ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast41h12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AL929387.7| Human DNA sequence from clone RP11-398F12 on chr... 40 0.20
2gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 40 0.20
3gb|BC037213.1| Homo sapiens cDNA clone IMAGE:4829494 40 0.20
4ref|NM_195439.1| Oryza sativa (japonica cultivar-group) putative... 38 0.78
5ref|NM_005273.2| Homo sapiens guanine nucleotide binding protein... 38 0.78
6gb|AF064853.1| Homo sapiens map 7qter; 41.64cR from WI-8540 repe... 38 0.78
7gb|AF053356.1| Homo sapiens chromosome 7q22 sequence, complete s... 38 0.78
8ref|XM_594059.2| PREDICTED: Bos taurus guanine nucleotide bindin... 38 0.78
9ref|XM_882636.1| PREDICTED: Bos taurus guanine nucleotide bindin... 38 0.78
10ref|XM_869432.1| PREDICTED: Bos taurus guanine nucleotide bindin... 38 0.78
11ref|XM_882625.1| PREDICTED: Bos taurus guanine nucleotide bindin... 38 0.78
12ref|XM_882610.1| PREDICTED: Bos taurus guanine nucleotide bindin... 38 0.78
13gb|BC059942.1| Mus musculus guanine nucleotide binding protein, ... 38 0.78
14gb|BC012348.1| Homo sapiens guanine nucleotide binding protein (... 38 0.78
15gb|BC010073.2| Homo sapiens guanine nucleotide binding protein (... 38 0.78
16gb|AC087289.9| Homo sapiens chromosome 17, clone RP11-552F3, com... 38 0.78
17gb|BC065579.1| Rattus norvegicus guanine nucleotide binding prot... 38 0.78
18gb|BC062178.1| Mus musculus guanine nucleotide binding protein, ... 38 0.78
19emb|CR624493.1| full-length cDNA clone CS0DI035YA06 of Placenta ... 38 0.78
20emb|CR624304.1| full-length cDNA clone CS0DF028YF19 of Fetal bra... 38 0.78
21emb|CR623391.1| full-length cDNA clone CS0DB004YB12 of Neuroblas... 38 0.78
22emb|CR621759.1| full-length cDNA clone CS0DI030YN12 of Placenta ... 38 0.78
23emb|CR621645.1| full-length cDNA clone CS0DC029YC09 of Neuroblas... 38 0.78
24emb|CR619728.1| full-length cDNA clone CS0DF038YD19 of Fetal bra... 38 0.78
25emb|CR617841.1| full-length cDNA clone CS0DN001YB06 of Adult bra... 38 0.78
26emb|CR617794.1| full-length cDNA clone CS0DC015YG05 of Neuroblas... 38 0.78
27emb|CR614935.1| full-length cDNA clone CS0DF009YM13 of Fetal bra... 38 0.78
28emb|CR610423.1| full-length cDNA clone CS0DI064YP24 of Placenta ... 38 0.78
29emb|CR608300.1| full-length cDNA clone CS0DB003YH12 of Neuroblas... 38 0.78
30emb|CR607124.1| full-length cDNA clone CS0DG004YP12 of B cells (... 38 0.78
31emb|CR606173.1| full-length cDNA clone CS0DF007YK08 of Fetal bra... 38 0.78
32emb|CR605713.1| full-length cDNA clone CS0DJ012YA20 of T cells (... 38 0.78
33emb|CR605173.1| full-length cDNA clone CS0DE006YF20 of Placenta ... 38 0.78
34emb|CR599855.1| full-length cDNA clone CS0DF008YP02 of Fetal bra... 38 0.78
35emb|CR595270.1| full-length cDNA clone CS0DL006YN11 of B cells (... 38 0.78
36gb|AC099040.10| Oryza sativa chromosome 10 BAC OSJNBa0004P12 gen... 38 0.78
37dbj|AB045007.1| Mus musculus GNB2 gene for guanine nucleotide bi... 38 0.78
38gb|AC011405.6| Homo sapiens chromosome 5 clone CTB-46B19, comple... 38 0.78
39dbj|AK146941.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 38 0.78
40dbj|AK151628.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 38 0.78
41gb|AC009488.5| Homo sapiens BAC clone RP11-336D7 from 7, complet... 38 0.78
42dbj|AK002604.1| Mus musculus adult male kidney cDNA, RIKEN full-... 38 0.78
43gb|BC068003.1| Homo sapiens guanine nucleotide binding protein (... 38 0.78
44dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 38 0.78
45gb|AF312033.1|AF312033 Mus musculus acetylcholinesterase (Ache) ... 38 0.78
46ref|NM_031037.2| Rattus norvegicus guanine nucleotide binding pr... 38 0.78
47ref|NM_010312.3| Mus musculus guanine nucleotide binding protein... 38 0.78
48gb|AC087749.12| Homo sapiens chromosome 17, clone RP11-474I11, c... 38 0.78
49dbj|AK064659.1| Oryza sativa (japonica cultivar-group) cDNA clon... 38 0.78
50emb|Y11107.3|HSA011107 Homo sapiens ITGB4 gene for integrin beta... 38 0.78
51gb|U66541.1|HSITGBF13 Human beta4-integrin (ITGB4) and alternati... 38 0.78
52gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 38 0.78
53gb|AC148018.3| Mus musculus BAC clone RP23-45G4 from 5, complete... 38 0.78
54gb|AC166328.4| Mus musculus BAC clone RP23-31H5 from chromosome ... 38 0.78
55emb|Y11970.1|MMGNB2 M.musculus mRNA for protein G beta-subunit 38 0.78
56gb|M16538.1|HUMGP Human signal-transducing guanine nucleotide-bi... 38 0.78
57ref|NM_032108.2| Homo sapiens sema domain, transmembrane domain ... 36 3.1
58ref|NM_020241.2| Homo sapiens sema domain, transmembrane domain ... 36 3.1
59ref|NM_133327.1| Homo sapiens sema domain, transmembrane domain ... 36 3.1
60gb|AC111030.11| Mus musculus chromosome 5, clone RP23-415E17, co... 36 3.1
61ref|XM_592676.2| PREDICTED: Bos taurus similar to G patch domain... 36 3.1
62gb|AC116130.15| Mus musculus chromosome 17, clone RP23-98F21, co... 36 3.1
63gb|AC122399.4| Mus musculus BAC clone RP24-92B2 from chromosome ... 36 3.1
64gb|AC124524.3| Mus musculus BAC clone RP23-402C9 from chromosome... 36 3.1
65gb|AY358939.1| Homo sapiens clone DNA80145 semaphorin Z (UNQ1907... 36 3.1
66gb|AC158144.13| Mus musculus chromosome 7, clone RP23-82N3, comp... 36 3.1
67emb|AL589702.8| Human DNA sequence from clone RP5-907A6 on chrom... 36 3.1
68emb|AL357673.12| Human DNA sequence from clone RP11-446E24 on ch... 36 3.1
69emb|AL031591.19|HS353E16 Human DNA sequence from clone RP3-353E1... 36 3.1
70emb|AL031716.8|HS360B4 Human DNA sequence from clone LA16c-360B4... 36 3.1
71emb|AL078630.1|MM573K1 Mouse DNA sequence from clone CT7-BM573K1... 36 3.1
72emb|AJ248284.1|CNSPAX02 Pyrococcus abyssi complete genome; segme... 36 3.1
73gb|AE006465.1| Homo sapiens 16p13.3 sequence section 4 of 8 36 3.1
74emb|CR591947.1| full-length cDNA clone CS0DC013YP19 of Neuroblas... 36 3.1
75gb|AC011498.7| Homo sapiens chromosome 19 clone CTB-50L17, compl... 36 3.1
76gb|AC000105.41| Homo sapiens Chromosome 22q11.2 MDR Region, comp... 36 3.1
77gb|AC004032.7| Homo sapiens Chromosome 22q11.2 BAC Clone b437g10... 36 3.1
78gb|AF532114.1| Mus musculus strain 129/SvJ BAC clone citb544e14 ... 36 3.1
79gb|AC020709.4|AC020709 Homo sapiens clone RP11-425F18, complete ... 36 3.1
80gb|AC175058.1| Mus musculus BAC clone RP23-210C4 from chromosome... 36 3.1
81gb|AC154404.3| Mus musculus BAC clone RP24-244M4 from 14, comple... 36 3.1
82emb|CT033778.16| Mouse DNA sequence from clone RP23-424G4 on chr... 36 3.1
83dbj|AB209278.1| Homo sapiens mRNA for semaphorin 6B isoform 3 pr... 36 3.1
84dbj|AP001010.4| Homo sapiens genomic DNA, chromosome 18 clone:RP... 36 3.1 
>emb|AL929387.7| Human DNA sequence from clone RP11-398F12 on chromosome 22, complete
             sequence
          Length = 24787

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 14    gggctgggggaggcaactga 33
             ||||||||||||||||||||
Sbjct: 19870 gggctgggggaggcaactga 19851
to top
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 9       aacgggggctgggggaggcaactg 32
               ||||||||| ||||||||||||||
Sbjct: 1262949 aacgggggcggggggaggcaactg 1262972
to top
>gb|BC037213.1| Homo sapiens cDNA clone IMAGE:4829494
          Length = 2584

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 14  gggctgggggaggcaactga 33
           ||||||||||||||||||||
Sbjct: 505 gggctgggggaggcaactga 524
to top
>ref|NM_195439.1| Oryza sativa (japonica cultivar-group) putative DNA binding protein
           (OSJNBa0004P12.12), mRNA
          Length = 1854

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 172 acgggggctgggggaggca 154
to top
>ref|NM_005273.2| Homo sapiens guanine nucleotide binding protein (G protein), beta
           polypeptide 2 (GNB2), mRNA
          Length = 1666

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 211 acgggggctgggggaggca 193
to top
>gb|AF064853.1| Homo sapiens map 7qter; 41.64cR from WI-8540 repeat region,
           complete sequence
          Length = 901

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 226 acgggggctgggggaggca 208
to top
>gb|AF053356.1| Homo sapiens chromosome 7q22 sequence, complete sequence
          Length = 227968

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    acgggggctgggggaggca 28
             |||||||||||||||||||
Sbjct: 99462 acgggggctgggggaggca 99480
to top
>ref|XM_594059.2| PREDICTED: Bos taurus guanine nucleotide binding protein (G
          protein),beta polypeptide 2, transcript variant 1
          (GNB2), mRNA
          Length = 1519

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 10 acgggggctgggggaggca 28
          |||||||||||||||||||
Sbjct: 81 acgggggctgggggaggca 63
to top
>ref|XM_882636.1| PREDICTED: Bos taurus guanine nucleotide binding protein (G
           protein),beta polypeptide 2, transcript variant 6
           (GNB2), mRNA
          Length = 1630

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 192 acgggggctgggggaggca 174
to top
>ref|XM_869432.1| PREDICTED: Bos taurus guanine nucleotide binding protein (G
           protein),beta polypeptide 2, transcript variant 2
           (GNB2), mRNA
          Length = 1688

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 250 acgggggctgggggaggca 232
to top
>ref|XM_882625.1| PREDICTED: Bos taurus guanine nucleotide binding protein (G
           protein),beta polypeptide 2, transcript variant 5
           (GNB2), mRNA
          Length = 1556

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 250 acgggggctgggggaggca 232
to top
>ref|XM_882610.1| PREDICTED: Bos taurus guanine nucleotide binding protein (G
           protein),beta polypeptide 2, transcript variant 3
           (GNB2), mRNA
          Length = 1646

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 250 acgggggctgggggaggca 232
to top
>gb|BC059942.1| Mus musculus guanine nucleotide binding protein, beta 2, mRNA (cDNA
           clone MGC:67952 IMAGE:6529685), complete cds
          Length = 1619

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 159 acgggggctgggggaggca 141
to top
>gb|BC012348.1| Homo sapiens guanine nucleotide binding protein (G protein), beta
           polypeptide 2, mRNA (cDNA clone MGC:20143
           IMAGE:4556119), complete cds
          Length = 1666

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 211 acgggggctgggggaggca 193
to top
>gb|BC010073.2| Homo sapiens guanine nucleotide binding protein (G protein), beta
           polypeptide 2, mRNA (cDNA clone MGC:19573
           IMAGE:4300639), complete cds
          Length = 1606

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 150 acgggggctgggggaggca 132
to top
>gb|AC087289.9| Homo sapiens chromosome 17, clone RP11-552F3, complete sequence
          Length = 203765

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 13     ggggctgggggaggcaact 31
              |||||||||||||||||||
Sbjct: 196757 ggggctgggggaggcaact 196775
to top
>gb|BC065579.1| Rattus norvegicus guanine nucleotide binding protein, beta
           polypeptide 2, mRNA (cDNA clone MGC:72266
           IMAGE:5598923), complete cds
          Length = 1670

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 181 acgggggctgggggaggca 163
to top
>gb|BC062178.1| Mus musculus guanine nucleotide binding protein, beta 2, mRNA (cDNA
           clone MGC:70139 IMAGE:6330944), complete cds
          Length = 1605

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 116 acgggggctgggggaggca 98
to top
>emb|CR624493.1| full-length cDNA clone CS0DI035YA06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1525

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 117 acgggggctgggggaggca 99
to top
>emb|CR624304.1| full-length cDNA clone CS0DF028YF19 of Fetal brain of Homo sapiens
           (human)
          Length = 1565

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 163 acgggggctgggggaggca 145
to top
>emb|CR623391.1| full-length cDNA clone CS0DB004YB12 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 1506

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 113 acgggggctgggggaggca 95
to top
>emb|CR621759.1| full-length cDNA clone CS0DI030YN12 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1327

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 119 acgggggctgggggaggca 101
to top
>emb|CR621645.1| full-length cDNA clone CS0DC029YC09 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1512

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 109 acgggggctgggggaggca 91
to top
>emb|CR619728.1| full-length cDNA clone CS0DF038YD19 of Fetal brain of Homo sapiens
           (human)
          Length = 1606

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 198 acgggggctgggggaggca 180
to top
>emb|CR617841.1| full-length cDNA clone CS0DN001YB06 of Adult brain of Homo
          sapiens (human)
          Length = 1468

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 10 acgggggctgggggaggca 28
          |||||||||||||||||||
Sbjct: 48 acgggggctgggggaggca 30
to top
>emb|CR617794.1| full-length cDNA clone CS0DC015YG05 of Neuroblastoma Cot
          25-normalized of Homo sapiens (human)
          Length = 1489

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 10 acgggggctgggggaggca 28
          |||||||||||||||||||
Sbjct: 81 acgggggctgggggaggca 63
to top
>emb|CR614935.1| full-length cDNA clone CS0DF009YM13 of Fetal brain of Homo sapiens
           (human)
          Length = 1650

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 221 acgggggctgggggaggca 203
to top
>emb|CR610423.1| full-length cDNA clone CS0DI064YP24 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1485

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 109 acgggggctgggggaggca 91
to top
>emb|CR608300.1| full-length cDNA clone CS0DB003YH12 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 1557

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 144 acgggggctgggggaggca 126
to top
>emb|CR607124.1| full-length cDNA clone CS0DG004YP12 of B cells (Ramos cell line) of
           Homo sapiens (human)
          Length = 1549

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 115 acgggggctgggggaggca 97
to top
>emb|CR606173.1| full-length cDNA clone CS0DF007YK08 of Fetal brain of Homo
          sapiens (human)
          Length = 1481

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 10 acgggggctgggggaggca 28
          |||||||||||||||||||
Sbjct: 77 acgggggctgggggaggca 59
to top
>emb|CR605713.1| full-length cDNA clone CS0DJ012YA20 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 1521

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 113 acgggggctgggggaggca 95
to top
>emb|CR605173.1| full-length cDNA clone CS0DE006YF20 of Placenta of Homo sapiens
          (human)
          Length = 1510

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 10 acgggggctgggggaggca 28
          |||||||||||||||||||
Sbjct: 93 acgggggctgggggaggca 75
to top
>emb|CR599855.1| full-length cDNA clone CS0DF008YP02 of Fetal brain of Homo sapiens
           (human)
          Length = 1621

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 221 acgggggctgggggaggca 203
to top
>emb|CR595270.1| full-length cDNA clone CS0DL006YN11 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 1510

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 109 acgggggctgggggaggca 91
to top
>gb|AC099040.10| Oryza sativa chromosome 10 BAC OSJNBa0004P12 genomic sequence, complete
             sequence
          Length = 137029

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    acgggggctgggggaggca 28
             |||||||||||||||||||
Sbjct: 76016 acgggggctgggggaggca 75998
to top
>dbj|AB045007.1| Mus musculus GNB2 gene for guanine nucleotide binding protein beta2
            subunit, complete cds
          Length = 9839

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 10   acgggggctgggggaggca 28
            |||||||||||||||||||
Sbjct: 6357 acgggggctgggggaggca 6339
to top
>gb|AC011405.6| Homo sapiens chromosome 5 clone CTB-46B19, complete sequence
          Length = 184541

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 13    ggggctgggggaggcaact 31
             |||||||||||||||||||
Sbjct: 87897 ggggctgggggaggcaact 87915
to top
>dbj|AK146941.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920078C06 product:guanine nucleotide
           binding protein, beta 2, full insert sequence
          Length = 1602

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 157 acgggggctgggggaggca 139
to top
>dbj|AK151628.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830032G11 product:guanine
           nucleotide binding protein, beta 2, full insert sequence
          Length = 1566

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 123 acgggggctgggggaggca 105
to top
>gb|AC009488.5| Homo sapiens BAC clone RP11-336D7 from 7, complete sequence
          Length = 98876

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    acgggggctgggggaggca 28
             |||||||||||||||||||
Sbjct: 17028 acgggggctgggggaggca 17010
to top
>dbj|AK002604.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610012H09 product:guanine nucleotide
           binding protein, beta 2, full insert sequence
          Length = 1574

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 130 acgggggctgggggaggca 112
to top
>gb|BC068003.1| Homo sapiens guanine nucleotide binding protein (G protein), beta
           polypeptide 2, mRNA (cDNA clone MGC:70586
           IMAGE:6055863), complete cds
          Length = 1612

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 136 acgggggctgggggaggca 118
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 10      acgggggctgggggaggca 28
               |||||||||||||||||||
Sbjct: 7007865 acgggggctgggggaggca 7007847
to top
>gb|AF312033.1|AF312033 Mus musculus acetylcholinesterase (Ache) and D5Ertd655e genes, complete
              cds; ASR2 (Asr2) gene, complete cds, alternatively spliced;
              TRIP6 (Trip6), CIP1 (Cip1), EPHB4 (Ephb4), ZAN (Zan), EPO
              (Epo), RPP20 (Rpp20), PERQ1 (Perq1), GNB2 (Gnb2), and
              BAF53B (Baf53b) genes, complete cds; and TFR2 (Tfr2) gene,
              partial cds
          Length = 296820

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 10     acgggggctgggggaggca 28
              |||||||||||||||||||
Sbjct: 250418 acgggggctgggggaggca 250436
to top
>ref|NM_031037.2| Rattus norvegicus guanine nucleotide binding protein, beta
           polypeptide 2 (Gnb2), mRNA
          Length = 1670

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 181 acgggggctgggggaggca 163
to top
>ref|NM_010312.3| Mus musculus guanine nucleotide binding protein, beta 2 (Gnb2),
           mRNA
          Length = 1619

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 159 acgggggctgggggaggca 141
to top
>gb|AC087749.12| Homo sapiens chromosome 17, clone RP11-474I11, complete sequence
          Length = 216161

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 13     ggggctgggggaggcaact 31
              |||||||||||||||||||
Sbjct: 201126 ggggctgggggaggcaact 201108
to top
>dbj|AK064659.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-114-H04, full
           insert sequence
          Length = 2162

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 151 acgggggctgggggaggca 133
to top
>emb|Y11107.3|HSA011107 Homo sapiens ITGB4 gene for integrin beta 4 subunit, exons 3-41
          Length = 28798

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 13    ggggctgggggaggcaact 31
             |||||||||||||||||||
Sbjct: 27717 ggggctgggggaggcaact 27699
to top
>gb|U66541.1|HSITGBF13 Human beta4-integrin (ITGB4) and alternatively spliced
           beta4-integrin (ITGB4) genes, exons 37,38,39,40 and 41
           and complete cds
          Length = 1475

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 13  ggggctgggggaggcaact 31
           |||||||||||||||||||
Sbjct: 394 ggggctgggggaggcaact 376
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 10      acgggggctgggggaggca 28
               |||||||||||||||||||
Sbjct: 7011151 acgggggctgggggaggca 7011133
to top
>gb|AC148018.3| Mus musculus BAC clone RP23-45G4 from 5, complete sequence
          Length = 234240

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 10     acgggggctgggggaggca 28
              |||||||||||||||||||
Sbjct: 162881 acgggggctgggggaggca 162899
to top
>gb|AC166328.4| Mus musculus BAC clone RP23-31H5 from chromosome 5, complete sequence
          Length = 215189

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 8     aaacgggggctgggggagg 26
             |||||||||||||||||||
Sbjct: 94971 aaacgggggctgggggagg 94953
to top
>emb|Y11970.1|MMGNB2 M.musculus mRNA for protein G beta-subunit
          Length = 220

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 146 acgggggctgggggaggca 128
to top
>gb|M16538.1|HUMGP Human signal-transducing guanine nucleotide-binding regulatory (G)
           protein beta subunit mRNA, complete cds
          Length = 1533

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  acgggggctgggggaggca 28
           |||||||||||||||||||
Sbjct: 102 acgggggctgggggaggca 84
to top
>ref|NM_032108.2| Homo sapiens sema domain, transmembrane domain (TM), and cytoplasmic
            domain, (semaphorin) 6B (SEMA6B), transcript variant
            SEMA6B.3, mRNA
          Length = 3805

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 12   gggggctgggggaggcaa 29
            ||||||||||||||||||
Sbjct: 3683 gggggctgggggaggcaa 3666
to top
>ref|NM_020241.2| Homo sapiens sema domain, transmembrane domain (TM), and cytoplasmic
            domain, (semaphorin) 6B (SEMA6B), transcript variant
            SEMA6B.1, mRNA
          Length = 2005

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 12   gggggctgggggaggcaa 29
            ||||||||||||||||||
Sbjct: 1883 gggggctgggggaggcaa 1866
to top
>ref|NM_133327.1| Homo sapiens sema domain, transmembrane domain (TM), and cytoplasmic
            domain, (semaphorin) 6B (SEMA6B), transcript variant
            SEMA6B.2, mRNA
          Length = 2500

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 12   gggggctgggggaggcaa 29
            ||||||||||||||||||
Sbjct: 2378 gggggctgggggaggcaa 2361
to top
>gb|AC111030.11| Mus musculus chromosome 5, clone RP23-415E17, complete sequence
          Length = 229028

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 14     gggctgggggaggcaact 31
              ||||||||||||||||||
Sbjct: 132258 gggctgggggaggcaact 132275
to top
>ref|XM_592676.2| PREDICTED: Bos taurus similar to G patch domain containing protein 3
            (LOC514771), mRNA
          Length = 2108

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 13   ggggctgggggaggcaac 30
            ||||||||||||||||||
Sbjct: 1893 ggggctgggggaggcaac 1876
to top
>gb|AC116130.15| Mus musculus chromosome 17, clone RP23-98F21, complete sequence
          Length = 228842

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 11     cgggggctgggggaggca 28
              ||||||||||||||||||
Sbjct: 109273 cgggggctgggggaggca 109290
to top
>gb|AC122399.4| Mus musculus BAC clone RP24-92B2 from chromosome 17, complete sequence
          Length = 184002

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 12    gggggctgggggaggcaa 29
             ||||||||||||||||||
Sbjct: 84858 gggggctgggggaggcaa 84841
to top
>gb|AC124524.3| Mus musculus BAC clone RP23-402C9 from chromosome 14, complete sequence
          Length = 213751

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 12     gggggctgggggaggcaa 29
              ||||||||||||||||||
Sbjct: 127679 gggggctgggggaggcaa 127662
to top
>gb|AY358939.1| Homo sapiens clone DNA80145 semaphorin Z (UNQ1907) mRNA, complete cds
          Length = 3721

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 12   gggggctgggggaggcaa 29
            ||||||||||||||||||
Sbjct: 3664 gggggctgggggaggcaa 3647
to top
>gb|AC158144.13| Mus musculus chromosome 7, clone RP23-82N3, complete sequence
          Length = 213341

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 8      aaacgggggctgggggag 25
              ||||||||||||||||||
Sbjct: 151721 aaacgggggctgggggag 151704
to top
>emb|AL589702.8| Human DNA sequence from clone RP5-907A6 on chromosome 1, complete
             sequence
          Length = 107103

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 10    acgggggctgggggaggc 27
             ||||||||||||||||||
Sbjct: 51311 acgggggctgggggaggc 51294
to top
>emb|AL357673.12| Human DNA sequence from clone RP11-446E24 on chromosome 1 Contains a
            novel protein, two novel genes and the 5' end of the
            MRPL37 gene for  mitochondrial ribosomal protein L37,
            complete sequence
          Length = 93717

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 11   cgggggctgggggaggca 28
            ||||||||||||||||||
Sbjct: 2371 cgggggctgggggaggca 2354
to top
>emb|AL031591.19|HS353E16 Human DNA sequence from clone RP3-353E16 on chromosome 22q11.22-12.3,
             complete sequence
          Length = 189765

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 12    gggggctgggggaggcaa 29
             ||||||||||||||||||
Sbjct: 24099 gggggctgggggaggcaa 24082
to top
>emb|AL031716.8|HS360B4 Human DNA sequence from clone LA16c-360B4 on chromosome 16 Contains
             part of a gene for a PUTATIVE novel protein similar to
             predicted bacterial and worm proteins and ESTs, complete
             sequence
          Length = 23388

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 11    cgggggctgggggaggca 28
             ||||||||||||||||||
Sbjct: 17795 cgggggctgggggaggca 17812
to top
>emb|AL078630.1|MM573K1 Mouse DNA sequence from clone CT7-BM573K1 on chromosome 17 Contains
           the gene for gamma-aminobutyric acid (GABA) B receptor
           1, five genes for novel 7 transmembrane receptor
           (rhodopsin family) (olfactory receptor LIKE) proteins,
           the gene for a novel Ulp1 protease family member, a Ulp1
           protease family pseudogene, a novel pseudogene, a Von
           Hippel-Lindau disease tumor suppressor (VHL) pseudogene,
           a 7 transmembrane receptor (rhodopsin family) (olfactory
           receptor LIKE) pseudogene, the gene for diubiquitin and
           three CpG islands, complete sequence
          Length = 154614

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 11  cgggggctgggggaggca 28
           ||||||||||||||||||
Sbjct: 715 cgggggctgggggaggca 698
to top
>emb|AJ248284.1|CNSPAX02 Pyrococcus abyssi complete genome; segment 2/6
          Length = 293250

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 9      aacgggggctgggggagg 26
              ||||||||||||||||||
Sbjct: 205989 aacgggggctgggggagg 206006
to top
>gb|AE006465.1| Homo sapiens 16p13.3 sequence section 4 of 8
          Length = 278911

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 11    cgggggctgggggaggca 28
             ||||||||||||||||||
Sbjct: 95321 cgggggctgggggaggca 95338
to top
>emb|CR591947.1| full-length cDNA clone CS0DC013YP19 of Neuroblastoma Cot
            25-normalized of Homo sapiens (human)
          Length = 1030

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 12   gggggctgggggaggcaa 29
            ||||||||||||||||||
Sbjct: 1027 gggggctgggggaggcaa 1010
to top
>gb|AC011498.7| Homo sapiens chromosome 19 clone CTB-50L17, complete sequence
          Length = 273403

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 12     gggggctgggggaggcaa 29
              ||||||||||||||||||
Sbjct: 174276 gggggctgggggaggcaa 174293
to top
>gb|AC000105.41| Homo sapiens Chromosome 22q11.2 MDR Region, complete sequence
          Length = 90223

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 12    gggggctgggggaggcaa 29
             ||||||||||||||||||
Sbjct: 47954 gggggctgggggaggcaa 47937
to top
>gb|AC004032.7| Homo sapiens Chromosome 22q11.2 BAC Clone b437g10 In BCRL2-GGT Region,
              complete sequence
          Length = 200685

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 12     gggggctgggggaggcaa 29
              ||||||||||||||||||
Sbjct: 138066 gggggctgggggaggcaa 138049
to top
>gb|AF532114.1| Mus musculus strain 129/SvJ BAC clone citb544e14 from the MHC region,
              complete sequence
          Length = 153869

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 11     cgggggctgggggaggca 28
              ||||||||||||||||||
Sbjct: 118762 cgggggctgggggaggca 118745
to top
>gb|AC020709.4|AC020709 Homo sapiens clone RP11-425F18, complete sequence
          Length = 184104

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 10     acgggggctgggggaggc 27
              ||||||||||||||||||
Sbjct: 159514 acgggggctgggggaggc 159497
to top
>gb|AC175058.1| Mus musculus BAC clone RP23-210C4 from chromosome 17, complete sequence
          Length = 218488

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 12     gggggctgggggaggcaa 29
              ||||||||||||||||||
Sbjct: 192810 gggggctgggggaggcaa 192827
to top
>gb|AC154404.3| Mus musculus BAC clone RP24-244M4 from 14, complete sequence
          Length = 190099

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 9     aacgggggctgggggagg 26
             ||||||||||||||||||
Sbjct: 30012 aacgggggctgggggagg 30029
to top
>emb|CT033778.16| Mouse DNA sequence from clone RP23-424G4 on chromosome 14, complete
             sequence
          Length = 184788

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 9     aacgggggctgggggagg 26
             ||||||||||||||||||
Sbjct: 23405 aacgggggctgggggagg 23388
to top
>dbj|AB209278.1| Homo sapiens mRNA for semaphorin 6B isoform 3 precursor variant
            protein
          Length = 3634

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 12   gggggctgggggaggcaa 29
            ||||||||||||||||||
Sbjct: 3605 gggggctgggggaggcaa 3588
to top
>dbj|AP001010.4| Homo sapiens genomic DNA, chromosome 18 clone:RP11-701H16, complete
              sequence
          Length = 173709

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 12     gggggctgggggaggcaa 29
              ||||||||||||||||||
Sbjct: 112802 gggggctgggggaggcaa 112785


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 236,647
Number of Sequences: 3902068
Number of extensions: 236647
Number of successful extensions: 76082
Number of sequences better than 10.0: 84
Number of HSP's better than 10.0 without gapping: 84
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 75888
Number of HSP's gapped (non-prelim): 194
length of query: 34
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 14
effective length of database: 17,155,003,908
effective search space: 240170054712
effective search space used: 240170054712
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top