>emb|CT963112.1| Medicago truncatula chromosome 5 clone mth2-117d22, COMPLETE SEQUENCE
          Length = 118597

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 295   taatcagtcacctagacatgt 315
             |||||||||||||||||||||
Sbjct: 29042 taatcagtcacctagacatgt 29062

>gb|AC122473.4| Mus musculus BAC clone RP24-326I7 from 12, complete sequence
          Length = 165740

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gggaggcaaagagcaggggca 122
              |||||||||||||||||||||
Sbjct: 102202 gggaggcaaagagcaggggca 102182

>gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, complete sequence
          Length = 6365727

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 319     cagttttcctgaactgtatt 338
               ||||||||||||||||||||
Sbjct: 4087363 cagttttcctgaactgtatt 4087382

>gb|AC084657.1|CBRG46J11 Caenorhabditis briggsae cosmid G46J11, complete sequence
          Length = 36926

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 260  tctaatctgcttgggttttcggaa 283
            ||||||||||||||| ||||||||
Sbjct: 9150 tctaatctgcttgggatttcggaa 9127

>gb|AC078878.20| Homo sapiens 12 BAC RP11-983C2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 172393

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 1     aacctaaaagcatcttaactaatt 24
             |||||||||||||||||| |||||
Sbjct: 63759 aacctaaaagcatcttaaataatt 63736


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,375,570
Number of Sequences: 3902068
Number of extensions: 2375570
Number of successful extensions: 41252
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41234
Number of HSP's gapped (non-prelim): 18
length of query: 365
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 343
effective length of database: 17,147,199,772
effective search space: 5881489521796
effective search space used: 5881489521796
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)