ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast46g07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC004633.1| Homo sapiens chromosome 5, P1 clone 41e13 (LBNL H... 42 1.1
2emb|AL449423.14| Human DNA sequence from clone RP11-149I2 on chr... 42 1.1
3gb|AC010433.9| Homo sapiens chromosome 5 clone CTD-2202L20, comp... 42 1.1
4gb|AC000047.6| Combined sequence from cosmids c110 and c20 deriv... 42 1.1
5gb|AC138460.4| Mus musculus BAC clone RP23-295A7 from 8, complet... 42 1.1
6gb|AC163288.4| Mus musculus BAC clone RP23-279M5 from chromosome... 42 1.1
7dbj|AB060808.1| Homo sapiens gene for p16/CDKN2A, complete cds 42 1.1
8gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome 40 4.2
9emb|BX897700.1| Bartonella quintana str. Toulouse, complete genome 40 4.2
10dbj|AP001085.5| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 4.2

>gb|AC004633.1| Homo sapiens chromosome 5, P1 clone 41e13 (LBNL H151), complete
             sequence
          Length = 89484

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 37    ttacacatatttttaagtatgtgta 61
             |||||||||||| ||||||||||||
Sbjct: 59099 ttacacatatttgtaagtatgtgta 59123



to top

>emb|AL449423.14| Human DNA sequence from clone RP11-149I2 on chromosome 9 Contains the
             CDKN2A gene for cyclin-dependent kinase inhibitor 2A
             (melanoma, p16, inhibits CDK4), the gene for
             susceptibility protein NSG-x (LOC51198), the 5' end of a
             variant of the MTAP gene for methylthioadenosine
             phosphorylase (MSAP), the 3' end of the CDKN2B gene for
             cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)
             and 4 CpG islands, complete sequence
          Length = 101155

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 37    ttacacatatttttaagtatg 57
             |||||||||||||||||||||
Sbjct: 30725 ttacacatatttttaagtatg 30705



to top

>gb|AC010433.9| Homo sapiens chromosome 5 clone CTD-2202L20, complete sequence
          Length = 258929

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 37    ttacacatatttttaagtatgtgta 61
             |||||||||||| ||||||||||||
Sbjct: 27566 ttacacatatttgtaagtatgtgta 27590



to top

>gb|AC000047.6| Combined sequence from cosmids c110 and c20 derived from Homo sapiens
             Chromosome 9p21, complete sequence
          Length = 41265

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 37    ttacacatatttttaagtatg 57
             |||||||||||||||||||||
Sbjct: 40048 ttacacatatttttaagtatg 40028



to top

>gb|AC138460.4| Mus musculus BAC clone RP23-295A7 from 8, complete sequence
          Length = 186258

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 44     tatttttaagtatgtgtactg 64
              |||||||||||||||||||||
Sbjct: 157863 tatttttaagtatgtgtactg 157883



to top

>gb|AC163288.4| Mus musculus BAC clone RP23-279M5 from chromosome 8, complete sequence
          Length = 222867

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 44    tatttttaagtatgtgtactg 64
             |||||||||||||||||||||
Sbjct: 37520 tatttttaagtatgtgtactg 37540



to top

>dbj|AB060808.1| Homo sapiens gene for p16/CDKN2A, complete cds
          Length = 250000

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 37     ttacacatatttttaagtatg 57
              |||||||||||||||||||||
Sbjct: 157369 ttacacatatttttaagtatg 157349



to top

>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome
          Length = 3059876

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 42      catatttttaagtatgtgta 61
               ||||||||||||||||||||
Sbjct: 1109831 catatttttaagtatgtgta 1109850



to top

>emb|BX897700.1| Bartonella quintana str. Toulouse, complete genome
          Length = 1581384

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 265     tgaatttcctgtaaacgttg 284
               ||||||||||||||||||||
Sbjct: 1127122 tgaatttcctgtaaacgttg 1127103



to top

>dbj|AP001085.5| Homo sapiens genomic DNA, chromosome 11q clone:RP11-632K5, complete
             sequence
          Length = 175747

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 169   cttctatgggaaggctactc 188
             ||||||||||||||||||||
Sbjct: 55387 cttctatgggaaggctactc 55368


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,932,787
Number of Sequences: 3902068
Number of extensions: 1932787
Number of successful extensions: 32269
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 32247
Number of HSP's gapped (non-prelim): 22
length of query: 318
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 296
effective length of database: 17,147,199,772
effective search space: 5075571132512
effective search space used: 5075571132512
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top