Clone Name	rbast48b02
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AY103710.1| Zea mays PCO123562 mRNA sequence	172	5e-40
2	gb|BT016569.1| Zea mays clone Contig402 mRNA sequence	157	3e-35
3	ref|NM_193707.1| Oryza sativa (japonica cultivar-group), predic...	153	4e-34
4	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	153	4e-34
5	gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare str...	153	4e-34
6	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	153	4e-34
7	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	153	4e-34
8	dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic D...	153	4e-34
9	dbj|AK121750.1| Oryza sativa (japonica cultivar-group) cDNA clon...	153	4e-34
10	ref|XM_475374.1| Oryza sativa (japonica cultivar-group), predic...	149	7e-33
11	gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome...	149	7e-33
12	gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome...	149	7e-33
13	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	149	7e-33
14	dbj|AK099763.1| Oryza sativa (japonica cultivar-group) cDNA clon...	149	7e-33
15	dbj|AK067406.1| Oryza sativa (japonica cultivar-group) cDNA clon...	149	7e-33
16	ref|XM_475081.1| Oryza sativa (japonica cultivar-group), predic...	147	3e-32
17	dbj|AK074018.1| Oryza sativa (japonica cultivar-group) cDNA clon...	147	3e-32
18	gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome...	147	3e-32
19	gb|BT019008.1| Zea mays clone Contig499.F mRNA sequence	125	1e-25
20	gb|BT016301.1| Zea mays clone Contig134 mRNA sequence	117	2e-23
21	gb|AY103585.1| Zea mays PCO123564 mRNA sequence	115	9e-23
22	gb|AY104486.1| Zea mays PCO109435 mRNA sequence	111	1e-21
23	dbj|D38087.1|WHTPH2AA Triticum aestivum mRNA for protein H2A, co...	111	1e-21
24	gb|BT019315.1| Zea mays clone Contig989.F mRNA sequence	107	2e-20
25	gb|AY109370.1| Zea mays CL2029_4 mRNA sequence	103	3e-19
26	dbj|D38090.1|WHTPH2AD Triticum aestivum mRNA for protein H2A, co...	103	3e-19
27	dbj|D38088.1|WHTPH2AB Triticum aestivum mRNA for protein H2A, co...	103	3e-19
28	emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274)	98	2e-17
29	gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complet...	98	2e-17
30	gb|U08225.1|ZMU08225 Zea mays W-22 histone H2A mRNA, complete cds	96	8e-17
31	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	92	1e-15
32	emb|AL662960.3|OSJN00162 Oryza sativa genomic DNA, chromosome 4,...	92	1e-15
33	gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence	88	2e-14
34	gb|AF493985.1| Triticum aestivum H2A-1 gene, partial sequence	78	2e-11
35	gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (...	62	1e-06
36	gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosom...	62	1e-06
37	ref|NM_010436.2| Mus musculus H2A histone family, member X (H2af...	62	1e-06
38	emb|CR700361.2|CNS0G3CL Tetraodon nigroviridis full-length cDNA	62	1e-06
39	emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X	62	1e-06
40	emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X	62	1e-06
41	gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (...	62	1e-06
42	dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells ...	62	1e-06
43	dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RI...	62	1e-06
44	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	62	1e-06
45	dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clon...	62	1e-06
46	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	62	1e-06
47	emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa...	62	1e-06
48	emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa...	62	1e-06
49	emb|BX063165.1|CNS09KWH Single read from an extremity of a full-...	60	5e-06
50	emb|BX063164.1|CNS09KWG Single read from an extremity of a full-...	60	5e-06
51	emb|BX040864.1|CNS093P0 Single read from an extremity of a full-...	60	5e-06
52	emb|BX019683.1|CNS08NCN Single read from an extremity of a full-...	60	5e-06
53	emb|BX016452.1|CNS08KUW Single read from an extremity of a full-...	60	5e-06
54	emb|BX016451.1|CNS08KUV Single read from an extremity of a full-...	60	5e-06
55	emb|BX009846.1|CNS08FRE Single read from an extremity of a full-...	60	5e-06
56	ref|XM_551996.1| Anopheles gambiae str. PEST ENSANGP00000029020 ...	60	5e-06
57	ref|XM_314447.2| Anopheles gambiae str. PEST ENSANGP00000016040 ...	60	5e-06
58	ref|XM_306256.1| Anopheles gambiae str. PEST ENSANGP00000000004 ...	60	5e-06
59	ref|NM_021840.2| Rattus norvegicus histone 2a (H2a), mRNA	58	2e-05
60	gb|BC099140.1| Rattus norvegicus histone 2a, mRNA (cDNA clone MG...	58	2e-05
61	gb|AY389588.1| Hyacinthus orientalis histone H2A mRNA, complete cds	58	2e-05
62	dbj|AB168678.1| Macaca fascicularis testis cDNA clone: QtsA-1409...	56	7e-05
63	gb|AF255740.1|AF255740 Bufo bufo gagarizans histone H1 (H1) and ...	56	7e-05
64	gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependen...	56	7e-05
65	ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA	54	3e-04
66	gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co...	54	3e-04
67	ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudo...	54	3e-04
68	ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone ...	54	3e-04
69	ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone ...	54	3e-04
70	ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone ...	54	3e-04
71	ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone ...	54	3e-04
72	ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone ...	54	3e-04
73	ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone ...	54	3e-04
74	ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone ...	54	3e-04
75	ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone ...	54	3e-04
76	ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone ...	54	3e-04
77	ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone ...	54	3e-04
78	ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone ...	54	3e-04
79	ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone ...	54	3e-04
80	ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone ...	54	3e-04
81	ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone ...	54	3e-04
82	ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, ...	54	3e-04
83	ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, ...	54	3e-04
84	ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone ...	54	3e-04
85	gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with appar...	54	3e-04
86	emb|CR673199.2|CNS0FIET Tetraodon nigroviridis full-length cDNA	54	3e-04
87	emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143	54	3e-04
88	emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones	54	3e-04
89	emb|X59961.1|RNH2AB R.norvegicus genes for H2A and H2B histones	54	3e-04
90	emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B)	54	3e-04
91	emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A)	54	3e-04
92	gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MG...	54	3e-04
93	emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr...	54	3e-04
94	ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA	54	3e-04
95	emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chr...	54	3e-04
96	emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chrom...	54	3e-04
97	emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr...	54	3e-04
98	emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr...	54	3e-04
99	gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MG...	54	3e-04
100	gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MG...	54	3e-04
101	dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKE...	54	3e-04
102	dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length...	54	3e-04
103	dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN fu...	54	3e-04
104	ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA	54	3e-04
105	gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365,...	54	3e-04
106	gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, ...	54	3e-04
107	gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016	54	3e-04
108	gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108	54	3e-04
109	ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA	54	3e-04
110	ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA	54	3e-04
111	ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA	54	3e-04
112	gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone...	54	3e-04
113	dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKE...	54	3e-04
114	dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-l...	54	3e-04
115	ref|NM_021839.1| Rattus norvegicus testis-specific histone 2a (H...	54	3e-04
116	ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA	54	3e-04
117	ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA	54	3e-04
118	ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone...	54	3e-04
119	gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, comp...	54	3e-04
120	gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, comp...	54	3e-04
121	gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, comp...	54	3e-04
122	gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, comp...	54	3e-04
123	gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, comp...	54	3e-04
124	gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, comp...	54	3e-04
125	gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, comp...	54	3e-04
126	gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, comp...	54	3e-04
127	gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene...	54	3e-04
128	gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, comp...	54	3e-04
129	ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA	54	3e-04
130	gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complet...	54	3e-04
131	gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds	54	3e-04
132	gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 ...	54	3e-04
133	gb|BC106331.1| Xenopus laevis cDNA clone MGC:130860 IMAGE:720558...	52	0.001
134	ref|XM_868674.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	52	0.001
135	gb|BC068823.1| Xenopus laevis cDNA clone IMAGE:6635737, partial cds	52	0.001
136	ref|XM_543796.2| PREDICTED: Canis familiaris similar to H2A hist...	52	0.001
137	emb|BX008487.1|CNS08EPN Single read from an extremity of a full-...	52	0.001
138	emb|X14730.1|CMHIST2A Duck H2A histone gene	52	0.001
139	emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A...	52	0.001
140	gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene...	52	0.001
141	ref|NM_178218.2| Mus musculus histone 3, H2a (Hist3h2a), mRNA	50	0.005
142	gb|BC063781.1| Mus musculus histone 3, H2a, mRNA (cDNA clone MGC...	50	0.005
143	gb|BC058119.1| Mus musculus histone 3, H2a, mRNA (cDNA clone IMA...	50	0.005
144	emb|BX007458.1|CNS08DX2 Single read from an extremity of a full-...	50	0.005
145	dbj|AK077568.1| Mus musculus 8 days embryo whole body cDNA, RIKE...	50	0.005
146	dbj|AK051448.1| Mus musculus 12 days embryo spinal ganglion cDNA...	50	0.005
147	dbj|AK087537.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f...	50	0.005
148	dbj|AK015962.1| Mus musculus adult male testis cDNA, RIKEN full-...	50	0.005
149	dbj|AK083155.1| Mus musculus adult male hippocampus cDNA, RIKEN ...	50	0.005
150	dbj|AK082083.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE...	50	0.005
151	ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA	50	0.005
152	gb|AY158926.1| Mus musculus histone protein Hist3h2a gene, compl...	50	0.005
153	gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, comp...	50	0.005
154	emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chr...	50	0.005
155	gb|U95110.1|MMU95110 Mus macedonicus histone H2a pseudogene, com...	50	0.005
156	gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 ...	48	0.018
157	gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 ...	48	0.018
158	gb|AY389592.1| Hyacinthus orientalis histone H2A mRNA, complete cds	48	0.018
159	emb|X02622.1|MMHISHSA Mouse gene fragment for histone H2a	48	0.018
160	dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic D...	48	0.018
161	emb|BX933556.1| Gallus gallus finished cDNA, clone ChEST42h4	48	0.018
162	gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, comp...	48	0.018
163	ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA	48	0.018
164	gb|U95112.1|MCU95112 Mus caroli histone H2a pseudogene, complete...	48	0.018
165	ref|XM_474362.1| Oryza sativa (japonica cultivar-group), predic...	46	0.070
166	gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome...	46	0.070
167	gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome...	46	0.070
168	ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, ...	46	0.070
169	ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, ...	46	0.070
170	ref|XM_425459.1| PREDICTED: Gallus gallus similar to histone 2, ...	46	0.070
171	ref|XM_425455.1| PREDICTED: Gallus gallus similar to histone 2, ...	46	0.070
172	ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, ...	46	0.070
173	ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro...	46	0.070
174	ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal hi...	46	0.070
175	gb|AC147426.2| Oryza sativa chromosome 3 B1377B10 genomic seque...	46	0.070
176	emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4...	46	0.070
177	emb|AL606456.2|OSJN00017 Oryza sativa genomic DNA, chromosome 4,...	46	0.070
178	emb|AJ245999.1|BNA245999 Brassica napus H2A gene for Histone H2A	46	0.070
179	emb|V00413.1|GGH2AX Chicken gene for histone H2A with flanking r...	46	0.070
180	ref|XM_694570.1| PREDICTED: Danio rerio similar to histone H2A (...	46	0.070
181	dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.070
182	emb|AL732353.1| Oryza sativa genomic DNA, chromosome 4, BAC clon...	46	0.070
183	dbj|D11055.1|CHKH2A4H Gallus gallus gene for H2A histone, comple...	46	0.070
184	gb|U38933.1|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, ...	46	0.070
185	gb|U38932.1|GGU38932 Gallus gallus histone H2A (H2A-VII) gene, c...	46	0.070
186	gb|U38931.1|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, co...	46	0.070
187	gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, comp...	46	0.070
188	gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks	46	0.070
189	ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	44	0.28
190	ref|NM_001040642.1| Gallus gallus similar to Histone H1.2 (H1d) ...	44	0.28
191	ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone ...	44	0.28
192	ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone ...	44	0.28
193	ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone ...	44	0.28
194	emb|X01064.1|SGHIS2A3 Rainbow trout histone H2A and H3 genes	44	0.28
195	emb|X01752.1|GGHISH1 Chicken histone H1 gene	44	0.28
196	gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, comple...	44	0.28
197	dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co...	44	0.28
198	ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H...	42	1.1
199	gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC...	42	1.1
200	gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC...	42	1.1
201	ref|NM_177688.2| Mus musculus H2A histone family, member J (H2af...	42	1.1
202	ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA	42	1.1
203	ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone ...	42	1.1
204	gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, comple...	42	1.1
205	gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, compl...	42	1.1
206	emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chr...	42	1.1
207	ref|NM_001030753.1| Gallus gallus histone H2A (H2A-IX), mRNA	42	1.1
208	emb|BX908783.8| Zebrafish DNA sequence from clone DKEY-86M2 in l...	42	1.1
209	emb|BX323796.14| Zebrafish DNA sequence from clone DKEY-106N21 i...	42	1.1
210	gb|DQ397869.1| Cenarchaeum symbiosum clone C04C05, complete sequ...	42	1.1
211	ref|NM_001024282.1| Rattus norvegicus Histone H2a (predicted) (R...	42	1.1
212	ref|XM_688696.1| PREDICTED: Danio rerio similar to histone H2A (...	42	1.1
213	dbj|AK053755.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f...	42	1.1
214	gb|BC099606.1| Mus musculus H2A histone family, member J, mRNA (...	42	1.1
215	gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (...	42	1.1
216	gb|U38934.1|GGU38934 Gallus gallus histone H2A (H2A-IX) gene, co...	42	1.1
217	gb|U95113.1|RNU95113 Rattus norvegicus histone H2a gene, complet...	42	1.1
218	gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1),...	42	1.1
219	gb|AY131974.1| Homo sapiens histone H2A (HIST3H2A) gene, complet...	42	1.1
220	gb|BC060324.1| Homo sapiens histone 2, H2ac, mRNA (cDNA clone MG...	40	4.3
221	ref|XM_511661.1| PREDICTED: Pan troglodytes similar to Galectin-...	40	4.3
222	ref|XM_527249.1| PREDICTED: Pan troglodytes similar to H2A histo...	40	4.3
223	gb|BC107354.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG...	40	4.3
224	gb|BC107355.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG...	40	4.3
225	ref|XM_513764.1| PREDICTED: Pan troglodytes LOC457261 (LOC457261...	40	4.3
226	ref|NM_003517.2| Homo sapiens histone 2, H2ac (HIST2H2AC), mRNA	40	4.3
227	ref|NM_006632.1| Homo sapiens solute carrier family 17 (sodium p...	40	4.3
228	gb|AY648852.1| Homo sapiens histone H2A/r gene, complete cds	40	4.3
229	ref|NM_175658.1| Mus musculus histone 1, H2aa (Hist1h2aa), mRNA	40	4.3
230	gb|AY389715.1| Hyacinthus orientalis histone H2A-like protein mR...	40	4.3
231	gb|BC019308.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG...	40	4.3
232	gb|BC001629.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG...	40	4.3
233	ref|XM_583595.2| PREDICTED: Bos taurus similar to Histone H2A.1 ...	40	4.3
234	ref|NM_003516.2| Homo sapiens histone 2, H2aa (HIST2H2AA), mRNA	40	4.3
235	gb|AC167023.2| Mus musculus BAC clone RP23-21J7 from chromosome ...	40	4.3
236	ref|XM_540292.2| PREDICTED: Canis familiaris similar to histone ...	40	4.3
237	ref|XM_845715.1| PREDICTED: Canis familiaris similar to Histone ...	40	4.3
238	ref|XM_540286.2| PREDICTED: Canis familiaris similar to Histone ...	40	4.3
239	gb|AC125226.3| Mus musculus BAC clone RP23-39D21 from 7, complet...	40	4.3
240	gb|AC143340.4| Medicago truncatula clone mth2-7f4, complete sequ...	40	4.3
241	gb|AC137836.25| Medicago truncatula clone mth2-10f14, complete s...	40	4.3
242	gb|AC139290.15| Medicago truncatula clone mth2-23f4, complete se...	40	4.3
243	emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch...	40	4.3
244	gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome	40	4.3
245	emb|AL138726.12| Human DNA sequence from clone RP1-139G21 on chr...	40	4.3
246	emb|AL050344.31|HSJ799D16 Human DNA sequence from clone RP4-799D...	40	4.3
247	gb|AC137931.3| Oryza sativa (japonica cultivar-group) chromosome...	40	4.3
248	ref|XM_967564.1| PREDICTED: Tribolium castaneum similar to CG435...	40	4.3
249	emb|BX072218.1|CNS09RVY Single read from an extremity of a full-...	40	4.3
250	emb|BX038155.1|CNS091LR Single read from an extremity of a full-...	40	4.3
251	emb|BX572603.1| Rhodopseudomonas palustris CGA009 complete genom...	40	4.3
252	emb|AL606464.11| Mouse DNA sequence from clone RP23-462P2 on chr...	40	4.3
253	gb|AC118670.2| Genomic sequence for Oryza sativa, Nipponbare sta...	40	4.3
254	gb|AC103809.2| Homo sapiens chromosome 17, clone RP11-647F2, com...	40	4.3
255	gb|DQ381152.1| Bos taurus BTA17 39037 genomic sequence contig co...	40	4.3
256	gb|AC113383.2| Homo sapiens chromosome 5 clone RP11-336F20, comp...	40	4.3
257	gb|AF098457.1|AF098457 Homo sapiens H2A/t pseudogene, complete s...	40	4.3
258	ref|XM_940760.1| PREDICTED: Homo sapiens similar to Galectin-3 b...	40	4.3
259	ref|XM_371078.2| PREDICTED: Homo sapiens similar to Galectin-3 b...	40	4.3
260	gb|U90545.1|HSU90545 Human sodium phosphate transporter (NPT4) m...	40	4.3
261	ref|XM_928387.1| PREDICTED: Homo sapiens similar to Histone H2A....	40	4.3
262	emb|CR541872.1| Homo sapiens full open reading frame cDNA clone ...	40	4.3
263	emb|CR536525.1| Homo sapiens full open reading frame cDNA clone ...	40	4.3
264	gb|AC149601.3| Medicago truncatula chromosome 7 BAC clone mth2-2...	40	4.3
265	gb|AC026440.4|AC026440 Homo sapiens chromosome 5 clone CTD-2269F...	40	4.3
266	ref|NG_002685.1| Homo sapiens histone 1, H2a, pseudogene 2 (HIST...	40	4.3
267	gb|AE006470.1| Chlorobium tepidum TLS, complete genome	40	4.3
268	gb|AC148038.3| Ovis aries clone CH243-361I2, complete sequence	40	4.3
269	gb|AC055863.16| Homo sapiens chromosome 17, clone RP11-478P5, co...	40	4.3
270	gb|AY158921.1| Mus musculus histone protein Hist1h2aa gene, comp...	40	4.3
271	gb|AY894055.1| Synthetic construct Homo sapiens clone FLH131281....	40	4.3
272	gb|AY894054.1| Synthetic construct Homo sapiens clone FLH130836....	40	4.3
273	dbj|AK107121.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	4.3
274	gb|BC098171.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG...	40	4.3
275	gb|BC096705.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG...	40	4.3
276	gb|BC096739.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG...	40	4.3
277	emb|Z54810.1|HS166G8F H.sapiens CpG island DNA genomic Mse1 frag...	40	4.3
278	emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple...	40	4.3
279	emb|CR954185.2| Medicago truncatula chromosome 5 clone mth4-20m5...	40	4.3
280	gb|AC099692.4| Mus musculus chromosome 13, clone RP23-198N22, co...	40	4.3
281	gb|L19779.1|HUMH2A2A Homo sapiens histone H2A.2 mRNA, complete cds	40	4.3
282	gb|AC141892.4| Mus musculus BAC clone RP23-388J12 from 13, compl...	40	4.3
283	gb|U70133.1|BBU70133 Bufo bufo gagarizans replication-dependent ...	40	4.3
284	gb|AY131973.1| Homo sapiens histone H2A (HIST2H2AC) gene, comple...	40	4.3
285	gb|AY131972.1| Homo sapiens histone H2A (HIST2H2AB) gene, comple...	40	4.3
286	gb|AY131971.1| Homo sapiens histone H2A (HIST2H2AA) gene, comple...	40	4.3
287	dbj|AB065914.1| Homo sapiens gene for seven transmembrane helix ...	40	4.3

---

>gb|AY103710.1| Zea mays PCO123562 mRNA sequence
          Length = 770

 Score =  172 bits (87), Expect = 5e-40
 Identities = 143/161 (88%), Gaps = 3/161 (1%)
 Strand = Plus / Minus

                                                                       
Query: 139 gccttcttgggggacttggcggccttcttgggcgacttgccctccttgggctcc---ttc 195
           ||||||||||||||||||||||||||||||||||||||| ||||||||| | ||   |||
Sbjct: 560 gccttcttgggggacttggcggccttcttgggcgacttggcctccttggccgccgccttc 501

                                                                       
Query: 196 tccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcg 255
           ||||| ||| ||||||| || ||||||||||||||||| || || ||||||||||| |||
Sbjct: 500 tccgcggtcttcttgggcaggagcaccgggttgatgttggggaggacgccgccgtgggcg 441

                                                    
Query: 256 atggtgacgccggccagcagcctcccgagctcctggtcgtt 296
           ||||||||||||| ||||||| | |||||||||| ||||||
Sbjct: 440 atggtgacgccggacagcagcttgccgagctcctcgtcgtt 400

---

>gb|BT016569.1| Zea mays clone Contig402 mRNA sequence
          Length = 719

 Score =  157 bits (79), Expect = 3e-35
 Identities = 141/161 (87%), Gaps = 3/161 (1%)
 Strand = Plus / Minus

                                                                       
Query: 139 gccttcttgggggacttggcggccttcttgggcgacttgccctccttgggctcc---ttc 195
           ||||||||||||||||||| || ||||||||| |||||| ||||||||||| ||   |||
Sbjct: 560 gccttcttgggggacttggggggcttcttgggggacttggcctccttgggcgccgccttc 501

                                                                       
Query: 196 tccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcg 255
           ||||| ||| ||||||| || ||||||||||||||||| || || ||||||||||| |||
Sbjct: 500 tccgcggtcttcttgggcaggagcaccgggttgatgttggggaggacgccgccgtgggcg 441

                                                    
Query: 256 atggtgacgccggccagcagcctcccgagctcctggtcgtt 296
           ||||||||||||| ||||||| | |||||||||| ||||||
Sbjct: 440 atggtgacgccggacagcagcttgccgagctcctcgtcgtt 400

---

>ref|NM_193707.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 480

 Score =  153 bits (77), Expect = 4e-34
 Identities = 101/109 (92%)
 Strand = Plus / Minus

                                                                       
Query: 191 ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
           |||||||||||||| ||||||| |||||||||||||||||||| ||||||||||| ||||
Sbjct: 412 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 353

                                                            
Query: 251 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcct 299
           |||||||||| ||||||||||||||| | |||||||||| |||||||||
Sbjct: 352 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcct 304



 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 47/52 (90%), Gaps = 3/52 (5%)
 Strand = Plus / Minus

                                                               
Query: 138 ggccttcttgggggacttggcggcc---ttcttgggcgacttgccctccttg 186
           ||||||||||||||||||| |||||   ||||||||||||||| ||||||||
Sbjct: 477 ggccttcttgggggacttgccggccgccttcttgggcgacttggcctccttg 426

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  153 bits (77), Expect = 4e-34
 Identities = 101/109 (92%)
 Strand = Plus / Plus

                                                                           
Query: 191     ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
               |||||||||||||| ||||||| |||||||||||||||||||| ||||||||||| ||||
Sbjct: 9471210 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 9471269

                                                                
Query: 251     gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcct 299
               |||||||||| ||||||||||||||| | |||||||||| |||||||||
Sbjct: 9471270 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcct 9471318



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 48/52 (92%), Gaps = 3/52 (5%)
 Strand = Plus / Plus

                                                                   
Query: 138     ggccttcttgggggactt---ggcggccttcttgggcgacttgccctccttg 186
               ||||||||||||||||||   |||||||||||||||||||||| ||||||||
Sbjct: 9471145 ggccttcttgggggacttcccggcggccttcttgggcgacttggcctccttg 9471196



 Score = 46.1 bits (23), Expect = 0.070
 Identities = 74/91 (81%)
 Strand = Plus / Minus

                                                                            
Query: 206      tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
                ||||||| ||||| ||| | | |||||| |||||||||||||||   ||||| |||||| 
Sbjct: 28998341 tcttgggaagcaggacctgctggatgttgggcagcacgccgccggcggcgatcgtgacgg 28998282

                                               
Query: 266      cggccagcagcctcccgagctcctggtcgtt 296
                 | |||||||||| |  ||||||| ||||||
Sbjct: 28998281 tgcccagcagcctgctcagctcctcgtcgtt 28998251



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 153      cttggcggccttcttgggcgacttgccctcct 184
                ||||||| ||||||||||||||| || |||||
Sbjct: 10411003 cttggcgcccttcttgggcgactcgctctcct 10410972

---

>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0002D01, from chromosome 3, complete sequence
          Length = 187589

 Score =  153 bits (77), Expect = 4e-34
 Identities = 101/109 (92%)
 Strand = Plus / Plus

                                                                          
Query: 191    ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
              |||||||||||||| ||||||| |||||||||||||||||||| ||||||||||| ||||
Sbjct: 168610 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 168669

                                                               
Query: 251    gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcct 299
              |||||||||| ||||||||||||||| | |||||||||| |||||||||
Sbjct: 168670 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcct 168718



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 48/52 (92%), Gaps = 3/52 (5%)
 Strand = Plus / Plus

                                                                  
Query: 138    ggccttcttgggggactt---ggcggccttcttgggcgacttgccctccttg 186
              ||||||||||||||||||   |||||||||||||||||||||| ||||||||
Sbjct: 168545 ggccttcttgggggacttcccggcggccttcttgggcgacttggcctccttg 168596

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  153 bits (77), Expect = 4e-34
 Identities = 101/109 (92%)
 Strand = Plus / Plus

                                                                           
Query: 191     ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
               |||||||||||||| ||||||| |||||||||||||||||||| ||||||||||| ||||
Sbjct: 9469331 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 9469390

                                                                
Query: 251     gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcct 299
               |||||||||| ||||||||||||||| | |||||||||| |||||||||
Sbjct: 9469391 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcct 9469439



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 48/52 (92%), Gaps = 3/52 (5%)
 Strand = Plus / Plus

                                                                   
Query: 138     ggccttcttgggggactt---ggcggccttcttgggcgacttgccctccttg 186
               ||||||||||||||||||   |||||||||||||||||||||| ||||||||
Sbjct: 9469266 ggccttcttgggggacttcccggcggccttcttgggcgacttggcctccttg 9469317



 Score = 46.1 bits (23), Expect = 0.070
 Identities = 74/91 (81%)
 Strand = Plus / Minus

                                                                            
Query: 206      tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
                ||||||| ||||| ||| | | |||||| |||||||||||||||   ||||| |||||| 
Sbjct: 29089763 tcttgggaagcaggacctgctggatgttgggcagcacgccgccggcggcgatcgtgacgg 29089704

                                               
Query: 266      cggccagcagcctcccgagctcctggtcgtt 296
                 | |||||||||| |  ||||||| ||||||
Sbjct: 29089703 tgcccagcagcctgctcagctcctcgtcgtt 29089673



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 153      cttggcggccttcttgggcgacttgccctcct 184
                ||||||| ||||||||||||||| || |||||
Sbjct: 10409104 cttggcgcccttcttgggcgactcgctctcct 10409073

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  153 bits (77), Expect = 4e-34
 Identities = 101/109 (92%)
 Strand = Plus / Minus

                                                                            
Query: 191      ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
                |||||||||||||| ||||||| |||||||||||||||||||| ||||||||||| ||||
Sbjct: 17417162 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 17417103

                                                                 
Query: 251      gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcct 299
                |||||||||| ||||||||||||||| | |||||||||| |||||||||
Sbjct: 17417102 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcct 17417054



 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 47/52 (90%), Gaps = 3/52 (5%)
 Strand = Plus / Minus

                                                                    
Query: 138      ggccttcttgggggacttggcggcc---ttcttgggcgacttgccctccttg 186
                ||||||||||||||||||| |||||   ||||||||||||||| ||||||||
Sbjct: 17417227 ggccttcttgggggacttgccggccgccttcttgggcgacttggcctccttg 17417176



 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                        
Query: 137      cggccttcttgggggacttggcgg 160
                ||||||||||||||||||||||||
Sbjct: 43063467 cggccttcttgggggacttggcgg 43063444

---

>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0507H06
          Length = 136351

 Score =  153 bits (77), Expect = 4e-34
 Identities = 101/109 (92%)
 Strand = Plus / Minus

                                                                         
Query: 191   ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
             |||||||||||||| ||||||| |||||||||||||||||||| ||||||||||| ||||
Sbjct: 70554 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 70495

                                                              
Query: 251   gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcct 299
             |||||||||| ||||||||||||||| | |||||||||| |||||||||
Sbjct: 70494 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcct 70446



 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 47/52 (90%), Gaps = 3/52 (5%)
 Strand = Plus / Minus

                                                                 
Query: 138   ggccttcttgggggacttggcggcc---ttcttgggcgacttgccctccttg 186
             ||||||||||||||||||| |||||   ||||||||||||||| ||||||||
Sbjct: 70619 ggccttcttgggggacttgccggccgccttcttgggcgacttggcctccttg 70568

---

>dbj|AK121750.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087I02, full
           insert sequence
          Length = 754

 Score =  153 bits (77), Expect = 4e-34
 Identities = 101/109 (92%)
 Strand = Plus / Minus

                                                                       
Query: 191 ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
           |||||||||||||| ||||||| |||||||||||||||||||| ||||||||||| ||||
Sbjct: 502 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 443

                                                            
Query: 251 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcct 299
           |||||||||| ||||||||||||||| | |||||||||| |||||||||
Sbjct: 442 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcct 394



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 48/52 (92%), Gaps = 3/52 (5%)
 Strand = Plus / Minus

                                                               
Query: 138 ggccttcttgggggactt---ggcggccttcttgggcgacttgccctccttg 186
           ||||||||||||||||||   |||||||||||||||||||||| ||||||||
Sbjct: 567 ggccttcttgggggacttcccggcggccttcttgggcgacttggcctccttg 516

---

>ref|XM_475374.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 492

 Score =  149 bits (75), Expect = 7e-33
 Identities = 87/91 (95%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           |||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||
Sbjct: 391 tcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgacgc 332

                                          
Query: 266 cggccagcagcctcccgagctcctggtcgtt 296
           ||||||||||| |||||||||||| ||||||
Sbjct: 331 cggccagcagcttcccgagctcctcgtcgtt 301

---

>gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02,
            complete sequence
          Length = 93826

 Score =  149 bits (75), Expect = 7e-33
 Identities = 87/91 (95%)
 Strand = Plus / Plus

                                                                        
Query: 206  tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
            |||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||
Sbjct: 7379 tcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgacgc 7438

                                           
Query: 266  cggccagcagcctcccgagctcctggtcgtt 296
            ||||||||||| |||||||||||| ||||||
Sbjct: 7439 cggccagcagcttcccgagctcctcgtcgtt 7469

---

>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05,
              complete sequence
          Length = 163130

 Score =  149 bits (75), Expect = 7e-33
 Identities = 87/91 (95%)
 Strand = Plus / Plus

                                                                          
Query: 206    tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
              |||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||
Sbjct: 101736 tcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgacgc 101795

                                             
Query: 266    cggccagcagcctcccgagctcctggtcgtt 296
              ||||||||||| |||||||||||| ||||||
Sbjct: 101796 cggccagcagcttcccgagctcctcgtcgtt 101826

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  149 bits (75), Expect = 7e-33
 Identities = 87/91 (95%)
 Strand = Plus / Plus

                                                                            
Query: 206      tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
                |||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||
Sbjct: 22512329 tcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgacgc 22512388

                                               
Query: 266      cggccagcagcctcccgagctcctggtcgtt 296
                ||||||||||| |||||||||||| ||||||
Sbjct: 22512389 cggccagcagcttcccgagctcctcgtcgtt 22512419



 Score =  147 bits (74), Expect = 3e-32
 Identities = 98/106 (92%)
 Strand = Plus / Minus

                                                                          
Query: 191    ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
              |||||||||| ||| |||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 707417 ccttctccgcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgt 707358

                                                            
Query: 251    gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgtt 296
              ||||||||||||| ||||| |||||| |||||||||||| ||||||
Sbjct: 707357 gcgcgatggtgaccccggcgagcagcttcccgagctcctcgtcgtt 707312

---

>dbj|AK099763.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094K03, full
           insert sequence
          Length = 912

 Score =  149 bits (75), Expect = 7e-33
 Identities = 87/91 (95%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           |||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||
Sbjct: 461 tcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgacgc 402

                                          
Query: 266 cggccagcagcctcccgagctcctggtcgtt 296
           ||||||||||| |||||||||||| ||||||
Sbjct: 401 cggccagcagcttcccgagctcctcgtcgtt 371

---

>dbj|AK067406.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013099N23, full
           insert sequence
          Length = 1097

 Score =  149 bits (75), Expect = 7e-33
 Identities = 87/91 (95%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           |||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||
Sbjct: 462 tcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgacgc 403

                                          
Query: 266 cggccagcagcctcccgagctcctggtcgtt 296
           ||||||||||| |||||||||||| ||||||
Sbjct: 402 cggccagcagcttcccgagctcctcgtcgtt 372

---

>ref|XM_475081.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 522

 Score =  147 bits (74), Expect = 3e-32
 Identities = 98/106 (92%)
 Strand = Plus / Minus

                                                                       
Query: 191 ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
           |||||||||| ||| |||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 454 ccttctccgcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgt 395

                                                         
Query: 251 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgtt 296
           ||||||||||||| ||||| |||||| |||||||||||| ||||||
Sbjct: 394 gcgcgatggtgaccccggcgagcagcttcccgagctcctcgtcgtt 349

---

>dbj|AK074018.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033075N03, full
           insert sequence
          Length = 797

 Score =  147 bits (74), Expect = 3e-32
 Identities = 98/106 (92%)
 Strand = Plus / Minus

                                                                       
Query: 191 ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
           |||||||||| ||| |||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 480 ccttctccgcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgt 421

                                                         
Query: 251 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgtt 296
           ||||||||||||| ||||| |||||| |||||||||||| ||||||
Sbjct: 420 gcgcgatggtgaccccggcgagcagcttcccgagctcctcgtcgtt 375

---

>gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0041A22, complete sequence
          Length = 117919

 Score =  147 bits (74), Expect = 3e-32
 Identities = 98/106 (92%)
 Strand = Plus / Minus

                                                                         
Query: 191   ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
             |||||||||| ||| |||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 52616 ccttctccgcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgt 52557

                                                           
Query: 251   gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgtt 296
             ||||||||||||| ||||| |||||| |||||||||||| ||||||
Sbjct: 52556 gcgcgatggtgaccccggcgagcagcttcccgagctcctcgtcgtt 52511

---

>gb|BT019008.1| Zea mays clone Contig499.F mRNA sequence
          Length = 674

 Score =  125 bits (63), Expect = 1e-25
 Identities = 97/107 (90%), Gaps = 1/107 (0%)
 Strand = Plus / Minus

                                                                       
Query: 191 ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
           |||||||||||||| ||||||| ||||| |||||||||||||| |||| |||||||||||
Sbjct: 463 ccttctccgccgtcttcttgggcagcaggaccgggttgatgttgggcaacacgccgccgt 404

                                                          
Query: 251 gcgcgatggtgacgccggccagcagcc-tcccgagctcctggtcgtt 296
           | |||||||| ||||||| |||||||| |||||||||||| ||||||
Sbjct: 403 gggcgatggtcacgccggtcagcagccttcccgagctcctcgtcgtt 357



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 47/48 (97%)
 Strand = Plus / Minus

                                                           
Query: 139 gccttcttgggggacttggcggccttcttgggcgacttgccctccttg 186
           ||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 527 gccttcttgggggacttggcggccttcttgggcgacttggcctccttg 480

---

>gb|BT016301.1| Zea mays clone Contig134 mRNA sequence
          Length = 846

 Score =  117 bits (59), Expect = 2e-23
 Identities = 83/91 (91%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           |||||||||||||||| ||||||||||| ||||| || |||||||| |||||||||||||
Sbjct: 395 tcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacgc 336

                                          
Query: 266 cggccagcagcctcccgagctcctggtcgtt 296
           ||||||| ||| |||||||||||| ||||||
Sbjct: 335 cggccagtagcttcccgagctcctcgtcgtt 305

---

>gb|AY103585.1| Zea mays PCO123564 mRNA sequence
          Length = 1953

 Score =  115 bits (58), Expect = 9e-23
 Identities = 94/106 (88%)
 Strand = Plus / Minus

                                                                       
Query: 191 ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
           |||||||||||| | ||||||| || ||||| | || |||||| || || ||||||||||
Sbjct: 623 ccttctccgccgccttcttgggcaggagcacggagtggatgttggggaggacgccgccgt 564

                                                         
Query: 251 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgtt 296
           |||||||||||||||||||||||||| |||||||||||| ||||||
Sbjct: 563 gcgcgatggtgacgccggccagcagcttcccgagctcctcgtcgtt 518



 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 139 gccttcttgggggacttggcggccttcttgggcgacttgccctccttg 186
           ||||||||||||||||||||| |||||||||| ||||||  |||||||
Sbjct: 687 gccttcttgggggacttggcgcccttcttgggggacttgggctccttg 640

---

>gb|AY104486.1| Zea mays PCO109435 mRNA sequence
          Length = 992

 Score =  111 bits (56), Expect = 1e-21
 Identities = 77/84 (91%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           |||||||||||||||| ||||||||||| ||||| || |||||||| |||||||||||||
Sbjct: 466 tcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacgc 407

                                   
Query: 266 cggccagcagcctcccgagctcct 289
           ||||||| ||| ||||||||||||
Sbjct: 406 cggccagtagcttcccgagctcct 383

---

>dbj|D38087.1|WHTPH2AA Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-2
          Length = 717

 Score =  111 bits (56), Expect = 1e-21
 Identities = 98/112 (87%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           |||||||||||||||| | ||||||||| || |  ||||||||||| |||||||||||||
Sbjct: 434 tcttggggagcagcacggagttgatgttggggatgacgccgccgtgggcgatggtgacgc 375

                                                               
Query: 266 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtg 317
           |||| |||||||| ||||||||||||||||| |  ||||| || ||||||||
Sbjct: 374 cggcgagcagcctgccgagctcctggtcgttgcggacggccagcagcaggtg 323



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 141 cttcttgggggacttggcggc 161
           |||||||||||||||||||||
Sbjct: 499 cttcttgggggacttggcggc 479

---

>gb|BT019315.1| Zea mays clone Contig989.F mRNA sequence
          Length = 699

 Score =  107 bits (54), Expect = 2e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                       
Query: 191 ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
           |||||||||||| | ||||||| || ||||| | || |||||| || || ||||| ||||
Sbjct: 474 ccttctccgccgccttcttgggcaggagcacggagtggatgttggggaggacgccaccgt 415

                                                         
Query: 251 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgtt 296
           |||||||||||||||||||||||||| |||||||||||| ||||||
Sbjct: 414 gcgcgatggtgacgccggccagcagcttcccgagctcctcgtcgtt 369



 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 139 gccttcttgggggacttggcggccttcttgggcgacttgccctccttg 186
           ||||||||||||||||||||| |||||||||| ||||||  |||||||
Sbjct: 538 gccttcttgggggacttggcgcccttcttgggggacttgggctccttg 491

---

>gb|AY109370.1| Zea mays CL2029_4 mRNA sequence
          Length = 1051

 Score =  103 bits (52), Expect = 3e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                       
Query: 191 ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
           |||||||||||||| ||||||| ||||| || |||||||| || || ||||| |||||||
Sbjct: 499 ccttctccgccgtcttcttgggcagcagaacagggttgatattggggagcacaccgccgt 440

                                                           
Query: 251 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcc 298
           | |||||||| |||||| |||||||| |||| ||||||| ||||||||
Sbjct: 439 gagcgatggtcacgccgcccagcagcttcccaagctcctcgtcgttcc 392



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 152 acttggcggccttcttgggcgacttgccctccttg 186
           |||||||||||||||||||||||||  ||||||||
Sbjct: 550 acttggcggccttcttgggcgactttgcctccttg 516

---

>dbj|D38090.1|WHTPH2AD Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-9
          Length = 704

 Score =  103 bits (52), Expect = 3e-19
 Identities = 97/112 (86%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           |||||||||||||||| | ||||||||| || | |||||| ||||| |||||||||||||
Sbjct: 411 tcttggggagcagcacggagttgatgttggggatcacgccaccgtgggcgatggtgacgc 352

                                                               
Query: 266 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtg 317
           | || |||||||| ||||||||||||||||| |  || ||||| ||||||||
Sbjct: 351 cagcgagcagcctgccgagctcctggtcgttgcggacagcgagcagcaggtg 300



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 162 cttcttgggcgacttgccctcctt 185
           |||||||||||||||| |||||||
Sbjct: 455 cttcttgggcgacttggcctcctt 432

---

>dbj|D38088.1|WHTPH2AB Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-3
          Length = 1153

 Score =  103 bits (52), Expect = 3e-19
 Identities = 97/112 (86%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           |||||||||||||||| | ||||||||| || |  ||||||||||| |||||||||||||
Sbjct: 432 tcttggggagcagcacggagttgatgttggggatgacgccgccgtgggcgatggtgacgc 373

                                                               
Query: 266 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtg 317
           |||| |||||||| || |||||||||||||| |  ||||| || ||||||||
Sbjct: 372 cggcgagcagcctgcccagctcctggtcgttgcggacggccagcagcaggtg 321

---

>emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274)
          Length = 2546

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 70/77 (90%)
 Strand = Plus / Minus

                                                                        
Query: 241  acgccgccgtgcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctc 300
            ||||||||||| ||||||||||||||||| |||||||| ||||||||||||||||| |  
Sbjct: 2198 acgccgccgtgggcgatggtgacgccggcaagcagcctgccgagctcctggtcgttgcgg 2139

                             
Query: 301  acggcgaggagcaggtg 317
            |||||||| ||||||||
Sbjct: 2138 acggcgagcagcaggtg 2122



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 162  cttcttgggcgacttgccctcctt 185
            |||||||||||||||| |||||||
Sbjct: 2277 cttcttgggcgacttggcctcctt 2254

---

>gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complete cds
          Length = 2546

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 70/77 (90%)
 Strand = Plus / Minus

                                                                        
Query: 241  acgccgccgtgcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctc 300
            ||||||||||| ||||||||||||||||| |||||||| ||||||||||||||||| |  
Sbjct: 2198 acgccgccgtgggcgatggtgacgccggcaagcagcctgccgagctcctggtcgttgcgg 2139

                             
Query: 301  acggcgaggagcaggtg 317
            |||||||| ||||||||
Sbjct: 2138 acggcgagcagcaggtg 2122



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 162  cttcttgggcgacttgccctcctt 185
            |||||||||||||||| |||||||
Sbjct: 2277 cttcttgggcgacttggcctcctt 2254

---

>gb|U08225.1|ZMU08225 Zea mays W-22 histone H2A mRNA, complete cds
          Length = 714

 Score = 95.6 bits (48), Expect = 8e-17
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 191 ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
           |||||||||||||| ||||||| ||||| || |||||||| || || ||||| |||||||
Sbjct: 480 ccttctccgccgtcttcttgggcagcagaacagggttgatattggggagcacaccgccgt 421

                                                           
Query: 251 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcc 298
           | |||||||| |||||| ||| |||| |||| ||||||| ||||||||
Sbjct: 420 gagcgatggtcacgccgcccaacagcttcccaagctcctcgtcgttcc 373



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 139 gccttcttgggggacttggcggccttcttgggcgacttgccctccttg 186
           |||||||| |||||||||||||||||||||||||||||  ||||||||
Sbjct: 544 gccttcttaggggacttggcggccttcttgggcgactttgcctccttg 497

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 61/66 (92%)
 Strand = Plus / Minus

                                                                           
Query: 211     gggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgccggcc 270
               ||||||||||||||||||||||| |||||||| || || ||||||||||||||||| |||
Sbjct: 7508467 gggagcagcaccgggttgatgttcggcagcacaccaccatgcgcgatggtgacgccagcc 7508408

                     
Query: 271     agcagc 276
               ||||||
Sbjct: 7508407 agcagc 7508402



 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 261      gacgccggccagcagcctcccga 283
                |||||||||||||||||||||||
Sbjct: 34705649 gacgccggccagcagcctcccga 34705627

---

>emb|AL662960.3|OSJN00162 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0021F22,
             complete sequence
          Length = 181498

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 61/66 (92%)
 Strand = Plus / Minus

                                                                         
Query: 211   gggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgccggcc 270
             ||||||||||||||||||||||| |||||||| || || ||||||||||||||||| |||
Sbjct: 30940 gggagcagcaccgggttgatgttcggcagcacaccaccatgcgcgatggtgacgccagcc 30881

                   
Query: 271   agcagc 276
             ||||||
Sbjct: 30880 agcagc 30875

---

>gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence
          Length = 772

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 95/112 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           |||||||||| || || ||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 447 tcttggggaggaggacggggttaatgttgggcagcacaccgccgtgcgcgatggtgaccc 388

                                                               
Query: 266 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtg 317
           |  |||||||| | |||||||||| |||||| |  | ||||||||| |||||
Sbjct: 387 cacccagcagcttgccgagctcctcgtcgttgcggatggcgaggaggaggtg 336



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 137 cggccttcttgggggacttgg 157
           |||||||||||||||||||||
Sbjct: 507 cggccttcttgggggacttgg 487

---

>gb|AF493985.1| Triticum aestivum H2A-1 gene, partial sequence
          Length = 538

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           |||||||||||||||| | ||||||||| || | ||| |||||||| |||||||||||||
Sbjct: 266 tcttggggagcagcacggagttgatgttggggatcacaccgccgtgggcgatggtgacgc 325

                      
Query: 266 cggccagcagc 276
           |||| ||||||
Sbjct: 326 cggcgagcagc 336



 Score = 48.1 bits (24), Expect = 0.018
 Identities = 44/51 (86%), Gaps = 6/51 (11%)
 Strand = Plus / Plus

                                                              
Query: 141 cttcttgggggacttggcggc------cttcttgggcgacttgccctcctt 185
           |||||||||||||||||||||      |||||||||||||||| |||||||
Sbjct: 195 cttcttgggggacttggcggccgtcttcttcttgggcgacttggcctcctt 245

---

>gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone
           MGC:11561 IMAGE:3156946), complete cds
          Length = 1414

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 405 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 346

                      
Query: 266 cggccagcagc 276
           || ||||||||
Sbjct: 345 cgcccagcagc 335

---

>gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosome 9, complete sequence
          Length = 185902

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                          
Query: 206    tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
              ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 149656 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 149715

                         
Query: 266    cggccagcagc 276
              || ||||||||
Sbjct: 149716 cgcccagcagc 149726

---

>ref|NM_010436.2| Mus musculus H2A histone family, member X (H2afx), mRNA
          Length = 1414

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 405 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 346

                      
Query: 266 cggccagcagc 276
           || ||||||||
Sbjct: 345 cgcccagcagc 335

---

>emb|CR700361.2|CNS0G3CL Tetraodon nigroviridis full-length cDNA
          Length = 547

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| ||||||||||  | |||||| |||||||||||||| || |||||||| || |
Sbjct: 387 tcttgggcagcagcaccgcctggatgttgggcagcacgccgccctgggcgatggtcactc 328

                      
Query: 266 cggccagcagc 276
           || ||||||||
Sbjct: 327 cgcccagcagc 317

---

>emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X
          Length = 2166

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 984 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 925

                      
Query: 266 cggccagcagc 276
           || ||||||||
Sbjct: 924 cgcccagcagc 914

---

>emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X
          Length = 1359

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 409 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 350

                      
Query: 266 cggccagcagc 276
           || ||||||||
Sbjct: 349 cgcccagcagc 339

---

>gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone
           MGC:6616 IMAGE:3490058), complete cds
          Length = 1367

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 399 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 340

                      
Query: 266 cggccagcagc 276
           || ||||||||
Sbjct: 339 cgcccagcagc 329

---

>dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430002L09
           product:H2A histone family, member X, full insert
           sequence
          Length = 1379

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 428 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 369

                      
Query: 266 cggccagcagc 276
           || ||||||||
Sbjct: 368 cgcccagcagc 358

---

>dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RIKEN full-length
           enriched library, clone:2010005I09 product:H2A histone
           family, member X, full insert sequence
          Length = 564

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 425 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 366

                      
Query: 266 cggccagcagc 276
           || ||||||||
Sbjct: 365 cgcccagcagc 355

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 76/91 (83%)
 Strand = Plus / Plus

                                                                            
Query: 206      tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
                ||||||||||||||  | ||| |||||| |||||||||||||||   |||||||||||| 
Sbjct: 20924435 tcttggggagcagcgtctggtggatgttgggcagcacgccgccggcggcgatggtgacgg 20924494

                                               
Query: 266      cggccagcagcctcccgagctcctggtcgtt 296
                || | |||||||| |  ||||||| ||||||
Sbjct: 20924495 cgccgagcagcctgctcagctcctcgtcgtt 20924525

---

>dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087P07, full
           insert sequence
          Length = 747

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 76/91 (83%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||||||||||  | ||| |||||| |||||||||||||||   |||||||||||| 
Sbjct: 477 tcttggggagcagcgtctggtggatgttgggcagcacgccgccggcggcgatggtgacgg 418

                                          
Query: 266 cggccagcagcctcccgagctcctggtcgtt 296
           || | |||||||| |  ||||||| ||||||
Sbjct: 417 cgccgagcagcctgctcagctcctcgtcgtt 387

---

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 76/91 (83%)
 Strand = Plus / Plus

                                                                            
Query: 206      tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
                ||||||||||||||  | ||| |||||| |||||||||||||||   |||||||||||| 
Sbjct: 20850649 tcttggggagcagcgtctggtggatgttgggcagcacgccgccggcggcgatggtgacgg 20850708

                                               
Query: 266      cggccagcagcctcccgagctcctggtcgtt 296
                || | |||||||| |  ||||||| ||||||
Sbjct: 20850709 cgccgagcagcctgctcagctcctcgtcgtt 20850739

---

>emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa0030G16 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 182172

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 76/91 (83%)
 Strand = Plus / Plus

                                                                         
Query: 206   tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
             ||||||||||||||  | ||| |||||| |||||||||||||||   |||||||||||| 
Sbjct: 9925  tcttggggagcagcgtctggtggatgttgggcagcacgccgccggcggcgatggtgacgg 9984

                                            
Query: 266   cggccagcagcctcccgagctcctggtcgtt 296
             || | |||||||| |  ||||||| ||||||
Sbjct: 9985  cgccgagcagcctgctcagctcctcgtcgtt 10015

---

>emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa0035E02 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 107819

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 76/91 (83%)
 Strand = Plus / Minus

                                                                         
Query: 206   tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
             ||||||||||||||  | ||| |||||| |||||||||||||||   |||||||||||| 
Sbjct: 34560 tcttggggagcagcgtctggtggatgttgggcagcacgccgccggcggcgatggtgacgg 34501

                                            
Query: 266   cggccagcagcctcccgagctcctggtcgtt 296
             || | |||||||| |  ||||||| ||||||
Sbjct: 34500 cgccgagcagcctgctcagctcctcgtcgtt 34470

---

>emb|BX063165.1|CNS09KWH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 72/86 (83%)
 Strand = Plus / Plus

                                                                       
Query: 191 ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
           |||||| | ||||| ||||||| |||||||| |  | |||||| |||||||||||||| |
Sbjct: 511 ccttcttctccgtcttcttgggcagcagcacggcctggatgttgggcagcacgccgccct 570

                                     
Query: 251 gcgcgatggtgacgccggccagcagc 276
           | |||||||| || |||| |||||||
Sbjct: 571 gggcgatggtcaccccggacagcagc 596

---

>emb|BX063164.1|CNS09KWG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                       
Query: 191 ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
           |||||| | ||||| ||||||| |||||||| |  | |||||| |||||||||||||| |
Sbjct: 490 ccttcttctccgtcttcttgggcagcagcacggcctggatgttgggcagcacgccgccct 431

                                     
Query: 251 gcgcgatggtgacgccggccagcagc 276
           | |||||||| || |||| |||||||
Sbjct: 430 gggcgatggtcaccccggacagcagc 405

---

>emb|BX040864.1|CNS093P0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                       
Query: 191 ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
           |||||| | ||||| ||||||| |||||||| |  | |||||| |||||||||||||| |
Sbjct: 483 ccttcttctccgtcttcttgggcagcagcacggcctggatgttgggcagcacgccgccct 424

                                     
Query: 251 gcgcgatggtgacgccggccagcagc 276
           | |||||||| || |||| |||||||
Sbjct: 423 gggcgatggtcaccccggacagcagc 398

---

>emb|BX019683.1|CNS08NCN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 651

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                       
Query: 191 ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
           |||||| | ||||| ||||||| |||||||| |  | |||||| |||||||||||||| |
Sbjct: 494 ccttcttctccgtcttcttgggcagcagcacggcctggatgttgggcagcacgccgccct 435

                                     
Query: 251 gcgcgatggtgacgccggccagcagc 276
           | |||||||| || |||| |||||||
Sbjct: 434 gggcgatggtcaccccggacagcagc 409

---

>emb|BX016452.1|CNS08KUW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24CG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 594

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 72/86 (83%)
 Strand = Plus / Plus

                                                                       
Query: 191 ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
           |||||| | ||||| ||||||| |||||||| |  | |||||| |||||||||||||| |
Sbjct: 61  ccttcttctccgtcttcttgggcagcagcacggcctggatgttgggcagcacgccgccct 120

                                     
Query: 251 gcgcgatggtgacgccggccagcagc 276
           | |||||||| || |||| |||||||
Sbjct: 121 gggcgatggtcaccccggacagcagc 146

---

>emb|BX016451.1|CNS08KUV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24CG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 556

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                       
Query: 191 ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
           |||||| | ||||| ||||||| |||||||| |  | |||||| |||||||||||||| |
Sbjct: 417 ccttcttctccgtcttcttgggcagcagcacggcctggatgttgggcagcacgccgccct 358

                                     
Query: 251 gcgcgatggtgacgccggccagcagc 276
           | |||||||| || |||| |||||||
Sbjct: 357 gggcgatggtcaccccggacagcagc 332

---

>emb|BX009846.1|CNS08FRE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 357

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 72/86 (83%)
 Strand = Plus / Plus

                                                                       
Query: 191 ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
           |||||| | ||||| ||||||| |||||||| |  | |||||| |||||||||||||| |
Sbjct: 104 ccttcttctccgtcttcttgggcagcagcacggcctggatgttgggcagcacgccgccct 163

                                     
Query: 251 gcgcgatggtgacgccggccagcagc 276
           | |||||||| || |||| |||||||
Sbjct: 164 gggcgatggtcaccccggacagcagc 189

---

>ref|XM_551996.1| Anopheles gambiae str. PEST ENSANGP00000029020
           (ENSANGG00000023190), partial mRNA
          Length = 297

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                       
Query: 191 ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
           |||||| | ||||| ||||||| |||||||| |  | |||||| |||||||||||||| |
Sbjct: 292 ccttcttctccgtcttcttgggcagcagcacggcctggatgttgggcagcacgccgccct 233

                                     
Query: 251 gcgcgatggtgacgccggccagcagc 276
           | |||||||| || |||| |||||||
Sbjct: 232 gggcgatggtcaccccggacagcagc 207

---

>ref|XM_314447.2| Anopheles gambiae str. PEST ENSANGP00000016040
           (ENSANGG00000013551), partial mRNA
          Length = 375

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                       
Query: 191 ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
           |||||| | ||||| ||||||| |||||||| |  | |||||| |||||||||||||| |
Sbjct: 370 ccttcttctccgtcttcttgggcagcagcacggcctggatgttgggcagcacgccgccct 311

                                     
Query: 251 gcgcgatggtgacgccggccagcagc 276
           | |||||||| || |||| |||||||
Sbjct: 310 gggcgatggtcaccccggacagcagc 285

---

>ref|XM_306256.1| Anopheles gambiae str. PEST ENSANGP00000000004
           (ENSANGG00000000004), mRNA
          Length = 630

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                       
Query: 191 ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
           |||||| | ||||| ||||||| |||||||| |  | |||||| |||||||||||||| |
Sbjct: 484 ccttcttctccgtcttcttgggcagcagcacggcctggatgttgggcagcacgccgccct 425

                                     
Query: 251 gcgcgatggtgacgccggccagcagc 276
           | |||||||| || |||| |||||||
Sbjct: 424 gggcgatggtcaccccggacagcagc 399

---

>ref|NM_021840.2| Rattus norvegicus histone 2a (H2a), mRNA
          Length = 1579

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 200 ccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatgg 259
           ||||| ||||||| |||| |||||  | |||||| ||||| |||||||| ||||||||||
Sbjct: 369 ccgtcttcttgggcagcaacaccgcctggatgttgggcaggacgccgccctgcgcgatgg 310

                            
Query: 260 tgacgccggccagcagc 276
           | |||| | ||||||||
Sbjct: 309 tcacgcggcccagcagc 293

---

>gb|BC099140.1| Rattus norvegicus histone 2a, mRNA (cDNA clone MGC:116285
           IMAGE:7457173), complete cds
          Length = 1579

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 200 ccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatgg 259
           ||||| ||||||| |||| |||||  | |||||| ||||| |||||||| ||||||||||
Sbjct: 369 ccgtcttcttgggcagcaacaccgcctggatgttgggcaggacgccgccctgcgcgatgg 310

                            
Query: 260 tgacgccggccagcagc 276
           | |||| | ||||||||
Sbjct: 309 tcacgcggcccagcagc 293

---

>gb|AY389588.1| Hyacinthus orientalis histone H2A mRNA, complete cds
          Length = 643

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 101/125 (80%)
 Strand = Plus / Minus

                                                                       
Query: 199 gccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatg 258
           |||||| |||| || |||| ||||||||||||||| ||||| || || ||||| ||||| 
Sbjct: 419 gccgtcttcttcggcagcaacaccgggttgatgttcggcaggactccaccgtgagcgatc 360

                                                                       
Query: 259 gtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgc 318
           |||||||| || || ||| | || |  ||||  ||||||||||| || || |||| ||||
Sbjct: 359 gtgacgcctgcaagtagcttgcccaattcctcatcgttcctcactgccagcagcacgtgc 300

                
Query: 319 ctggg 323
           |||||
Sbjct: 299 ctggg 295

---

>dbj|AB168678.1| Macaca fascicularis testis cDNA clone: QtsA-14092, similar to human
           histone 2, H2aa (HIST2H2AA), mRNA, RefSeq: NM_003516.2
          Length = 778

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                       
Query: 200 ccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatgg 259
           ||||| |||| ||||||||||| |  | |||||||||||| |||||||| || |||||||
Sbjct: 563 ccgtcttcttagggagcagcacggcctggatgttaggcaggacgccgccctgggcgatgg 504

               
Query: 260 tgac 263
           ||||
Sbjct: 503 tgac 500

---

>gb|AF255740.1|AF255740 Bufo bufo gagarizans histone H1 (H1) and histone H2A variant (H2AInr)
            genes, complete cds
          Length = 2396

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 82/100 (82%)
 Strand = Plus / Minus

                                                                        
Query: 206  tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
            ||||||| |||||||| |  | |||||| ||||| |||||||| || ||||||||||| |
Sbjct: 1582 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgggcgatggtgactc 1523

                                                    
Query: 266  cggccagcagcctcccgagctcctggtcgttcctcacggc 305
            || |||||||| |   |||||||| |||||| | ||||||
Sbjct: 1522 cgcccagcagcttgttgagctcctcgtcgttgcgcacggc 1483

---

>gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependent histone H2A gene, complete
            cds
          Length = 2120

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 82/100 (82%)
 Strand = Plus / Minus

                                                                        
Query: 206  tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
            ||||||| |||||||| |  | |||||| ||||| ||||| || || |||||||||||||
Sbjct: 1163 tcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatggtgacgc 1104

                                                    
Query: 266  cggccagcagcctcccgagctcctggtcgttcctcacggc 305
            || |||||||| |   |||||||| |||||| | ||||||
Sbjct: 1103 cgcccagcagcttgttgagctcctcgtcgttgcgcacggc 1064

---

>ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA
          Length = 393

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 299

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 298 ggcccagcagc 288

---

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                         
Query: 206   tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
             ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 64627 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 64568

                        
Query: 266   cggccagcagc 276
              | ||||||||
Sbjct: 64567 ggcccagcagc 64557



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                         
Query: 206   tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
             ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 60550 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 60609

                        
Query: 266   cggccagcagc 276
              | ||||||||
Sbjct: 60610 ggcccagcagc 60620



 Score = 48.1 bits (24), Expect = 0.018
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                          
Query: 206    tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
              ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 101110 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 101169

---

>ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudogene on chromosome
           13
          Length = 1357

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 840 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 781

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 780 ggcccagcagc 770

---

>ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488308), mRNA
          Length = 456

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 421 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 362

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 361 ggcccagcagc 351

---

>ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC611496), mRNA
          Length = 393

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 299

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 298 ggcccagcagc 288

---

>ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488291), mRNA
          Length = 387

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 299

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 298 ggcccagcagc 288

---

>ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488289),
           mRNA
          Length = 393

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 299

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 298 ggcccagcagc 288

---

>ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488278), mRNA
          Length = 576

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 299

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 298 ggcccagcagc 288

---

>ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488272), mRNA
          Length = 393

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 299

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 298 ggcccagcagc 288

---

>ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611132),
           mRNA
          Length = 393

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 299

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 298 ggcccagcagc 288

---

>ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488270), mRNA
          Length = 462

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 427 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 368

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 367 ggcccagcagc 357

---

>ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488262), mRNA
          Length = 393

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 299

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 298 ggcccagcagc 288

---

>ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611082),
           mRNA
          Length = 393

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 299

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 298 ggcccagcagc 288

---

>ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488254), mRNA
          Length = 417

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 382 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 323

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 322 ggcccagcagc 312

---

>ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone H2A (LOC488251),
           mRNA
          Length = 396

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 299

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 298 ggcccagcagc 288

---

>ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l),
           transcript variant 2 (LOC488268), mRNA
          Length = 402

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 299

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 298 ggcccagcagc 288

---

>ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l),
           transcript variant 1 (LOC488268), mRNA
          Length = 393

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 299

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 298 ggcccagcagc 288

---

>ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 2
           (LOC665433), mRNA
          Length = 465

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 390 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 331

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 330 ggcccagcagc 320

---

>ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 1
           (LOC665433), mRNA
          Length = 467

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 392 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 333

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 332 ggcccagcagc 322

---

>ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC482203),
           mRNA
          Length = 393

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 299

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 298 ggcccagcagc 288

---

>gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with apparent retained
           intron
          Length = 497

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 389 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 330

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 329 ggcccagcagc 319

---

>emb|CR673199.2|CNS0FIET Tetraodon nigroviridis full-length cDNA
          Length = 775

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggt 260
           ||||||| ||||||||||  | |||||| |||||||||||||| || ||||||||
Sbjct: 396 tcttgggcagcagcaccgcctggatgttgggcagcacgccgccctgagcgatggt 342

---

>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143
          Length = 3210

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                        
Query: 206  tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
            ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 1931 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 1872

                       
Query: 266  cggccagcagc 276
             | ||||||||
Sbjct: 1871 ggcccagcagc 1861

---

>emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones
          Length = 1653

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                        
Query: 206  tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
            ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 1494 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 1435

                       
Query: 266  cggccagcagc 276
             | ||||||||
Sbjct: 1434 ggcccagcagc 1424

---

>emb|X59961.1|RNH2AB R.norvegicus genes for H2A and H2B histones
          Length = 1635

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                        
Query: 206  tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
            ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 1240 tcttgggcagcagcacagcctggatgttgggcagaacgccgccctgcgcgatggtcacgc 1181

                       
Query: 266  cggccagcagc 276
             | ||||||||
Sbjct: 1180 ggcccagcagc 1170

---

>emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B)
          Length = 1826

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                        
Query: 206  tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
            ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 1306 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 1247

                       
Query: 266  cggccagcagc 276
             | ||||||||
Sbjct: 1246 ggcccagcagc 1236

---

>emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A)
          Length = 1797

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                        
Query: 206  tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
            ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 1307 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 1248

                       
Query: 266  cggccagcagc 276
             | ||||||||
Sbjct: 1247 ggcccagcagc 1237

---

>gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MGC:117571
           IMAGE:30789778), complete cds
          Length = 1075

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 368 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 309

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 308 ggcccagcagc 298

---

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
              novel gene, the genes for three H1, four H2a, five H2b,
              four H3 and four H4 histone family members, the 3' end of a
              variant of the Hfe gene for hemochromatosis protein (Mr2)
              and ten CpG islands, complete sequence
          Length = 184730

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                          
Query: 206    tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
              ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 163975 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 164034

                         
Query: 266    cggccagcagc 276
               | ||||||||
Sbjct: 164035 ggcccagcagc 164045



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                         
Query: 206   tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
             ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 55434 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 55375

                        
Query: 266   cggccagcagc 276
              | ||||||||
Sbjct: 55374 ggcccagcagc 55364



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                         
Query: 206   tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
             ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 51357 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 51416

                        
Query: 266   cggccagcagc 276
              | ||||||||
Sbjct: 51417 ggcccagcagc 51427



 Score = 48.1 bits (24), Expect = 0.018
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                         
Query: 206   tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
             ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 14870 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 14811

---

>ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA
          Length = 2493

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 402 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 343

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 342 ggcccagcagc 332

---

>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the
             genes for H2b histone family member A, two H2a, two H4 and
             an H2b histone family member, a serine/threonine protein
             kinase pseudogene, a novel pseudogene, a novel gene
             (4930500C15Rik), the gene for a novel KRAB box and C2H2
             Zinc Finger containing protein, a ribosomal protein L21
             (RPL21) pseudogene, a TU mitochondrial translation
             elongation factor (tufa) pseudogene, the 5' end of the
             gene for a novel protein similar to nuclear envelope pore
             membrane protein POM121 and four CpG islands, complete
             sequence
          Length = 182817

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                         
Query: 206   tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
             ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 33285 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 33344

                        
Query: 266   cggccagcagc 276
              | ||||||||
Sbjct: 33345 ggcccagcagc 33355



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                         
Query: 206   tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
             ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 10991 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 10932

                        
Query: 266   cggccagcagc 276
              | ||||||||
Sbjct: 10931 ggcccagcagc 10921

---

>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the
             3' end of the gene for a novel protein similar to nuclear
             envelope pore membrane protein POM121, the Prss16 gene for
             thymus serine protease16, three novel genes, the genes for
             two H2a, two H2b and one H4 histone family members, a
             ribosomal protein L37A (Rpl37a) pseudogene, a novel
             pseudogene, three genes for novel vomeronasal 1 receptor H
             (V1rh) family members, the gene for a novel vomeronasal 1
             receptor I (V1ri) family member, six V1ri pseudogenes, a
             V1rh pseudogene and six CpG islands, complete sequence
          Length = 210845

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                         
Query: 206   tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
             ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 59926 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 59985

                        
Query: 266   cggccagcagc 276
              | ||||||||
Sbjct: 59986 ggcccagcagc 59996



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                         
Query: 206   tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
             ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 52551 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 52610

                        
Query: 266   cggccagcagc 276
              | ||||||||
Sbjct: 52611 ggcccagcagc 52621

---

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                          
Query: 206    tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
              ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 174460 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 174519

                         
Query: 266    cggccagcagc 276
               | ||||||||
Sbjct: 174520 ggcccagcagc 174530



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                          
Query: 206    tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
              ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 142452 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 142511

                         
Query: 266    cggccagcagc 276
               | ||||||||
Sbjct: 142512 ggcccagcagc 142522



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                          
Query: 206    tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
              ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 137769 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 137710

                         
Query: 266    cggccagcagc 276
               | ||||||||
Sbjct: 137709 ggcccagcagc 137699



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 228    gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
              |||||| ||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 207873 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 207921

---

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                          
Query: 206    tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
              ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 142178 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 142119

                         
Query: 266    cggccagcagc 276
               | ||||||||
Sbjct: 142118 ggcccagcagc 142108



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                          
Query: 206    tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
              ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 136888 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 136947

                         
Query: 266    cggccagcagc 276
               | ||||||||
Sbjct: 136948 ggcccagcagc 136958

---

>gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MGC:73771
           IMAGE:1263745), complete cds
          Length = 527

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 380 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 321

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 320 ggcccagcagc 310

---

>gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MGC:90847
           IMAGE:5713252), complete cds
          Length = 492

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 388 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 329

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 328 ggcccagcagc 318

---

>dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:I0C0045N09 product:histone 1,
           H2ad, full insert sequence
          Length = 446

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 391 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 332

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 331 ggcccagcagc 321

---

>dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730004H15 product:histone 1, H2ai, full insert
           sequence
          Length = 1396

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 61/71 (85%), Gaps = 1/71 (1%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||| 
Sbjct: 369 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacg- 311

                      
Query: 266 cggccagcagc 276
           |||||||||||
Sbjct: 310 cggccagcagc 300

---

>dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:I920064A15 product:histone 1, H2ad, full
           insert sequence
          Length = 445

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 389 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 330

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 329 ggcccagcagc 319

---

>ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA
          Length = 506

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 403 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 344

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 343 ggcccagcagc 333

---

>gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365, complete cds
          Length = 447

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 370 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 311

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 310 ggcccagcagc 300

---

>gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, complete cds
          Length = 444

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 370 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 311

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 310 ggcccagcagc 300

---

>gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016
          Length = 2110

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 628 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 569

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 568 ggcccagcagc 558

---

>gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108
          Length = 2221

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 626 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 567

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 566 ggcccagcagc 556

---

>ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA
          Length = 527

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 380 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 321

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 320 ggcccagcagc 310

---

>ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA
          Length = 705

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 471 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 412

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 411 ggcccagcagc 401

---

>ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA
          Length = 393

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 299

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 298 ggcccagcagc 288

---

>gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone H2a.1-F (H2a-F), histone
            H2b-F (H2b-F) genes, complete cds
          Length = 2822

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                        
Query: 206  tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
            ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 1471 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 1530

                       
Query: 266  cggccagcagc 276
             | ||||||||
Sbjct: 1531 ggcccagcagc 1541

---

>dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1190022L06 product:HISTONE H2A
           homolog [Homo sapiens], full insert sequence
          Length = 705

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 471 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 412

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 411 ggcccagcagc 401

---

>dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-length enriched
           library, clone:9030420B16 product:histone 1, H2ac, full
           insert sequence
          Length = 2493

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 402 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 343

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 342 ggcccagcagc 332

---

>ref|NM_021839.1| Rattus norvegicus testis-specific histone 2a (Hist1h2aa), mRNA
          Length = 393

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 299

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 298 ggcccagcagc 288

---

>ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA
          Length = 393

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 299

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 298 ggcccagcagc 288

---

>ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA
          Length = 393

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 299

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 298 ggcccagcagc 288

---

>ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC306962),
           mRNA
          Length = 437

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| ||||||||||  | ||| |||||||| || ||||| ||||||||||| ||||
Sbjct: 372 tcttgggcagcagcaccgcctggatattaggcaggacaccgccctgcgcgatggtcacgc 313

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 312 ggcccagcagc 302

---

>gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, complete cds
          Length = 1390

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 858 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 799

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 798 ggcccagcagc 788

---

>gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, complete cds
          Length = 1390

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 858 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 799

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 798 ggcccagcagc 788

---

>gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, complete cds
          Length = 1390

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 858 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 799

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 798 ggcccagcagc 788

---

>gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, complete cds
          Length = 1390

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 858 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 799

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 798 ggcccagcagc 788

---

>gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, complete cds
          Length = 1392

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 857 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 798

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 797 ggcccagcagc 787

---

>gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, complete cds
          Length = 1381

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 855 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 796

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 795 ggcccagcagc 785

---

>gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, complete cds
          Length = 1390

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 858 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 799

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 798 ggcccagcagc 788

---

>gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, complete cds
          Length = 1201

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 892 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 833

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 832 ggcccagcagc 822

---

>gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene, partial sequence
          Length = 1357

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 840 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 781

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 780 ggcccagcagc 770

---

>gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, complete cds
          Length = 1387

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 855 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 796

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 795 ggcccagcagc 785

---

>ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA
          Length = 387

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 299

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 298 ggcccagcagc 288

---

>gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complete sequence
          Length = 567

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 421 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 362

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 361 ggcccagcagc 351

---

>gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds
          Length = 929

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 521 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 462

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 461 ggcccagcagc 451

---

>gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 gene
          Length = 668

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 481 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 422

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 421 ggcccagcagc 411

---

>gb|BC106331.1| Xenopus laevis cDNA clone MGC:130860 IMAGE:7205580, complete cds
          Length = 799

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 95/118 (80%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           |||||||||||||||| |  | |||||| ||||| || ||||| || ||||||||||| |
Sbjct: 370 tcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgaccc 311

                                                                     
Query: 266 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctggg 323
           |  | |||||  |   |||||||| |||||| | |||||||||  |||||||||||||
Sbjct: 310 ctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctggg 253

---

>ref|XM_868674.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616611), mRNA
          Length = 393

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgac 263
           ||||||| ||||||||||  | |||||| ||||| |||||||| || |||||||||||
Sbjct: 358 tcttgggcagcagcaccgcctggatgttgggcaggacgccgccctgagcgatggtgac 301

---

>gb|BC068823.1| Xenopus laevis cDNA clone IMAGE:6635737, partial cds
          Length = 763

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 95/118 (80%)
 Strand = Plus / Plus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           |||||||||||||||| |  | |||||| ||||| || ||||| || ||||||||||| |
Sbjct: 291 tcttggggagcagcacagactggatgttgggcagaaccccgccctgggcgatggtgaccc 350

                                                                     
Query: 266 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctggg 323
           |  | |||||  |   |||||||| |||||| | |||||||||  |||||||||||||
Sbjct: 351 ctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctggg 408

---

>ref|XM_543796.2| PREDICTED: Canis familiaris similar to H2A histone family, member J
           isoform 2 (LOC486669), mRNA
          Length = 598

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgac 263
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||||||
Sbjct: 436 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtgac 379

---

>emb|BX008487.1|CNS08EPN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 408

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                       
Query: 191 ccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgt 250
           |||||| | ||||| ||||||| |||||||| |  | |||||| |||||||||||||| |
Sbjct: 244 ccttcttctccgtcttcttgggcagcagcacggcctggatgttgggcagcacgccgccct 185

                     
Query: 251 gcgcgatggt 260
           | ||||||||
Sbjct: 184 gggcgatggt 175

---

>emb|X14730.1|CMHIST2A Duck H2A histone gene
          Length = 845

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgac 263
           ||||||| |||||||| |  | |||||| |||||||| ||||| ||||||||||||||
Sbjct: 508 tcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtgac 451

---

>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3
            and H4
          Length = 8592

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 95/118 (80%)
 Strand = Plus / Minus

                                                                        
Query: 206  tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
            |||||||||||||||| |  | |||||| ||||| || ||||| || ||||||||||| |
Sbjct: 4729 tcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgaccc 4670

                                                                      
Query: 266  cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctggg 323
            |  | |||||  |   |||||||| |||||| | |||||||||  |||||||||||||
Sbjct: 4669 ctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctggg 4612

---

>gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and
            histone H3 gene, 3' end, gene cluster X1h3
          Length = 8608

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 95/118 (80%)
 Strand = Plus / Minus

                                                                        
Query: 206  tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
            |||||||||||||||| |  | |||||| ||||| || ||||| || ||||||||||| |
Sbjct: 4746 tcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgaccc 4687

                                                                      
Query: 266  cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctggg 323
            |  | |||||  |   |||||||| |||||| | |||||||||  |||||||||||||
Sbjct: 4686 ctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctggg 4629

---

>ref|NM_178218.2| Mus musculus histone 3, H2a (Hist3h2a), mRNA
          Length = 1991

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           |||||| ||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 390 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 342

---

>gb|BC063781.1| Mus musculus histone 3, H2a, mRNA (cDNA clone MGC:70265
           IMAGE:6493838), complete cds
          Length = 1607

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           |||||| ||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 356 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 308

---

>gb|BC058119.1| Mus musculus histone 3, H2a, mRNA (cDNA clone IMAGE:6819179), with
           apparent retained intron
          Length = 1490

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           |||||| ||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 362 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 314

---

>emb|BX007458.1|CNS08DX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 349

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           |||||| |||||||||||||| || |||||||| || |||| |||||||
Sbjct: 141 gatgttgggcagcacgccgccctgggcgatggtcaccccggacagcagc 93

---

>dbj|AK077568.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:5730450G06 product:H2A HISTONE
           FAMILY, MEMBER L homolog [Homo sapiens], full insert
           sequence
          Length = 924

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           |||||| ||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 390 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 342

---

>dbj|AK051448.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length
           enriched library, clone:D130049H21 product:H2A HISTONE
           FAMILY, MEMBER L homolog [Homo sapiens], full insert
           sequence
          Length = 1991

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           |||||| ||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 390 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 342

---

>dbj|AK087537.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
           library, clone:E130315C04 product:H2A HISTONE FAMILY,
           MEMBER L homolog [Homo sapiens], full insert sequence
          Length = 1500

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           |||||| ||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 391 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 343

---

>dbj|AK015962.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4930534G10 product:unclassifiable, full
           insert sequence
          Length = 767

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           |||||| ||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 217 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 265

---

>dbj|AK083155.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length
           enriched library, clone:C630019H19 product:H2A HISTONE
           FAMILY, MEMBER L homolog [Homo sapiens]; RING finger
           protein TERF, full insert sequence
          Length = 3665

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           |||||| ||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 390 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 342

---

>dbj|AK082083.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:C230003M12 product:H2A HISTONE
           FAMILY, MEMBER L homolog [Homo sapiens], full insert
           sequence
          Length = 2150

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           |||||| ||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 393 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 345

---

>ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA
          Length = 393

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           |||||| ||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 288

---

>gb|AY158926.1| Mus musculus histone protein Hist3h2a gene, complete cds
          Length = 1201

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           |||||| ||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 870 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 822

---

>gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, complete cds
          Length = 1390

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           |||||| ||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 836 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 788

---

>emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chromosome 11, complete
             sequence
          Length = 103129

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                              
Query: 228   gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
             |||||| ||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 39545 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 39497

---

>gb|U95110.1|MMU95110 Mus macedonicus histone H2a pseudogene, complete sequence
          Length = 571

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           |||||| ||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 403 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 355

---

>gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 H2ai-like mRNA,
           complete sequence
          Length = 786

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgat 257
           ||||||| |||||||| |  | |||||| |||||||||||||| ||||||||
Sbjct: 441 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgcgcgat 390

---

>gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 H2ai-like mRNA,
           complete sequence
          Length = 786

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgat 257
           ||||||| |||||||| |  | |||||| |||||||||||||| ||||||||
Sbjct: 441 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgcgcgat 390

---

>gb|AY389592.1| Hyacinthus orientalis histone H2A mRNA, complete cds
          Length = 635

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 72/88 (81%)
 Strand = Plus / Minus

                                                                       
Query: 189 ctccttctccgccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgcc 248
           |||||||  |||| || |||| || |||| ||||||||||||||| ||||| || || ||
Sbjct: 414 ctccttcgacgccatcttcttcggcagcaacaccgggttgatgttcggcaggactccacc 355

                                       
Query: 249 gtgcgcgatggtgacgccggccagcagc 276
           ||| ||||| || ||||| || ||||||
Sbjct: 354 gtgagcgatcgtcacgcctgcaagcagc 327

---

>emb|X02622.1|MMHISHSA Mouse gene fragment for histone H2a
          Length = 204

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 79  tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 20

---

>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0459B04
          Length = 142475

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 137   cggccttcttgggggacttggcgg 160
             ||||||||||||||||||||||||
Sbjct: 60496 cggccttcttgggggacttggcgg 60473

---

>emb|BX933556.1| Gallus gallus finished cDNA, clone ChEST42h4
          Length = 895

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 229 atgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           ||||| ||||| || ||||| |||||||||||||| ||| ||||||||
Sbjct: 60  atgttgggcagtaccccgccctgcgcgatggtgacaccgcccagcagc 107

---

>gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, complete cds
          Length = 1390

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 882 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 823

---

>ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA
          Length = 393

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 299

---

>gb|U95112.1|MCU95112 Mus caroli histone H2a pseudogene, complete sequence
          Length = 468

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 324 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 265

---

>ref|XM_474362.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1617

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 261 gacgccggccagcagcctcccga 283
           |||||||||||||||||||||||
Sbjct: 489 gacgccggccagcagcctcccga 467

---

>gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone
             OSJNBa0031O09, complete sequence
          Length = 161339

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 74/91 (81%)
 Strand = Plus / Minus

                                                                         
Query: 206   tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
             ||||||| ||||| ||| | | |||||| |||||||||||||||   ||||| |||||| 
Sbjct: 38482 tcttgggaagcaggacctgctggatgttgggcagcacgccgccggcggcgatcgtgacgg 38423

                                            
Query: 266   cggccagcagcctcccgagctcctggtcgtt 296
              | |||||||||| |  ||||||| ||||||
Sbjct: 38422 tgcccagcagcctgctcagctcctcgtcgtt 38392

---

>gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone B1154F06 map
              near C10769, complete sequence
          Length = 194856

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 74/91 (81%)
 Strand = Plus / Plus

                                                                          
Query: 206    tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
              ||||||| ||||| ||| | | |||||| |||||||||||||||   ||||| |||||| 
Sbjct: 140950 tcttgggaagcaggacctgctggatgttgggcagcacgccgccggcggcgatcgtgacgg 141009

                                             
Query: 266    cggccagcagcctcccgagctcctggtcgtt 296
               | |||||||||| |  ||||||| ||||||
Sbjct: 141010 tgcccagcagcctgctcagctcctcgtcgtt 141040

---

>ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427895),
           mRNA
          Length = 390

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggt 260
           ||||||| |||||||| |  | |||||| |||||||| ||||| |||||||||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggt 304

---

>ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427891),
           mRNA
          Length = 390

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggt 260
           ||||||| |||||||| |  | |||||| |||||||| ||||| |||||||||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggt 304

---

>ref|XM_425459.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427885),
           mRNA
          Length = 918

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggt 260
           ||||||| |||||||| |  | |||||| |||||||| ||||| |||||||||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggt 304

---

>ref|XM_425455.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427881),
           mRNA
          Length = 534

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggt 260
           ||||||| |||||||| |  | |||||| |||||||| ||||| |||||||||||
Sbjct: 502 tcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggt 448

---

>ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC417955), mRNA
          Length = 1220

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 206  tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggt 260
            ||||||| |||||||| |  | |||||| |||||||| ||||| |||||||||||
Sbjct: 1188 tcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggt 1134

---

>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
            (LOC417953), mRNA
          Length = 2271

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                   
Query: 206  tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggt 260
            ||||||| |||||||| |  | |||||| |||||||| ||||| |||||||||||
Sbjct: 1173 tcttgggcagcagcacagcctggatgttgggcagcaccccgccctgcgcgatggt 1227

---

>ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene
           (LOC417952), mRNA
          Length = 1374

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                  
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggt 260
           ||||||| |||||||| |  | |||||| |||||||| ||||| |||||||||||
Sbjct: 732 tcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggt 786

---

>gb|AC147426.2| Oryza sativa chromosome 3  B1377B10 genomic sequence, complete sequence
          Length = 184366

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 74/91 (81%)
 Strand = Plus / Minus

                                                                          
Query: 206    tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
              ||||||| ||||| ||| | | |||||| |||||||||||||||   ||||| |||||| 
Sbjct: 181636 tcttgggaagcaggacctgctggatgttgggcagcacgccgccggcggcgatcgtgacgg 181577

                                             
Query: 266    cggccagcagcctcccgagctcctggtcgtt 296
               | |||||||||| |  ||||||| ||||||
Sbjct: 181576 tgcccagcagcctgctcagctcctcgtcgtt 181546

---

>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene
          Length = 8384

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 206  tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggt 260
            ||||||| |||||||| |  | |||||| |||||||| ||||| |||||||||||
Sbjct: 5289 tcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggt 5235

---

>emb|AL606456.2|OSJN00017 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0017I01,
             complete sequence
          Length = 133331

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 261   gacgccggccagcagcctcccga 283
             |||||||||||||||||||||||
Sbjct: 11211 gacgccggccagcagcctcccga 11189

---

>emb|AJ245999.1|BNA245999 Brassica napus H2A gene for Histone H2A
          Length = 971

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 205 ctcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgac 263
           |||||||| || || ||||||||||||||||| || || || |||  ||||||||||||
Sbjct: 792 ctcttgggaagaagaaccgggttgatgttaggaagaactccaccgctcgcgatggtgac 734

---

>emb|V00413.1|GGH2AX Chicken gene for histone H2A with flanking regions
          Length = 843

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggt 260
           ||||||| |||||||| |  | |||||| |||||||| ||||| |||||||||||
Sbjct: 691 tcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggt 637

---

>ref|XM_694570.1| PREDICTED: Danio rerio similar to histone H2A (LOC571016), partial
           mRNA
          Length = 374

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggt 260
           ||||||| |||||||| |  | |||||| |||||||||||||| || ||||||||
Sbjct: 348 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgagcgatggt 294

---

>dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-107-A07, full
           insert sequence
          Length = 724

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 74/91 (81%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| ||||| ||| | | |||||| |||||||||||||||   ||||| |||||| 
Sbjct: 474 tcttgggaagcaggacctgctggatgttgggcagcacgccgccggcggcgatcgtgacgg 415

                                          
Query: 266 cggccagcagcctcccgagctcctggtcgtt 296
            | |||||||||| |  ||||||| ||||||
Sbjct: 414 tgcccagcagcctgctcagctcctcgtcgtt 384

---

>emb|AL732353.1| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0801D08, complete
             sequence
          Length = 103264

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 261   gacgccggccagcagcctcccga 283
             |||||||||||||||||||||||
Sbjct: 48674 gacgccggccagcagcctcccga 48652

---

>dbj|D11055.1|CHKH2A4H Gallus gallus gene for H2A histone, complete cds
          Length = 1028

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggt 260
           ||||||| |||||||| |  | |||||| |||||||| ||||| |||||||||||
Sbjct: 689 tcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggt 635

---

>gb|U38933.1|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, complete cds
          Length = 740

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggt 260
           ||||||| |||||||| |  | |||||| |||||||| ||||| |||||||||||
Sbjct: 536 tcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggt 482

---

>gb|U38932.1|GGU38932 Gallus gallus histone H2A (H2A-VII) gene, complete cds
          Length = 827

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggt 260
           ||||||| |||||||| |  | |||||| |||||||| ||||| |||||||||||
Sbjct: 519 tcttgggcagcagcacagcctggatgttgggcagcaccccgccctgcgcgatggt 465

---

>gb|U38931.1|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, complete cds
          Length = 743

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggt 260
           ||||||| |||||||| |  | |||||| |||||||| ||||| |||||||||||
Sbjct: 381 tcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggt 327

---

>gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, complete sequence
          Length = 531

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||  |||||||| ||||||||||| ||||
Sbjct: 385 tcttgggcagcagcacggcctggatgttgggcacgacgccgccctgcgcgatggtcacgc 326

                      
Query: 266 cggccagcagc 276
            | ||||||||
Sbjct: 325 ggcccagcagc 315

---

>gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks
          Length = 1564

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                  
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggt 260
           ||||||| |||||||| |  | |||||| |||||||| ||||| |||||||||||
Sbjct: 288 tcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggt 342

---

>ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC613926), mRNA
          Length = 393

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgac 263
           |||| ||||||||||| |  | |||||| ||||| |||||||| || |||||||||||
Sbjct: 358 tcttagggagcagcacggcctggatgttgggcaggacgccgccctgagcgatggtgac 301

---

>ref|NM_001040642.1| Gallus gallus similar to Histone H1.2 (H1d) (LOC417954), mRNA
          Length = 660

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 132 cttgtcggccttcttgggggacttggcggccttcttgg 169
           |||| ||||||||||||||  |||||| ||||||||||
Sbjct: 531 cttggcggccttcttggggctcttggccgccttcttgg 494

---

>ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488304), mRNA
          Length = 588

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 235 ggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           ||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 476 ggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 435

---

>ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488299),
           mRNA
          Length = 387

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgac 263
           ||||||| |||||||| |  | |||||| ||||  |||||||| ||||||||||||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaagacgccgccctgcgcgatggtgac 301

---

>ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488297),
           mRNA
          Length = 393

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgac 263
           ||||||| |||||||| |  | |||||| ||||  |||||||| ||||||||||||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaagacgccgccctgcgcgatggtgac 301

---

>emb|X01064.1|SGHIS2A3 Rainbow trout histone H2A and H3 genes
          Length = 2597

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           |||||||||||||||| |  | |||||| ||||| || || || || |||||||||||||
Sbjct: 721 tcttggggagcagcactgcctggatgttgggcagaacaccaccctgagcgatggtgacgc 662

             
Query: 266 cg 267
           ||
Sbjct: 661 cg 660

---

>emb|X01752.1|GGHISH1 Chicken histone H1 gene
          Length = 2201

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 132  cttgtcggccttcttgggggacttggcggccttcttgg 169
            |||| ||||||||||||||  |||||| ||||||||||
Sbjct: 1189 cttggcggccttcttggggctcttggccgccttcttgg 1152

---

>gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, complete sequence
          Length = 211945

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                       
Query: 235   ggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
             |||||||||||||| || |||||||| || ||| ||||||||
Sbjct: 98621 ggcagcacgccgccctgagcgatggtcactccgcccagcagc 98580

---

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 126     ggccttcttgtcggccttcttg 147
               ||||||||||||||||||||||
Sbjct: 3848244 ggccttcttgtcggccttcttg 3848223

---

>ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC469700),
           mRNA
          Length = 393

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           |||||| ||||| ||||| || ||||||||||| |||| | ||||||||
Sbjct: 336 gatgttgggcaggacgccaccctgcgcgatggtcacgcggcccagcagc 288

---

>gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:3165
           IMAGE:3355200), complete cds
          Length = 897

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           |||||| ||||| ||||| || ||||||||||| |||| | ||||||||
Sbjct: 378 gatgttgggcaggacgccaccctgcgcgatggtcacgcggcccagcagc 330

---

>gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:99456
           IMAGE:6671338), complete cds
          Length = 889

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           |||||| ||||| ||||| || ||||||||||| |||| | ||||||||
Sbjct: 368 gatgttgggcaggacgccaccctgcgcgatggtcacgcggcccagcagc 320

---

>ref|NM_177688.2| Mus musculus H2A histone family, member J (H2afj), mRNA
          Length = 1754

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 200 ccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatgg 259
           ||||| ||||||| |||||||| |  | ||| || ||||| |||||||| ||||||||||
Sbjct: 381 ccgtcttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatgg 322

            
Query: 260 t 260
           |
Sbjct: 321 t 321

---

>ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA
          Length = 496

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           |||||| ||||| ||||| || ||||||||||| |||| | ||||||||
Sbjct: 378 gatgttgggcaggacgccaccctgcgcgatggtcacgcggcccagcagc 330

---

>ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone family, member J
           (LOC632401), mRNA
          Length = 1833

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 200 ccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatgg 259
           ||||| ||||||| |||||||| |  | ||| || ||||| |||||||| ||||||||||
Sbjct: 460 ccgtcttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatgg 401

            
Query: 260 t 260
           |
Sbjct: 400 t 400

---

>gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, complete sequence
          Length = 205659

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                          
Query: 200    ccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatgg 259
              ||||| ||||||| |||||||| |  | ||| || ||||| |||||||| ||||||||||
Sbjct: 108580 ccgtcttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatgg 108639

               
Query: 260    t 260
              |
Sbjct: 108640 t 108640

---

>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence
          Length = 3363523

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 254    cgatggtgacgccggccagcagcct 278
              |||||||||||||||| ||||||||
Sbjct: 765511 cgatggtgacgccggcaagcagcct 765535

---

>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3,
              complete sequence
          Length = 151563

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                               
Query: 228    gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
              |||||| ||||| ||||| || ||||||||||| |||| | ||||||||
Sbjct: 100883 gatgttgggcaggacgccaccctgcgcgatggtcacgcggcccagcagc 100835

---

>ref|NM_001030753.1| Gallus gallus histone H2A (H2A-IX), mRNA
          Length = 390

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggt 260
           |||||| |||||||| ||||| |||||||||||
Sbjct: 336 gatgttgggcagcaccccgccctgcgcgatggt 304

---

>emb|BX908783.8| Zebrafish DNA sequence from clone DKEY-86M2 in linkage group 25, complete
              sequence
          Length = 216800

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 71     aaacagcaagcaatgttacaacaga 95
              |||||||||||||||| ||||||||
Sbjct: 200490 aaacagcaagcaatgtcacaacaga 200514

---

>emb|BX323796.14| Zebrafish DNA sequence from clone DKEY-106N21 in linkage group 25,
             complete sequence
          Length = 204383

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 71    aaacagcaagcaatgttacaacaga 95
             |||||||||||||||| ||||||||
Sbjct: 51767 aaacagcaagcaatgtcacaacaga 51743

---

>gb|DQ397869.1| Cenarchaeum symbiosum clone C04C05, complete sequence
          Length = 40287

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 261  gacgccggccagcagcctcccgagctcct 289
            ||||| ||||||||||||| |||||||||
Sbjct: 1340 gacgcgggccagcagcctctcgagctcct 1312

---

>ref|NM_001024282.1| Rattus norvegicus Histone H2a (predicted) (RGD1564767_predicted),
           mRNA
          Length = 393

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggt 260
           |||||| ||||| |||||||| |||||||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggt 304

---

>ref|XM_688696.1| PREDICTED: Danio rerio similar to histone H2A (LOC565417), mRNA
          Length = 384

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggt 260
           |||||| |||||||||||||| || ||||||||
Sbjct: 336 gatgttgggcagcacgccgccctgagcgatggt 304

---

>dbj|AK053755.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
           library, clone:E130307C13 product:HISTONE H2A homolog
           [Gallus gallus], full insert sequence
          Length = 1754

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 200 ccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatgg 259
           ||||| ||||||| |||||||| |  | ||| || ||||| |||||||| ||||||||||
Sbjct: 381 ccgtcttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatgg 322

            
Query: 260 t 260
           |
Sbjct: 321 t 321

---

>gb|BC099606.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone
           MGC:118637 IMAGE:1383389), complete cds
          Length = 587

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 200 ccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatgg 259
           ||||| ||||||| |||||||| |  | ||| || ||||| |||||||| ||||||||||
Sbjct: 438 ccgtcttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatgg 379

            
Query: 260 t 260
           |
Sbjct: 378 t 378

---

>gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone
           MGC:36202 IMAGE:5055276), complete cds
          Length = 550

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 200 ccgtcctcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatgg 259
           ||||| ||||||| |||||||| |  | ||| || ||||| |||||||| ||||||||||
Sbjct: 416 ccgtcttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatgg 357

            
Query: 260 t 260
           |
Sbjct: 356 t 356

---

>gb|U38934.1|GGU38934 Gallus gallus histone H2A (H2A-IX) gene, complete cds
          Length = 575

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggt 260
           |||||| |||||||| ||||| |||||||||||
Sbjct: 354 gatgttgggcagcaccccgccctgcgcgatggt 322

---

>gb|U95113.1|RNU95113 Rattus norvegicus histone H2a gene, complete cds
          Length = 575

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggt 260
           |||||| ||||| |||||||| |||||||||||
Sbjct: 400 gatgttgggcaggacgccgccctgcgcgatggt 368

---

>gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1), histone H2A (ch2a-IV),
            and histone H2B (ch2b-IV) genes, complete cds
          Length = 4502

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 129  cttcttgtcggccttcttgggggacttgg 157
            |||||| ||||||||||||| ||||||||
Sbjct: 1136 cttcttctcggccttcttggcggacttgg 1108

---

>gb|AY131974.1| Homo sapiens histone H2A (HIST3H2A) gene, complete cds
          Length = 1173

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           |||||| ||||| ||||| || ||||||||||| |||| | ||||||||
Sbjct: 728 gatgttgggcaggacgccaccctgcgcgatggtcacgcggcccagcagc 680

---

>gb|BC060324.1| Homo sapiens histone 2, H2ac, mRNA (cDNA clone MGC:74460
           IMAGE:3892650), complete cds
          Length = 446

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgac 263
           |||||||||||  |||||||| || |||||||||||
Sbjct: 371 gatgttaggcaaaacgccgccctgggcgatggtgac 336

---

>ref|XM_511661.1| PREDICTED: Pan troglodytes similar to Galectin-3 binding protein
            precursor (Lectin galactoside-binding soluble 3 binding
            protein) (Mac-2 binding protein) (Mac-2 BP) (MAC2BP)
            (Tumor-associated antigen 90K) (LOC454863), mRNA
          Length = 1677

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 257  tggtgacgccggccagcagc 276
            ||||||||||||||||||||
Sbjct: 1181 tggtgacgccggccagcagc 1200

---

>ref|XM_527249.1| PREDICTED: Pan troglodytes similar to H2A histone family, member P
           (LOC471871), mRNA
          Length = 660

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 229 atgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           ||||| ||||| || ||||| ||||||||||||||  || ||||||||
Sbjct: 497 atgttgggcaggacaccgccctgcgcgatggtgacttcgcccagcagc 450

---

>gb|BC107354.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MGC:130330
           IMAGE:40055855), complete cds
          Length = 391

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| ||||| || ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccaccctgcgcgatggtcacgc 299

---

>gb|BC107355.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MGC:130331
           IMAGE:40055860), complete cds
          Length = 391

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| ||||| || ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccaccctgcgcgatggtcacgc 299

---

>ref|XM_513764.1| PREDICTED: Pan troglodytes LOC457261 (LOC457261), mRNA
          Length = 789

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgac 263
           |||||||||||  |||||||| || |||||||||||
Sbjct: 741 gatgttaggcaagacgccgccctgggcgatggtgac 706

---

>ref|NM_003517.2| Homo sapiens histone 2, H2ac (HIST2H2AC), mRNA
          Length = 437

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgac 263
           |||||||||||  |||||||| || |||||||||||
Sbjct: 336 gatgttaggcaaaacgccgccctgggcgatggtgac 301

---

>ref|NM_006632.1| Homo sapiens solute carrier family 17 (sodium phosphate), member 3
           (SLC17A3), mRNA
          Length = 1795

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 229 atgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
           ||||| ||||| || ||||| ||||||||||||||  || ||||||||
Sbjct: 236 atgttgggcaggacaccgccctgcgcgatggtgacttcgcccagcagc 189

---

>gb|AY648852.1| Homo sapiens histone H2A/r gene, complete cds
          Length = 1119

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgac 263
           |||||||||||  |||||||| || |||||||||||
Sbjct: 709 gatgttaggcaaaacgccgccctgggcgatggtgac 674

---

>ref|NM_175658.1| Mus musculus histone 1, H2aa (Hist1h2aa), mRNA
          Length = 390

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | |||||| ||||| ||||| || ||||||||||| ||||
Sbjct: 358 tcttgggcagcagcacggcctggatgttgggcaggacgccaccctgcgcgatggtcacgc 299

---

>gb|AY389715.1| Hyacinthus orientalis histone H2A-like protein mRNA, partial cds
          Length = 267

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 214 agcagcaccgggttgatgtt 233
           ||||||||||||||||||||
Sbjct: 22  agcagcaccgggttgatgtt 3

---

>gb|BC019308.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MGC:4205
           IMAGE:2823572), complete cds
          Length = 567

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgac 263
           |||||||||||  |||||||| || |||||||||||
Sbjct: 374 gatgttaggcaagacgccgccctgggcgatggtgac 339

---

>gb|BC001629.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MGC:2238
           IMAGE:3536984), complete cds
          Length = 567

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgac 263
           |||||||||||  |||||||| || |||||||||||
Sbjct: 374 gatgttaggcaagacgccgccctgggcgatggtgac 339

---

>ref|XM_583595.2| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC538911), mRNA
          Length = 1488

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                       
Query: 206 tcttggggagcagcaccgggttgatgttaggcagcacgccgccgtgcgcgatggtgacgc 265
           ||||||| |||||||| |  | ||| |||||||| || ||||| ||||||||||| ||||
Sbjct: 396 tcttgggcagcagcacggcctggatattaggcaggacaccgccctgcgcgatggtcacgc 337

---

>ref|NM_003516.2| Homo sapiens histone 2, H2aa (HIST2H2AA), mRNA
          Length = 534

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgac 263
           |||||||||||  |||||||| || |||||||||||
Sbjct: 389 gatgttaggcaagacgccgccctgggcgatggtgac 354

---

>gb|AC167023.2| Mus musculus BAC clone RP23-21J7 from chromosome 7, complete sequence
          Length = 214762

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 185    tgggctccttctccgccgtc 204
              ||||||||||||||||||||
Sbjct: 177671 tgggctccttctccgccgtc 177652

---

>ref|XM_540292.2| PREDICTED: Canis familiaris similar to histone 2, H2ac (LOC483174),
           mRNA
          Length = 485

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgac 263
           |||||| ||||| |||||||| || |||||||||||
Sbjct: 393 gatgttgggcaggacgccgccctgggcgatggtgac 358

---

>ref|XM_845715.1| PREDICTED: Canis familiaris similar to Histone H2A.o (H2A/o)
           (H2A.2) (H2a-615) (LOC608631), mRNA
          Length = 534

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgac 263
           |||||| ||||| |||||||| || |||||||||||
Sbjct: 371 gatgttgggcaggacgccgccctgggcgatggtgac 336

---

>ref|XM_540286.2| PREDICTED: Canis familiaris similar to Histone H2A.o (H2A/o)
           (H2A.2) (H2a-615) (LOC483168), mRNA
          Length = 534

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 228 gatgttaggcagcacgccgccgtgcgcgatggtgac 263
           |||||| ||||| |||||||| || |||||||||||
Sbjct: 371 gatgttgggcaggacgccgccctgggcgatggtgac 336

---

>gb|AC125226.3| Mus musculus BAC clone RP23-39D21 from 7, complete sequence
          Length = 133624

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 185   tgggctccttctccgccgtc 204
             ||||||||||||||||||||
Sbjct: 43360 tgggctccttctccgccgtc 43341

---

>gb|AC143340.4| Medicago truncatula clone mth2-7f4, complete sequence
          Length = 114535

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     tcaacaatttgctcaaatca 21
             ||||||||||||||||||||
Sbjct: 98432 tcaacaatttgctcaaatca 98413

---

>gb|AC137836.25| Medicago truncatula clone mth2-10f14, complete sequence
          Length = 140197

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     tcaacaatttgctcaaatca 21
             ||||||||||||||||||||
Sbjct: 35136 tcaacaatttgctcaaatca 35117

---

>gb|AC139290.15| Medicago truncatula clone mth2-23f4, complete sequence
          Length = 127701

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     tcaacaatttgctcaaatca 21
             ||||||||||||||||||||
Sbjct: 63949 tcaacaatttgctcaaatca 63930

---

>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a
              ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
              (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of
              IgG, high affinity Ia, receptor for (CD64), a novel gene
              similar to histone 2, H2be (HIST2H2BE), a novel gene
              similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for
              histone 2, H4, the HIST2H3C gene for histone 2, H3c, the
              HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd
              pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene
              (HIST2H2BC), a novel gene similar to histone 2, H2aa
              (HIST2H2AA), a novel gene similar to histone 2, H3c
              (HIST2H3C), a novel gene similar to histone 1, H4
              (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the
              HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for
              histone 2, H2ab, a novel protein similar to histone 2, a
              novel gene, the SV2A gene for synaptic vesicle glycoprotein
              2A, the 3' end of the SF3B4 gene for splicing factor 3b,
              subunit 4, 49kDa and five CpG islands, complete sequence
          Length = 188956

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 228    gatgttaggcagcacgccgccgtgcgcgatggtgac 263
              |||||||||||  |||||||| || |||||||||||
Sbjct: 149020 gatgttaggcaaaacgccgccctgggcgatggtgac 148985



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 228    gatgttaggcagcacgccgccgtgcgcgatggtgac 263
              |||||||||||  |||||||| || |||||||||||
Sbjct: 113176 gatgttaggcaagacgccgccctgggcgatggtgac 113141



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                  
Query: 228    gatgttaggcagcacgccgccgtgcgcgatggtgac 263
              |||||||||||  |||||||| || |||||||||||
Sbjct: 104090 gatgttaggcaagacgccgccctgggcgatggtgac 104125

---

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 257     tggtgacgccggccagcagc 276
               ||||||||||||||||||||
Sbjct: 1718253 tggtgacgccggccagcagc 1718234

---

>emb|AL138726.12| Human DNA sequence from clone RP1-139G21 on chromosome 6 Contains (part
             of) the SLC17A1, SLC17A2 and SLC17A3 genes for the sodium
             phosphate solute carrier family 17 members 1, 2 and 3 and
             a H2A (histone 2A) pseudogene, complete sequence
          Length = 136646

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                             
Query: 229   atgttaggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 276
             ||||| ||||| || ||||| ||||||||||||||  || ||||||||
Sbjct: 45419 atgttgggcaggacaccgccctgcgcgatggtgacttcgcccagcagc 45372

---

>emb|AL050344.31|HSJ799D16 Human DNA sequence from clone RP4-799D16 on chromosome 1p34.3-36.1
             Contains the 3' end of a novel gene, complete sequence
          Length = 127109

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 303   ggcgaggagcaggtgcctgg 322
             ||||||||||||||||||||
Sbjct: 51539 ggcgaggagcaggtgcctgg 51558

---

>gb|AC137931.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0039F10, complete sequence
          Length = 139714

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 153   cttggcggccttcttgggcgacttgccctcct 184
             ||||||| ||||||||||||||| || |||||
Sbjct: 67556 cttggcgcccttcttgggcgactcgctctcct 67525

---

>ref|XM_967564.1| PREDICTED: Tribolium castaneum similar to CG4356-PA, isoform A
            (LOC661406), mRNA
          Length = 1794

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 127  gccttcttgtcggccttctt 146
            ||||||||||||||||||||
Sbjct: 1520 gccttcttgtcggccttctt 1501

---

>emb|BX072218.1|CNS09RVY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 468

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 191 ccttctccgccgtcctcttgggga 214
           ||||||||||| ||||||||||||
Sbjct: 132 ccttctccgccttcctcttgggga 155

---

>emb|BX038155.1|CNS091LR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 339

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 191 ccttctccgccgtcctcttgggga 214
           ||||||||||| ||||||||||||
Sbjct: 132 ccttctccgccttcctcttgggga 155


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,651,175
Number of Sequences: 3902068
Number of extensions: 2651175
Number of successful extensions: 51230
Number of sequences better than 10.0: 287
Number of HSP's better than 10.0 without gapping: 294
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50210
Number of HSP's gapped (non-prelim): 991
length of query: 329
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 307
effective length of database: 17,147,199,772
effective search space: 5264190330004
effective search space used: 5264190330004
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---