>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome
          Length = 6260361

 Score = 42.1 bits (21), Expect = 0.97
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 2      ttttaaaagtaaaattgggat 22
              |||||||||||||||||||||
Sbjct: 583559 ttttaaaagtaaaattgggat 583539

>ref|NM_017404.2| Mus musculus mitochondrial ribosomal protein L39 (Mrpl39), mRNA
          Length = 1773

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 124  tgcttaacacactggcacat 143
            ||||||||||||||||||||
Sbjct: 1279 tgcttaacacactggcacat 1260

>gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 9, complete
              sequence
          Length = 1178688

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 136    tggcacatccatccatctga 155
              ||||||||||||||||||||
Sbjct: 940990 tggcacatccatccatctga 941009

>ref|XM_572880.1| Cryptococcus neoformans var. neoformans JEC21 Voltage-gated
           potassium channel beta-2 subunit (CNI03480) partial mRNA
          Length = 1351

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 136 tggcacatccatccatctga 155
           ||||||||||||||||||||
Sbjct: 47  tggcacatccatccatctga 66

>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome
          Length = 3059876

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 91     gcagtacgctcagcaaagtc 110
              ||||||||||||||||||||
Sbjct: 728490 gcagtacgctcagcaaagtc 728471

>emb|AL021937.1|HS149A16 Human DNA sequence from clone RP1-149A16 on chromosome 22 Contains four
             novel genes (LOC339666, HSPC117), the RFPL3 gene for ret
             finger protein-like 3, a immunoglobulin lambda chain
             pseudogene, the RFPL3S gene for ret finger protein-like 3
             antisense, the BPIL2 gene for
             bactericidal/permeability-increasing protein-like 2, the
             5' end of the FBXO7 gene for F-box protein 7 and three CpG
             islands, complete sequence
          Length = 173354

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 138   gcacatccatccatctgaag 157
             ||||||||||||||||||||
Sbjct: 20894 gcacatccatccatctgaag 20875

>gb|AC164162.2| Mus musculus BAC clone RP23-253E17 from chromosome 16, complete sequence
          Length = 174250

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 124    tgcttaacacactggcacat 143
              ||||||||||||||||||||
Sbjct: 155812 tgcttaacacactggcacat 155793

>gb|AY829865.1| Damon medius isolate AMCC 124715 12S ribosomal RNA gene, partial
           sequence; mitochondrial
          Length = 340

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 3   tttaaaagtaaaattgggat 22
           ||||||||||||||||||||
Sbjct: 286 tttaaaagtaaaattgggat 305

>dbj|AK031942.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length
            enriched library, clone:6330504K13 product:mitochondrial
            ribosomal protein L39, full insert sequence
          Length = 1773

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 124  tgcttaacacactggcacat 143
            ||||||||||||||||||||
Sbjct: 1279 tgcttaacacactggcacat 1260

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 165      cagatccagatggggcttgacagt 188
                ||||||||||||||||||| ||||
Sbjct: 18845248 cagatccagatggggcttggcagt 18845225

>dbj|AP003684.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0485D10
          Length = 147464

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 165   cagatccagatggggcttgacagt 188
             ||||||||||||||||||| ||||
Sbjct: 10813 cagatccagatggggcttggcagt 10790

>dbj|AP005492.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0077L03
          Length = 171177

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 165    cagatccagatggggcttgacagt 188
              ||||||||||||||||||| ||||
Sbjct: 170999 cagatccagatggggcttggcagt 170976

>dbj|AB016880.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MTG10
          Length = 81284

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 22    tggcatttgacaaaccatca 41
             ||||||||||||||||||||
Sbjct: 24140 tggcatttgacaaaccatca 24159

>gb|AF293849.1| Secale cereale beta-glucosidase mRNA, complete cds
          Length = 1843

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 12  aaaattgggatggcatttga 31
           ||||||||||||||||||||
Sbjct: 945 aaaattgggatggcatttga 964

>emb|CT027693.11| Mouse DNA sequence from clone RP24-120H1 on chromosome 16, complete
              sequence
          Length = 186376

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 124    tgcttaacacactggcacat 143
              ||||||||||||||||||||
Sbjct: 113832 tgcttaacacactggcacat 113851


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,486,938
Number of Sequences: 3902068
Number of extensions: 2486938
Number of successful extensions: 45966
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45917
Number of HSP's gapped (non-prelim): 49
length of query: 292
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 270
effective length of database: 17,147,199,772
effective search space: 4629743938440
effective search space used: 4629743938440
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)