>emb|AL714030.6| Zebrafish DNA sequence from clone BUSM1-223C6 in linkage group 11
             Contains part of a novel gene similar to CACNA1D
             (voltage-dependent calcium channel L type, alpha 1D
             subunit) and a CpG island, complete sequence
          Length = 90347

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 51    ttaaaatagcaatattaacag 71
             |||||||||||||||||||||
Sbjct: 47566 ttaaaatagcaatattaacag 47546

>emb|BX571969.5| Zebrafish DNA sequence from clone DKEY-93P1 in linkage group 11, complete
              sequence
          Length = 160905

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 51     ttaaaatagcaatattaacag 71
              |||||||||||||||||||||
Sbjct: 125578 ttaaaatagcaatattaacag 125558

>emb|BX248137.9| Zebrafish DNA sequence from clone DKEY-19L19, complete sequence
          Length = 209896

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 98     ctgcactgttgtagttaaag 117
              ||||||||||||||||||||
Sbjct: 169867 ctgcactgttgtagttaaag 169886

>dbj|AK127858.1| Homo sapiens cDNA FLJ45961 fis, clone PLACE7013055
          Length = 3514

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 48   aaattaaaatagcaatatta 67
            ||||||||||||||||||||
Sbjct: 1473 aaattaaaatagcaatatta 1454

>gb|AE016826.1| Buchnera aphidicola str. Bp (Baizongia pistaciae), complete genome
          Length = 615980

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 51     ttaaaatagcaatattaaca 70
              ||||||||||||||||||||
Sbjct: 238223 ttaaaatagcaatattaaca 238204

>gb|AC009228.4| Homo sapiens BAC clone RP11-219F1 from 2, complete sequence
          Length = 173552

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 48    aaattaaaatagcaatatta 67
             ||||||||||||||||||||
Sbjct: 72577 aaattaaaatagcaatatta 72596

>gb|AC074363.3| Homo sapiens BAC clone RP11-31F22 from 2, complete sequence
          Length = 151325

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 48    aaattaaaatagcaatatta 67
             ||||||||||||||||||||
Sbjct: 27426 aaattaaaatagcaatatta 27445

>gb|AE001438.3| Clostridium acetobutylicum ATCC 824 megaplasmid pSOL1, complete
             sequence
          Length = 192000

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    aattaaaatagcaatattaa 68
             ||||||||||||||||||||
Sbjct: 76267 aattaaaatagcaatattaa 76248


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,508,978
Number of Sequences: 3902068
Number of extensions: 2508978
Number of successful extensions: 181312
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 181277
Number of HSP's gapped (non-prelim): 35
length of query: 215
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 193
effective length of database: 17,147,199,772
effective search space: 3309409555996
effective search space used: 3309409555996
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)