mus musculus chromosome 15, clone RP24-280E23, complete sequence
          Length = 179719

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 1      caaaaaaaagggggcaggg 19
              |||||||||||||||||||
Sbjct: 175796 caaaaaaaagggggcaggg 175778
to top
>gb|AC084385.5| Mus musculus chromosome 15 clone RP23-54K18, complete sequence
          Length = 203712

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 1     caaaaaaaagggggcaggg 19
             |||||||||||||||||||
Sbjct: 89172 caaaaaaaagggggcaggg 89154
to top
>gb|AC163657.3| Mus musculus BAC clone RP24-302A24 from chromosome 1, complete sequence
          Length = 197913

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 3      aaaaaaagggggcaggggg 21
              |||||||||||||||||||
Sbjct: 121125 aaaaaaagggggcaggggg 121107
to top
>gb|AC121517.7| Mus musculus chromosome 15, clone RP23-120A12, complete sequence
          Length = 222681

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 1      caaaaaaaagggggcaggg 19
              |||||||||||||||||||
Sbjct: 215911 caaaaaaaagggggcaggg 215929
to top
>ref|XM_589946.2| PREDICTED: Bos taurus similar to protein phosphatase 1, regulatory
           subunit 12C (LOC512431), partial mRNA
          Length = 2678

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 10  gggggcagggggcaccccc 28
           |||||||||||||||||||
Sbjct: 867 gggggcagggggcaccccc 885
to top
>gb|AC148004.3| Mus musculus BAC clone RP23-352J18 from chromosome 18, complete sequence
          Length = 206275

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 5      aaaaagggggcagggggca 23
              |||||||||||||||||||
Sbjct: 167318 aaaaagggggcagggggca 167336
to top
>gb|AC145992.2| Pan troglodytes BAC clone RP43-172K3 from 7, complete sequence
          Length = 208817

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 1    caaaaaaaagggggcagggggca 23
            |||||||| ||||||||||||||
Sbjct: 2405 caaaaaaaggggggcagggggca 2427
to top
>gb|AC015884.15| Homo sapiens chromosome 17, clone RP11-216P6, complete sequence
          Length = 207661

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 2      aaaaaaaagggggcagggg 20
              |||||||||||||||||||
Sbjct: 193985 aaaaaaaagggggcagggg 194003
to top
>gb|AC117191.4| Mus musculus BAC clone RP23-58O15 from 18, complete sequence
          Length = 149461

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 5     aaaaagggggcagggggca 23
             |||||||||||||||||||
Sbjct: 92473 aaaaagggggcagggggca 92491
to top
>emb|BX321878.4| Human DNA sequence from clone XXyac-13CF11 on chromosome 1,
           complete sequence
          Length = 60721

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 7   aaagggggcagggggcacc 25
           |||||||||||||||||||
Sbjct: 216 aaagggggcagggggcacc 234
to top
>emb|AL365223.19| Human DNA sequence from clone RP11-55K22 on chromosome 6 Contains the
             3' end of the PEX7 gene for peroxisomal biogenesis factor
             7 (PTS2R, RCDP1), a ribosomal protein L7a (RPL7A)
             pseudogene, a novel gene, the gene for a novel protein
             similar to 60s ribosomal protein L35a (RPL35A) (possible
             pseudogene), the 3' end of a novel gene and a CpG island,
             complete sequence
          Length = 116855

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 5     aaaaagggggcagggggca 23
             |||||||||||||||||||
Sbjct: 98141 aaaaagggggcagggggca 98159
to top
>emb|AL137793.16| Human DNA sequence from clone RP5-1065P14 on chromosome 1q41-42.2
              Contains a novel pseudogene and a novel gene, complete
              sequence
          Length = 138419

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 7      aaagggggcagggggcacc 25
              |||||||||||||||||||
Sbjct: 136635 aaagggggcagggggcacc 136653
to top
>gb|AC078828.12| Homo sapiens 3 BAC RP11-779P15 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 172043

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 5     aaaaagggggcagggggca 23
             |||||||||||||||||||
Sbjct: 42866 aaaaagggggcagggggca 42884
to top
>gb|AC112169.2| Homo sapiens chromosome 5 clone CTD-2016H11, complete sequence
          Length = 168329

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 3     aaaaaaagggggcaggggg 21
             |||||||||||||||||||
Sbjct: 53263 aaaaaaagggggcaggggg 53281
to top
>gb|AC107029.4| Homo sapiens 3 BAC RP11-550H20 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 182634

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 5     aaaaagggggcagggggca 23
             |||||||||||||||||||
Sbjct: 33280 aaaaagggggcagggggca 33262
to top
>gb|AC010163.8| Homo sapiens chromosome 10 clone RP11-90J7, complete sequence
          Length = 157069

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 8     aagggggcagggggcaccc 26
             |||||||||||||||||||
Sbjct: 14890 aagggggcagggggcaccc 14872
to top
>gb|AC147213.3| Pan troglodytes BAC clone RP43-127I22 from chromosome 7, complete
              sequence
          Length = 205208

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 1      caaaaaaaagggggcagggggca 23
              |||||||| ||||||||||||||
Sbjct: 148966 caaaaaaaggggggcagggggca 148988
to top
>emb|AJ342863.1|HSA342863 Homo sapiens genomic sequence surrounding NotI site, clone
           NL4-BI19R
          Length = 801

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 3   aaaaaaagggggcagggggcacc 25
           |||||||||||| ||||||||||
Sbjct: 661 aaaaaaaggggggagggggcacc 639
to top
>emb|AL732600.4| Human DNA sequence from clone RP11-184E11 on chromosome 1, complete
           sequence
          Length = 25994

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 7   aaagggggcagggggcacc 25
           |||||||||||||||||||
Sbjct: 216 aaagggggcagggggcacc 234
to top
>gb|AC124828.14| Mus musculus chromosome 5, clone RP24-126A19, complete sequence
          Length = 188504

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 18     ggggcacccccttttttt 35
              ||||||||||||||||||
Sbjct: 126061 ggggcacccccttttttt 126044
to top
>gb|AY663392.1| Triticum aestivum cultivar Renan clone BAC 930H14, complete sequence
          Length = 153766

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 10    gggggcagggggcacccc 27
             ||||||||||||||||||
Sbjct: 47898 gggggcagggggcacccc 47915



 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 10    gggggcagggggcacccc 27
             ||||||||||||||||||
Sbjct: 41929 gggggcagggggcacccc 41946
to top
>gb|AY485644.1| Triticum monococcum phosphatidylserine decarboxylase, ZCCT2, ZCCT1, and
              SNF2P genes, complete cds; nucellin pseudogene, complete
              sequence; putative transposase, phosphatidylinositol
              phosphatidylcholine transfer protein sec14 cytosolic-like
              protein, and phytochrome P450-like protein genes, complete
              cds; and unknown genes
          Length = 438828

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 10     gggggcagggggcacccc 27
              ||||||||||||||||||
Sbjct: 423296 gggggcagggggcacccc 423279



 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 10     gggggcagggggcacccc 27
              ||||||||||||||||||
Sbjct: 416318 gggggcagggggcacccc 416301



 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 10     gggggcagggggcacccc 27
              ||||||||||||||||||
Sbjct: 271829 gggggcagggggcacccc 271812



 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 10     gggggcagggggcacccc 27
              ||||||||||||||||||
Sbjct: 264833 gggggcagggggcacccc 264816



 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 10     gggggcagggggcacccc 27
              ||||||||||||||||||
Sbjct: 116098 gggggcagggggcacccc 116115



 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 10     gggggcagggggcacccc 27
              ||||||||||||||||||
Sbjct: 105029 gggggcagggggcacccc 105046
to top
>gb|AF488415.1| Triticum monococcum chromosome 7Am BAC 5K14 complete sequence
          Length = 168746

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 10     gggggcagggggcacccc 27
              ||||||||||||||||||
Sbjct: 165252 gggggcagggggcacccc 165235



 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 10   gggggcagggggcacccc 27
            ||||||||||||||||||
Sbjct: 7449 gggggcagggggcacccc 7432



 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 10  gggggcagggggcacccc 27
           ||||||||||||||||||
Sbjct: 585 gggggcagggggcacccc 568
to top
>gb|AF326781.1| Triticum monococcum actin (ACT-1) gene, partial cds; putative chromosome
              condensation factor (CCF), putative resistance protein
              (RGA-2), putative resistance protein (RGA2) and putative
              nodulin-like-like protein (NLL) gene, complete cds; and
              retrotransposons Josephine, Angela-2, Angela-4, Heidi,
              Greti, Angela-3, Fatima, Erika-1, Angela-6, Angela-5,
              Barbara, Isabelle, Erika-2, and Claudia
          Length = 211009

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 10     gggggcagggggcacccc 27
              ||||||||||||||||||
Sbjct: 189824 gggggcagggggcacccc 189807



 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 10     gggggcagggggcacccc 27
              ||||||||||||||||||
Sbjct: 125000 gggggcagggggcacccc 125017
to top
>gb|AY146588.1| Triticum monococcum BAC clone 453N11, complete sequence
          Length = 285444

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 10    gggggcagggggcacccc 27
             ||||||||||||||||||
Sbjct: 89361 gggggcagggggcacccc 89378



 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 10    gggggcagggggcacccc 27
             ||||||||||||||||||
Sbjct: 73625 gggggcagggggcacccc 73642
to top
>gb|AY491681.1| Triticum monococcum DV92 BAC 109N23, complete sequence
          Length = 101101

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 10    gggggcagggggcacccc 27
             ||||||||||||||||||
Sbjct: 59591 gggggcagggggcacccc 59574



 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 10    gggggcagggggcacccc 27
             ||||||||||||||||||
Sbjct: 52976 gggggcagggggcacccc 52959
to top
>gb|AC145905.4| Pan troglodytes BAC clone RP43-9I21 from 7, complete sequence
          Length = 187893

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 6     aaaagggggcagggggca 23
             ||||||||||||||||||
Sbjct: 77140 aaaagggggcagggggca 77123
to top
>gb|CP000080.1| Leishmania major strain Friedlin chromosome 29, complete sequence
          Length = 1212674

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 8      aagggggcagggggcacc 25
              ||||||||||||||||||
Sbjct: 107009 aagggggcagggggcacc 107026
to top
>gb|DQ484013.1| Gymnogyps californianus clone 179G microsatellite sequence
          Length = 705

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 2   aaaaaaaagggggcaggg 19
           ||||||||||||||||||
Sbjct: 506 aaaaaaaagggggcaggg 489
to top
>gb|DQ483304.1| Gymnogyps californianus clone 7H microsatellite sequence
          Length = 702

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 2   aaaaaaaagggggcaggg 19
           ||||||||||||||||||
Sbjct: 200 aaaaaaaagggggcaggg 217
to top
>gb|AC146159.2| Pan troglodytes BAC clone RP43-36O19 from 7, complete sequence
          Length = 163991

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 6     aaaagggggcagggggca 23
             ||||||||||||||||||
Sbjct: 23286 aaaagggggcagggggca 23269
to top
>gb|AC107664.8| Mus musculus chromosome 17, clone RP23-103F2, complete sequence
          Length = 208198

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 3      aaaaaaagggggcagggg 20
              ||||||||||||||||||
Sbjct: 192281 aaaaaaagggggcagggg 192298
to top
>gb|AC122248.5| Mus musculus BAC clone RP23-156N18 from 7, complete sequence
          Length = 198901

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 2      aaaaaaaagggggcagggggca 23
              |||||||||||||| |||||||
Sbjct: 101471 aaaaaaaagggggcggggggca 101450
to top
>gb|AC074359.2| Mus musculus strain C57BL6/J chromosome 5 clone RP23-289J24, complete
             sequence
          Length = 106041

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 3     aaaaaaagggggcagggg 20
             ||||||||||||||||||
Sbjct: 66140 aaaaaaagggggcagggg 66123
to top
>gb|AC122832.4| Mus musculus BAC clone RP23-179D3 from 12, complete sequence
          Length = 224056

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 3     aaaaaaagggggcagggg 20
             ||||||||||||||||||
Sbjct: 63475 aaaaaaagggggcagggg 63492
to top
>gb|AC112663.9| Mus musculus chromosome 5, clone RP23-465J5, complete sequence
          Length = 228717

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 4      aaaaaagggggcaggggg 21
              ||||||||||||||||||
Sbjct: 182601 aaaaaagggggcaggggg 182584
to top
>gb|AC116479.14| Mus musculus, clone RP23-397F3, complete sequence
          Length = 225423

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 5     aaaaagggggcagggggc 22
             ||||||||||||||||||
Sbjct: 15097 aaaaagggggcagggggc 15080
to top
>emb|AL513325.13| Human DNA sequence from clone RP11-332L8 on chromosome 1 Contains an H+
              transporting ATPase lysosomal accessory protein 2 (ATP6AP2)
              pseudogene, the 5' end o the CRB1 gene for crumbs homolog 1
              (Drosophila) and a mitochondrial ribosomal protein S21
              (MRPS21) pseudogene, complete sequence
          Length = 212888

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 3      aaaaaaagggggcagggggcac 24
              |||||||||||| |||||||||
Sbjct: 210360 aaaaaaagggggaagggggcac 210339
to top
>gb|AC124158.3| Macaca mulatta clone CH250-337A5, complete sequence
          Length = 173421

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 2     aaaaaaaagggggcaggg 19
             ||||||||||||||||||
Sbjct: 65335 aaaaaaaagggggcaggg 65318
to top
>gb|AC087525.6| Homo sapiens chromosome 15, clone RP11-321G12, complete sequence
          Length = 157590

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 3     aaaaaaagggggcagggg 20
             ||||||||||||||||||
Sbjct: 37433 aaaaaaagggggcagggg 37416
to top
>gb|AC015878.7| Homo sapiens, clone RP11-296E23, complete sequence
          Length = 160569

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 2     aaaaaaaagggggcagggggca 23
             |||||||||| |||||||||||
Sbjct: 70531 aaaaaaaaggaggcagggggca 70552
to top
>gb|AF389851.1| Homo sapiens solute carrier family 12 member 8 (SLC12A8) gene, partial
              cds
          Length = 118384

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 18     ggggcacccccttttttt 35
              ||||||||||||||||||
Sbjct: 118335 ggggcacccccttttttt 118352
to top
>gb|AC093863.3| Homo sapiens BAC clone RP11-552I10 from 4, complete sequence
          Length = 164278

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 4      aaaaaagggggcaggggg 21
              ||||||||||||||||||
Sbjct: 150101 aaaaaagggggcaggggg 150118
to top
>gb|AC016207.9| Homo sapiens, clone RP11-25H20, complete sequence
          Length = 169476

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 3    aaaaaaagggggcagggg 20
            ||||||||||||||||||
Sbjct: 4631 aaaaaaagggggcagggg 4648
to top
>gb|AC092067.2| Homo sapiens chromosome 19 clone CTB-184G21, complete sequence
          Length = 61958

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 2     aaaaaaaagggggcaggg 19
             ||||||||||||||||||
Sbjct: 29694 aaaaaaaagggggcaggg 29677
to top
>ref|XM_940150.1| PREDICTED: Homo sapiens KIAA1305 (KIAA1305), mRNA
          Length = 7845

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 11   ggggcagggggcaccccc 28
            ||||||||||||||||||
Sbjct: 6038 ggggcagggggcaccccc 6021
to top
>ref|XM_370756.3| PREDICTED: Homo sapiens KIAA1305 (KIAA1305), mRNA
          Length = 7845

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 11   ggggcagggggcaccccc 28
            ||||||||||||||||||
Sbjct: 6038 ggggcagggggcaccccc 6021
to top
>dbj|AK156599.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
           library, clone:F830032C11 product:hypothetical protein,
           full insert sequence
          Length = 2906

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 18  ggggcacccccttttttt 35
           ||||||||||||||||||
Sbjct: 164 ggggcacccccttttttt 181
to top
>gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome
          Length = 2628784

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 1       caaaaaaaagggggcagg 18
               ||||||||||||||||||
Sbjct: 1544001 caaaaaaaagggggcagg 1543984
to top
>gb|AY951945.1| Triticum monococcum TmBAC 60J11 FR-Am2 locus, genomic sequence
          Length = 103866

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 10    gggggcagggggcacccc 27
             ||||||||||||||||||
Sbjct: 80278 gggggcagggggcacccc 80261



 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 10    gggggcagggggcacccc 27
             ||||||||||||||||||
Sbjct: 73288 gggggcagggggcacccc 73271
to top
>gb|DP000005.1| Macaca mulatta target 1 genomic scaffold
          Length = 1678549

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 2      aaaaaaaagggggcaggg 19
              ||||||||||||||||||
Sbjct: 201399 aaaaaaaagggggcaggg 201382
to top
>gb|DQ267106.1| Triticum urartu clone BAC 210J24 chromosome 4A, complete sequence
          Length = 111912

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 10     gggggcagggggcacccc 27
              ||||||||||||||||||
Sbjct: 107909 gggggcagggggcacccc 107926



 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 10     gggggcagggggcacccc 27
              ||||||||||||||||||
Sbjct: 101102 gggggcagggggcacccc 101119
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                     
Query: 2       aaaaaaaagggggcagggggca 23
               |||||||||||||| |||||||
Sbjct: 8450893 aaaaaaaagggggcggggggca 8450872
to top
>gb|AC147283.3| Pan troglodytes BAC clone RP43-94K2 from chromosome 7, complete
             sequence
          Length = 171112

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 17    gggggcaccccctttttt 34
             ||||||||||||||||||
Sbjct: 56663 gggggcaccccctttttt 56680
to top
>gb|AC154515.2| Mus musculus BAC clone RP24-81I13 from chromosome 14, complete sequence
          Length = 172475

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 5      aaaaagggggcagggggc 22
              ||||||||||||||||||
Sbjct: 148350 aaaaagggggcagggggc 148333
to top
>gb|AC103736.5| Homo sapiens chromosome 11, clone RP11-703E9, complete sequence
          Length = 147226

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 7      aaagggggcagggggcac 24
              ||||||||||||||||||
Sbjct: 113764 aaagggggcagggggcac 113781
to top
>gb|AC083861.2|AC083861 Homo sapiens chromosome 7 clone RP11-164E6, complete sequence
          Length = 147288

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 17    gggggcaccccctttttt 34
             ||||||||||||||||||
Sbjct: 90469 gggggcaccccctttttt 90452
to top
>gb|AC078843.2|AC078843 Homo sapiens chromosome 7 clone RP11-59F6, complete sequence
          Length = 179416

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 17     gggggcaccccctttttt 34
              ||||||||||||||||||
Sbjct: 165969 gggggcaccccctttttt 165986
to top
>gb|AC026736.4|AC026736 Homo sapiens chromosome 5 clone CTD-2350M8, complete sequence
          Length = 108661

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 19    gggcaccccctttttttc 36
             ||||||||||||||||||
Sbjct: 47250 gggcaccccctttttttc 47233
to top
>gb|AC091582.17| Homo sapiens chromosome 15, clone RP11-483O19, complete sequence
          Length = 90065

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 10    gggggcagggggcacccc 27
             ||||||||||||||||||
Sbjct: 59296 gggggcagggggcacccc 59279
to top
>gb|AC008080.1|AC008080 Homo sapiens clone RP11-89N17 from 7p14-15, complete sequence
          Length = 178635

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 6     aaaagggggcagggggca 23
             ||||||||||||||||||
Sbjct: 27095 aaaagggggcagggggca 27078
to top
>gb|AY663391.1| Triticum turgidum cultivar Langdon clone BAC 1156G16, complete sequence
          Length = 187012

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 10     gggggcagggggcacccc 27
              ||||||||||||||||||
Sbjct: 136474 gggggcagggggcacccc 136491
to top
>emb|AL844532.18| Mouse DNA sequence from clone RP23-221O14 on chromosome 2, complete
            sequence
          Length = 207432

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 3    aaaaaaagggggcagggg 20
            ||||||||||||||||||
Sbjct: 5524 aaaaaaagggggcagggg 5541
to top
>emb|BX005164.9| Mouse DNA sequence from clone RP23-257P3 on chromosome X, complete
              sequence
          Length = 168756

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 3      aaaaaaagggggcagggg 20
              ||||||||||||||||||
Sbjct: 150178 aaaaaaagggggcagggg 150161
to top
>emb|BX294161.8| Mouse DNA sequence from clone RP24-205E7 on chromosome X, complete
            sequence
          Length = 28807

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 3    aaaaaaagggggcagggg 20
            ||||||||||||||||||
Sbjct: 7820 aaaaaaagggggcagggg 7803
to top
>emb|BX511192.4| Zebrafish DNA sequence from clone DKEYP-89C11 in linkage group 4,
             complete sequence
          Length = 154256

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 3     aaaaaaagggggcagggg 20
             ||||||||||||||||||
Sbjct: 17062 aaaaaaagggggcagggg 17045
to top
>emb|AL132800.4|CNS01DTM Human chromosome 14 DNA sequence BAC R-80A15 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 185251

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 11     ggggcagggggcaccccc 28
              ||||||||||||||||||
Sbjct: 150266 ggggcagggggcaccccc 150283
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                     
Query: 2       aaaaaaaagggggcagggggca 23
               |||||||||||||| |||||||
Sbjct: 8450776 aaaaaaaagggggcggggggca 8450755
to top
>emb|AL928775.2|CNS08CC5 Oryza sativa chromosome 12, . BAC OSJNBa0030N06 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 146444

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 2     aaaaaaaagggggcagggggca 23
             |||||||||||||| |||||||
Sbjct: 57556 aaaaaaaagggggcggggggca 57535
to top
>emb|CT010429.11| Mouse DNA sequence from clone RP23-306H20 on chromosome 17, complete
             sequence
          Length = 191390

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 3     aaaaaaagggggcagggg 20
             ||||||||||||||||||
Sbjct: 29018 aaaaaaagggggcagggg 29035
to top
>emb|AL049631.7|HSDJ513M9 Human DNA sequence from clone RP3-513M9 on chromosome Xq22.1-22.3,
             complete sequence
          Length = 118047

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 2     aaaaaaaagggggcaggg 19
             ||||||||||||||||||
Sbjct: 59981 aaaaaaaagggggcaggg 59998
to top
>emb|AL671901.14| Mouse DNA sequence from clone RP23-238B14 on chromosome X, complete
              sequence
          Length = 201821

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 3      aaaaaaagggggcagggg 20
              ||||||||||||||||||
Sbjct: 115040 aaaaaaagggggcagggg 115057
to top
>dbj|AB037726.2| Homo sapiens mRNA for KIAA1305 protein, partial cds
          Length = 7296

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 11   ggggcagggggcaccccc 28
            ||||||||||||||||||
Sbjct: 5489 ggggcagggggcaccccc 5472


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 442,775
Number of Sequences: 3902068
Number of extensions: 442775
Number of successful extensions: 142073
Number of sequences better than 10.0: 79
Number of HSP's better than 10.0 without gapping: 79
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 141632
Number of HSP's gapped (non-prelim): 439
length of query: 51
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 31
effective length of database: 17,155,003,908
effective search space: 531805121148
effective search space used: 531805121148
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top