>ref|XM_472771.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 867

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 85/99 (85%)
 Strand = Plus / Minus

                                                                       
Query: 270 ctgcttctcgaactcctcgacgtatctcgcaaagttgaggatgatcctcttgccttcagg 329
           ||||||||| | |||||||| | | ||| | |||||||| ||||||||||||||||| ||
Sbjct: 846 ctgcttctccagctcctcgatgaacctcacgaagttgagaatgatcctcttgccttctgg 787

                                                  
Query: 330 tgtgataatactctctgggtggaactggaccccctggat 368
            ||||| || |||||||||||||| ||||| ||||||||
Sbjct: 786 ggtgatgatgctctctgggtggaattggactccctggat 748

>dbj|AB116721.1| Oryza sativa (japonica cultivar-group) OASB1 mRNA for anthranilate
           synthase beta 1 subunit, complete cds
          Length = 867

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 85/99 (85%)
 Strand = Plus / Minus

                                                                       
Query: 270 ctgcttctcgaactcctcgacgtatctcgcaaagttgaggatgatcctcttgccttcagg 329
           ||||||||| | |||||||| | | ||| | |||||||| ||||||||||||||||| ||
Sbjct: 846 ctgcttctccagctcctcgatgaacctcacgaagttgagaatgatcctcttgccttctgg 787

                                                  
Query: 330 tgtgataatactctctgggtggaactggaccccctggat 368
            ||||| || |||||||||||||| ||||| ||||||||
Sbjct: 786 ggtgatgatgctctctgggtggaattggactccctggat 748

>dbj|AK107879.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-134-D04, full
           insert sequence
          Length = 1104

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 85/99 (85%)
 Strand = Plus / Minus

                                                                       
Query: 270 ctgcttctcgaactcctcgacgtatctcgcaaagttgaggatgatcctcttgccttcagg 329
           ||||||||| | |||||||| | | ||| | |||||||| ||||||||||||||||| ||
Sbjct: 926 ctgcttctccagctcctcgatgaacctcacgaagttgagaatgatcctcttgccttctgg 867

                                                  
Query: 330 tgtgataatactctctgggtggaactggaccccctggat 368
            ||||| || |||||||||||||| ||||| ||||||||
Sbjct: 866 ggtgatgatgctctctgggtggaattggactccctggat 828

>emb|BX842605.1|OSJN00299 Oryza sativa genomic DNA, chromosome 4, BAC clone: B1358B12, complete
              sequence
          Length = 131246

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 82/96 (85%)
 Strand = Plus / Plus

                                                                          
Query: 270    ctgcttctcgaactcctcgacgtatctcgcaaagttgaggatgatcctcttgccttcagg 329
              ||||||||| | |||||||| | | ||| | |||||||| ||||||||||||||||| ||
Sbjct: 110361 ctgcttctccagctcctcgatgaacctcacgaagttgagaatgatcctcttgccttctgg 110420

                                                  
Query: 330    tgtgataatactctctgggtggaactggaccccctg 365
               ||||| || |||||||||||||| ||||| |||||
Sbjct: 110421 ggtgatgatgctctctgggtggaattggactccctg 110456

>emb|AL663017.3|OSJN00149 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0060P14,
            complete sequence
          Length = 139418

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 82/96 (85%)
 Strand = Plus / Plus

                                                                        
Query: 270  ctgcttctcgaactcctcgacgtatctcgcaaagttgaggatgatcctcttgccttcagg 329
            ||||||||| | |||||||| | | ||| | |||||||| ||||||||||||||||| ||
Sbjct: 4214 ctgcttctccagctcctcgatgaacctcacgaagttgagaatgatcctcttgccttctgg 4273

                                                
Query: 330  tgtgataatactctctgggtggaactggaccccctg 365
             ||||| || |||||||||||||| ||||| |||||
Sbjct: 4274 ggtgatgatgctctctgggtggaattggactccctg 4309

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 82/96 (85%)
 Strand = Plus / Plus

                                                                            
Query: 270      ctgcttctcgaactcctcgacgtatctcgcaaagttgaggatgatcctcttgccttcagg 329
                ||||||||| | |||||||| | | ||| | |||||||| ||||||||||||||||| ||
Sbjct: 23114021 ctgcttctccagctcctcgatgaacctcacgaagttgagaatgatcctcttgccttctgg 23114080

                                                    
Query: 330      tgtgataatactctctgggtggaactggaccccctg 365
                 ||||| || |||||||||||||| ||||| |||||
Sbjct: 23114081 ggtgatgatgctctctgggtggaattggactccctg 23114116



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 270      ctgcttctcgaactcctcga 289
                ||||||||||||||||||||
Sbjct: 19324910 ctgcttctcgaactcctcga 19324891

>emb|AL512547.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: B0812A04, complete
             sequence
          Length = 43144

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 82/96 (85%)
 Strand = Plus / Plus

                                                                         
Query: 270   ctgcttctcgaactcctcgacgtatctcgcaaagttgaggatgatcctcttgccttcagg 329
             ||||||||| | |||||||| | | ||| | |||||||| ||||||||||||||||| ||
Sbjct: 34941 ctgcttctccagctcctcgatgaacctcacgaagttgagaatgatcctcttgccttctgg 35000

                                                 
Query: 330   tgtgataatactctctgggtggaactggaccccctg 365
              ||||| || |||||||||||||| ||||| |||||
Sbjct: 35001 ggtgatgatgctctctgggtggaattggactccctg 35036

>gb|BT017892.1| Zea mays clone EL01N0515B07.c mRNA sequence
          Length = 951

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 299 caaagttgaggatgatcctcttgccttcaggtgtgataatactctctgggtggaactgga 358
           ||||||||||||||||  ||||||||||||| ||||| || ||||| |||||||| ||||
Sbjct: 541 caaagttgaggatgattttcttgccttcaggggtgatgatgctctccgggtggaattgga 482

                     
Query: 359 ccccctggat 368
           | ||||||||
Sbjct: 481 caccctggat 472

>gb|AY105008.1| Zea mays PCO123247 mRNA sequence
          Length = 1195

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 299 caaagttgaggatgatcctcttgccttcaggtgtgataatactctctgggtggaactgga 358
           ||||||||||||||||  ||||||||||||| ||||| || ||||| |||||||| ||||
Sbjct: 807 caaagttgaggatgattttcttgccttcaggggtgatgatgctctccgggtggaattgga 748

                     
Query: 359 ccccctggat 368
           | ||||||||
Sbjct: 747 caccctggat 738

>gb|AC154740.2| Mus musculus BAC clone RP23-118I16 from chromosome 9, complete sequence
          Length = 222313

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 133    tctttgcccttattcctttcct 154
              ||||||||||||||||||||||
Sbjct: 176906 tctttgcccttattcctttcct 176927

>gb|AC026397.4| Homo sapiens chromosome 16 clone CTA-162C2, complete sequence
          Length = 124998

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 311  tgatcctcttgccttcaggtg 331
            |||||||||||||||||||||
Sbjct: 7661 tgatcctcttgccttcaggtg 7641

>gb|AC044802.6| Homo sapiens chromosome 16 clone RP11-61A14, complete sequence
          Length = 170691

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 311   tgatcctcttgccttcaggtg 331
             |||||||||||||||||||||
Sbjct: 33530 tgatcctcttgccttcaggtg 33510

>gb|AC004638.1|HUAC004638 Homo sapiens Chromosome 16 BAC clone CIT987SK-A-116A10, complete
            sequence
          Length = 124645

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 311  tgatcctcttgccttcaggtg 331
            |||||||||||||||||||||
Sbjct: 7661 tgatcctcttgccttcaggtg 7641

>gb|AC163683.4| Mus musculus BAC clone RP23-8L20 from chromosome 6, complete sequence
          Length = 218138

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 217   ttcctctaactgctctgctt 236
             ||||||||||||||||||||
Sbjct: 74264 ttcctctaactgctctgctt 74283

>gb|AY536286.1| Calocera cornea isolate AFTOL-ID 438 RNA polymerase II second largest
            subunit (RPB2) gene, partial cds
          Length = 1995

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 272  gcttctcgaactcctcgacg 291
            ||||||||||||||||||||
Sbjct: 1458 gcttctcgaactcctcgacg 1439

>gb|AC138101.8| Mus musculus chromosome 5, clone RP23-149H20, complete sequence
          Length = 211521

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 310   atgatcctcttgccttcagg 329
             ||||||||||||||||||||
Sbjct: 13687 atgatcctcttgccttcagg 13706

>emb|AL354862.11| Human DNA sequence from clone RP11-83L6 on chromosome 9 Contains an
              olfactory receptor pseudsogene, the SYK gene for spleen
              tyrosine kinase and a CpG island, complete sequence
          Length = 153954

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 160    tctgctttgcttttaggccc 179
              ||||||||||||||||||||
Sbjct: 136813 tctgctttgcttttaggccc 136832

>emb|AL353751.13| Human DNA sequence from clone RP11-149I23 on chromosome 10 Contains the
             5' end of the LIPA gene for lipase A lysosomal acid
             cholesterol esterase (Wolman disease), a novel gene, the
             IFIT2 gene for interferon-induced protein with
             tetratricopeptide repeats 2, the IFIT4 gene for
             interferon-induced protein with tetratricopeptide repeats
             4, an interferon-induced protein with tetratricopeptide
             repeats 1 (IFIT1) pseudogene, the gene for a novel protein
             similar to interferon-induced protein with
             tetratricopeptide repeats 1 (IFIT1) and a CpG island,
             complete sequence
          Length = 169404

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 145   ttcctttcctctgaatctgc 164
             ||||||||||||||||||||
Sbjct: 62326 ttcctttcctctgaatctgc 62345

>emb|X53576.1|ANTRPCA Aspergillus niger trpC gene for glutamine amidotransferase,
           indoglycerolphosphate synthetase, and
           phosphoribosylanthranilate isomerase
          Length = 2830

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 337 atactctctgggtggaactggaccccct 364
           |||||||| |||||||||||||| ||||
Sbjct: 923 atactctcggggtggaactggactccct 896

>emb|AL731600.3|OSJN00243 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0055C08,
              complete sequence
          Length = 145670

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 270    ctgcttctcgaactcctcga 289
              ||||||||||||||||||||
Sbjct: 106742 ctgcttctcgaactcctcga 106723

>dbj|AK094808.1| Homo sapiens cDNA FLJ37489 fis, clone BRAWH2014729
          Length = 3628

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 160 tctgctttgcttttaggccc 179
           ||||||||||||||||||||
Sbjct: 502 tctgctttgcttttaggccc 521

>gb|DQ385882.1| Cylindrobasidium evolvens strain KB990121-8 RNA polymerase II second
            largest subunit (rpb2) gene, partial cds
          Length = 2447

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 272  gcttctcgaactcctcgacg 291
            ||||||||||||||||||||
Sbjct: 2033 gcttctcgaactcctcgacg 2014

>gb|AF325177.1| Mus musculus BAC470L12 sequence
          Length = 205602

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 311   tgatcctcttgccttcaggt 330
             ||||||||||||||||||||
Sbjct: 98759 tgatcctcttgccttcaggt 98740

>gb|AC021581.10| Homo sapiens chromosome 17, clone RP11-956N15, complete sequence
          Length = 181607

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 160   tctgctttgcttttaggccc 179
             ||||||||||||||||||||
Sbjct: 11982 tctgctttgcttttaggccc 11963

>gb|AC160824.2| Xenopus tropicalis Irx5 gene, complete cds, complete sequence
          Length = 73293

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 218   tcctctaactgctctgcttcctga 241
             ||||||||||||||| ||||||||
Sbjct: 30329 tcctctaactgctcttcttcctga 30352

>gb|AC108037.3| Homo sapiens BAC clone RP11-168E17 from 4, complete sequence
          Length = 73477

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 7     atttacccatttattacttg 26
             ||||||||||||||||||||
Sbjct: 51607 atttacccatttattacttg 51588

>gb|AF289666.1|AF289666 Mus musculus GTF2I and GTF2IRD1 genes, partial cds
          Length = 130665

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 311   tgatcctcttgccttcaggt 330
             ||||||||||||||||||||
Sbjct: 50764 tgatcctcttgccttcaggt 50783

>gb|AC117622.10| Mus musculus chromosome 5, clone RP23-114L5, complete sequence
          Length = 185368

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 134   ctttgcccttattcctttcc 153
             ||||||||||||||||||||
Sbjct: 98428 ctttgcccttattcctttcc 98409

>gb|AC013622.12| Mus musculus chromosome 5, clone RP23-232H18, complete sequence
          Length = 240821

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 310    atgatcctcttgccttcagg 329
              ||||||||||||||||||||
Sbjct: 114460 atgatcctcttgccttcagg 114441

>gb|AC167419.4| Mus musculus BAC clone RP24-359H20 from chromosome 5, complete
            sequence
          Length = 179790

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 311  tgatcctcttgccttcaggt 330
            ||||||||||||||||||||
Sbjct: 5217 tgatcctcttgccttcaggt 5236


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,459,348
Number of Sequences: 3902068
Number of extensions: 3459348
Number of successful extensions: 67386
Number of sequences better than 10.0: 30
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 67297
Number of HSP's gapped (non-prelim): 89
length of query: 370
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 348
effective length of database: 17,147,199,772
effective search space: 5967225520656
effective search space used: 5967225520656
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)