ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast47f08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AB021918.1| Bactrocera kandiensis G6pdh gene for glucose-6-p... 40 1.3
2dbj|AB021917.1| Bactrocera carambolae G6pdh gene for glucose-6-p... 40 1.3
3dbj|AB021910.1| Bactrocera dorsalis strain Ogasawara G6pdh gene ... 40 1.3
4dbj|AB021909.1| Bactrocera dorsalis strain Amami-oshima G6pdh ge... 40 1.3
5gb|AC147382.3| Pan troglodytes BAC clone RP43-171M24 from 7, com... 38 5.3
6gb|AC146098.3| Pan troglodytes BAC clone RP43-51J12 from 7, comp... 38 5.3
7gb|AC126455.4| Mus musculus BAC clone RP23-260P2 from chromosome... 38 5.3
8gb|AC096752.4| Homo sapiens BAC clone RP11-454E2 from 7, complet... 38 5.3
9emb|AL445588.12| Human DNA sequence from clone RP11-522H16 on ch... 38 5.3
10emb|AL445684.8| Human DNA sequence from clone RP11-45D15 on chro... 38 5.3
11gb|AE003849.1| Xylella fastidiosa 9a5c, complete genome 38 5.3
12gb|AC009623.6|AC009623 Homo sapiens chromosome 8, clone RP11-219... 38 5.3
13gb|AC019097.5| Homo sapiens BAC clone RP11-425I16 from 2, comple... 38 5.3

>dbj|AB021918.1| Bactrocera kandiensis G6pdh gene for glucose-6-phosphate
           dehydrogenase, partial cds
          Length = 1069

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 68  tttcattgactaaaagatgggaaa 91
           ||||||||||| ||||||||||||
Sbjct: 884 tttcattgacttaaagatgggaaa 861



to top

>dbj|AB021917.1| Bactrocera carambolae G6pdh gene for glucose-6-phosphate
           dehydrogenase, partial cds
          Length = 1071

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 68  tttcattgactaaaagatgggaaa 91
           ||||||||||| ||||||||||||
Sbjct: 886 tttcattgacttaaagatgggaaa 863



to top

>dbj|AB021910.1| Bactrocera dorsalis strain Ogasawara G6pdh gene for
           glucose-6-phosphate dehydrogenase, partial cds
          Length = 1069

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 68  tttcattgactaaaagatgggaaa 91
           ||||||||||| ||||||||||||
Sbjct: 884 tttcattgacttaaagatgggaaa 861



to top

>dbj|AB021909.1| Bactrocera dorsalis strain Amami-oshima G6pdh gene for
           glucose-6-phosphate dehydrogenase, partial cds
          Length = 1069

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 68  tttcattgactaaaagatgggaaa 91
           ||||||||||| ||||||||||||
Sbjct: 884 tttcattgacttaaagatgggaaa 861



to top

>gb|AC147382.3| Pan troglodytes BAC clone RP43-171M24 from 7, complete sequence
          Length = 198872

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 69     ttcattgactaaaagatgg 87
              |||||||||||||||||||
Sbjct: 188304 ttcattgactaaaagatgg 188322



to top

>gb|AC146098.3| Pan troglodytes BAC clone RP43-51J12 from 7, complete sequence
          Length = 195811

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 69    ttcattgactaaaagatgg 87
             |||||||||||||||||||
Sbjct: 54339 ttcattgactaaaagatgg 54357



to top

>gb|AC126455.4| Mus musculus BAC clone RP23-260P2 from chromosome 16, complete sequence
          Length = 197474

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 55    ccctgacaatccatttcat 73
             |||||||||||||||||||
Sbjct: 80737 ccctgacaatccatttcat 80719



to top

>gb|AC096752.4| Homo sapiens BAC clone RP11-454E2 from 7, complete sequence
          Length = 131629

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 69    ttcattgactaaaagatgg 87
             |||||||||||||||||||
Sbjct: 86012 ttcattgactaaaagatgg 85994



to top

>emb|AL445588.12| Human DNA sequence from clone RP11-522H16 on chromosome 13, complete
             sequence
          Length = 174591

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    catttcattgactaaaaga 84
             |||||||||||||||||||
Sbjct: 92203 catttcattgactaaaaga 92185



to top

>emb|AL445684.8| Human DNA sequence from clone RP11-45D15 on chromosome 9 Contains a CpG
             island, complete sequence
          Length = 140091

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 55    ccctgacaatccatttcat 73
             |||||||||||||||||||
Sbjct: 47346 ccctgacaatccatttcat 47364



to top

>gb|AE003849.1| Xylella fastidiosa 9a5c, complete genome
          Length = 2679306

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 69    ttcattgactaaaagatgg 87
             |||||||||||||||||||
Sbjct: 19078 ttcattgactaaaagatgg 19060



to top

>gb|AC009623.6|AC009623 Homo sapiens chromosome 8, clone RP11-219J21, complete sequence
          Length = 196953

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 64    tccatttcattgactaaaa 82
             |||||||||||||||||||
Sbjct: 68268 tccatttcattgactaaaa 68250



to top

>gb|AC019097.5| Homo sapiens BAC clone RP11-425I16 from 2, complete sequence
          Length = 186023

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 1      aaacaaaacataatcccat 19
              |||||||||||||||||||
Sbjct: 112348 aaacaaaacataatcccat 112330


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,105,678
Number of Sequences: 3902068
Number of extensions: 1105678
Number of successful extensions: 80462
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 80436
Number of HSP's gapped (non-prelim): 26
length of query: 115
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 94
effective length of database: 17,151,101,840
effective search space: 1612203572960
effective search space used: 1612203572960
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top