>emb|AL603889.5| Mouse DNA sequence from clone RP23-407M20 on chromosome 11, complete
             sequence
          Length = 145052

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    gctggtgagcagaaaagatgg 77
             |||||||||||||||||||||
Sbjct: 86835 gctggtgagcagaaaagatgg 86815

>gb|AC163020.9| Mus musculus chromosome 7, clone RP23-36L11, complete sequence
          Length = 215384

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 57     gctggtgagcagaaaagatg 76
              ||||||||||||||||||||
Sbjct: 105858 gctggtgagcagaaaagatg 105877

>gb|AC161412.10| Mus musculus chromosome 7, clone RP24-78I5, complete sequence
          Length = 172087

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 57     gctggtgagcagaaaagatg 76
              ||||||||||||||||||||
Sbjct: 140795 gctggtgagcagaaaagatg 140814

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 279     gtcggtttccatgatcacat 298
               ||||||||||||||||||||
Sbjct: 3323931 gtcggtttccatgatcacat 3323950

>emb|AL162408.8| Human DNA sequence from clone RP11-397O4 on chromosome 10 Contains a
            novel gene, the 5' end of a novel gene and a CpG island,
            complete sequence
          Length = 28205

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 278  agtcggtttccatgatcaca 297
            ||||||||||||||||||||
Sbjct: 4876 agtcggtttccatgatcaca 4857

>emb|CR925678.1| Ehrlichia ruminantium str. Welgevonden, complete genome
          Length = 1512977

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 253     ttatagagatttacaatctc 272
               ||||||||||||||||||||
Sbjct: 1158386 ttatagagatttacaatctc 1158367

>emb|CR925677.1| Ehrlichia ruminantium str. Gardel, complete genome
          Length = 1499920

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 253     ttatagagatttacaatctc 272
               ||||||||||||||||||||
Sbjct: 1147713 ttatagagatttacaatctc 1147694

>emb|CR767821.1| Ehrlichia ruminantium strain Welgevonden, complete genome
          Length = 1516355

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 253     ttatagagatttacaatctc 272
               ||||||||||||||||||||
Sbjct: 1180007 ttatagagatttacaatctc 1179988

>emb|BX294148.1| Pirellula sp. strain 1 complete genome; segment 16/24
          Length = 294850

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 84     gtcagtccaattttcggtgg 103
              ||||||||||||||||||||
Sbjct: 151489 gtcagtccaattttcggtgg 151470

>emb|CR861457.1| Pongo pygmaeus mRNA; cDNA DKFZp459D042 (from clone DKFZp459D042)
          Length = 4369

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 269  tctccaagcagtcggtttccatga 292
            |||||||| |||||||||||||||
Sbjct: 1942 tctccaagaagtcggtttccatga 1919

>gb|AF314199.1|AF314199S1 Homo sapiens neuroplastoma apoptosis-related RNA-binding protein
             (CUGBP2) gene, exons 1a and 1b
          Length = 59000

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 278   agtcggtttccatgatcaca 297
             ||||||||||||||||||||
Sbjct: 25653 agtcggtttccatgatcaca 25634

>gb|AE000783.1| Borrelia burgdorferi B31, complete genome
          Length = 910724

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 14     agctttattcaacaaaagaa 33
              ||||||||||||||||||||
Sbjct: 343146 agctttattcaacaaaagaa 343165

>emb|BX679675.28| Zebrafish DNA sequence from clone CH211-37L23 in linkage group 17,
             complete sequence
          Length = 119154

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 277   cagtcggtttccatgatcac 296
             ||||||||||||||||||||
Sbjct: 78819 cagtcggtttccatgatcac 78800

>gb|AC110033.9| Mus musculus chromosome 1, clone RP23-117O18, complete sequence
          Length = 260404

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 37     ctggcatcattagccaagag 56
              ||||||||||||||||||||
Sbjct: 147099 ctggcatcattagccaagag 147080

>gb|AC108796.10| Mus musculus chromosome 1, clone RP23-349L18, complete sequence
          Length = 188713

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 37     ctggcatcattagccaagag 56
              ||||||||||||||||||||
Sbjct: 161618 ctggcatcattagccaagag 161599

>gb|AF000366.1|AF000366 Borrelia burgdorferi oligopeptide permease homologs AI (oppAI), AII
            (oppAII), AIII (oppAIII), B (oppB), C (oppC), D (oppD),
            and F (oppF), P26 (p26) and enolase homolog (eno) genes,
            complete cds
          Length = 12206

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 14   agctttattcaacaaaagaa 33
            ||||||||||||||||||||
Sbjct: 8955 agctttattcaacaaaagaa 8974

>gb|AC004475.1|AC004475 Homo sapiens chromosome 19, cosmid F23858, complete sequence
          Length = 42146

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 269   tctccaagcagtcggtttccatga 292
             |||||||| |||||||||||||||
Sbjct: 29074 tctccaagaagtcggtttccatga 29097


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,413,915
Number of Sequences: 3902068
Number of extensions: 3413915
Number of successful extensions: 56573
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56524
Number of HSP's gapped (non-prelim): 49
length of query: 435
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 413
effective length of database: 17,147,199,772
effective search space: 7081793505836
effective search space used: 7081793505836
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)