Clone Name	rbast40a12
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	307	1e-80
2	dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic D...	307	1e-80
3	dbj|AK108078.1| Oryza sativa (japonica cultivar-group) cDNA clon...	307	1e-80
4	ref|NM_190750.1| Oryza sativa (japonica cultivar-group), predic...	305	5e-80
5	ref|XM_475315.1| Oryza sativa (japonica cultivar-group), predic...	297	1e-77
6	gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome...	297	1e-77
7	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	297	1e-77
8	dbj|AK120955.1| Oryza sativa (japonica cultivar-group) cDNA clon...	297	1e-77
9	gb|AC134048.3| Oryza sativa (japonica cultivar-group) chromosome...	280	3e-72
10	gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome...	280	3e-72
11	emb|X13680.1|OSHIS321 Oryza sativa H3 histone H3R-21 clone RH3-2	280	3e-72
12	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	280	3e-72
13	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	280	3e-72
14	gb|U77296.1|OSU77296 Oryza sativa histone 3 mRNA, complete cds	280	3e-72
15	emb|X00937.1|TAHI02 Wheat histone H3 gene	278	1e-71
16	ref|NM_185612.1| Oryza sativa (japonica cultivar-group), predic...	264	2e-67
17	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	264	2e-67
18	dbj|AP005828.2| Oryza sativa (japonica cultivar-group) genomic D...	264	2e-67
19	dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic D...	264	2e-67
20	gb|M36658.1|MZEH3A Corn histone H3 (H3C3) gene, complete cds	260	3e-66
21	ref|NM_185607.1| Oryza sativa (japonica cultivar-group), predic...	256	4e-65
22	ref|NM_185609.1| Oryza sativa (japonica cultivar-group), predic...	256	4e-65
23	emb|X13678.1|OSHIS311 Oryza sativa H3 histone gene H3R-11	256	4e-65
24	emb|X13679.1|OSHIS3PS Oryza sativa H3 histone pseudogene H3R-12	256	4e-65
25	gb|M35388.1|MZEHISH3A Zea mays histone H3 gene, complete cds	250	3e-63
26	gb|M13378.1|MZEH3C2 Maize (Zea mays) histone H3 gene (H3C2), com...	250	3e-63
27	ref|XM_493701.1| Oryza sativa (japonica cultivar-group), mRNA	248	1e-62
28	ref|NM_185613.1| Oryza sativa (japonica cultivar-group), predic...	248	1e-62
29	gb|BT017805.1| Zea mays clone EL01N0506E02.c mRNA sequence	248	1e-62
30	dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic D...	248	1e-62
31	gb|AF093633.1|AF093633 Oryza sativa histone H3 mRNA, complete cds	248	1e-62
32	gb|BT018930.1| Zea mays clone Contig60.F mRNA sequence	246	4e-62
33	emb|X84377.1|ZMHIS3DNA Z.mays histone H3 gene	246	4e-62
34	ref|XM_472456.1| Oryza sativa (japonica cultivar-group), predic...	242	6e-61
35	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	242	6e-61
36	emb|AL606618.4|OSJN00062 Oryza sativa genomic DNA, chromosome 4,...	242	6e-61
37	dbj|AB205017.1| Lolium multiflorum gene for replacement histone ...	228	1e-56
38	ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro...	226	4e-56
39	emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4...	226	4e-56
40	gb|BT018950.1| Zea mays clone Contig110.F mRNA sequence	224	1e-55
41	emb|X79714.1|LTMRHIS3 L.temulentum mRNA for histone H3	224	1e-55
42	gb|U25664.1|OSU25664 Oryza sativa histone H3 gene, complete cds	224	1e-55
43	gb|M15664.1|RICHIS3 Rice histone 3 gene, complete cds	224	1e-55
44	ref|XM_545420.2| PREDICTED: Canis familiaris similar to histone ...	222	6e-55
45	ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone ...	220	2e-54
46	ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone ...	220	2e-54
47	ref|XM_849194.1| PREDICTED: Canis familiaris similar to histone ...	218	9e-54
48	ref|XM_545399.1| PREDICTED: Canis familiaris similar to histone ...	218	9e-54
49	ref|XM_545397.2| PREDICTED: Canis familiaris similar to histone ...	218	9e-54
50	ref|XM_848782.1| PREDICTED: Canis familiaris similar to histone ...	218	9e-54
51	ref|XM_545429.1| PREDICTED: Canis familiaris similar to histone ...	218	9e-54
52	ref|XM_545385.1| PREDICTED: Canis familiaris similar to histone ...	218	9e-54
53	emb|Y08528.1|OSHISTON3 Oryza sativa mRNA for histone 3	218	9e-54
54	ref|XM_425464.1| PREDICTED: Gallus gallus similar to histone pro...	216	4e-53
55	ref|XM_416198.1| PREDICTED: Gallus gallus similar to GLP_39_8822...	216	4e-53
56	ref|XM_416190.1| PREDICTED: Gallus gallus similar to GLP_39_8822...	216	4e-53
57	ref|XM_416186.1| PREDICTED: Gallus gallus similar to GLP_39_8822...	216	4e-53
58	emb|CR390239.1| Gallus gallus finished cDNA, clone ChEST932d15	216	4e-53
59	emb|X62291.1|GGHISH3IV G.gallus gene for histone H3-IV	216	4e-53
60	gb|U37579.1|GGU37579 Gallus gallus histone H3-VIII gene, complet...	216	4e-53
61	gb|U37578.1|GGU37578 Gallus gallus histone H3-VII gene, complete...	216	4e-53
62	gb|U37577.1|GGU37577 Gallus gallus histone H3-VI gene, complete cds	216	4e-53
63	gb|M61154.1|CHKH3AA Chicken histone H3 gene, complete cds	216	4e-53
64	gb|BT018179.1| Zea mays clone EL01N0557G06.c mRNA sequence	214	1e-52
65	ref|XM_848810.1| PREDICTED: Canis familiaris similar to histone ...	212	6e-52
66	gb|M34928.1|BLYHISH3PA Barley histone H3 mRNA, 3' end	210	2e-51
67	ref|XM_545428.1| PREDICTED: Canis familiaris similar to histone ...	208	9e-51
68	emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes	208	9e-51
69	emb|X62292.1|GGHISH3V G.gallus gene for histone H3-V	208	9e-51
70	gb|M61155.1|CHKH3AB Chicken histone H3 gene, complete cds	208	9e-51
71	gb|M13379.1|MZEH3C4 Maize (Zea mays) histone H3 gene (H3C4), com...	206	4e-50
72	gb|BT017332.1| Zea mays clone EL01N0320H03.c mRNA sequence	202	5e-49
73	ref|XM_870218.1| PREDICTED: Bos taurus similar to histone 1, H2a...	194	1e-46
74	ref|XM_599846.2| PREDICTED: Bos taurus similar to histone 1, H2a...	194	1e-46
75	ref|XM_540290.1| PREDICTED: Canis familiaris similar to H3 histo...	194	1e-46
76	ref|XM_540285.1| PREDICTED: Canis familiaris similar to H3 histo...	194	1e-46
77	ref|XM_845651.1| PREDICTED: Canis familiaris similar to CG31613-...	194	1e-46
78	gb|BT016934.1| Zea mays clone E04912703G10.c mRNA sequence	186	3e-44
79	ref|XM_871261.1| PREDICTED: Bos taurus similar to histone 1, H2a...	186	3e-44
80	ref|XM_591827.2| PREDICTED: Bos taurus similar to histone 1, H2a...	186	3e-44
81	ref|XM_601510.2| PREDICTED: Bos taurus similar to histone 1, H2a...	186	3e-44
82	gb|AY125231.1| Melanoplus sp. OR18 histone 3 gene, partial cds	186	3e-44
83	gb|AY125229.1| Argia vivida histone 3 gene, partial cds	186	3e-44
84	gb|AY749753.1| Diphlebia coerulescens histone H3 (H3) gene, part...	186	3e-44
85	ref|XM_848995.1| PREDICTED: Canis familiaris similar to histone ...	184	1e-43
86	gb|DQ393956.1| Cydia pomonella clone Cp4.140 microsatellite sequ...	184	1e-43
87	gb|DQ393939.1| Cydia pomonella clone Cp4.P microsatellite sequence	184	1e-43
88	gb|DQ393935.1| Cydia pomonella clone Cp4.118 microsatellite sequ...	184	1e-43
89	gb|DQ393934.1| Cydia pomonella clone Cp4.100 microsatellite sequ...	184	1e-43
90	dbj|AB185026.1| Conocephalum conicum H3 gene for histone 3, comp...	182	5e-43
91	dbj|AB185023.1| Conocephalum conicum H3 gene for histone 3, comp...	182	5e-43
92	gb|AF140033.1|AF140033 Phreatamoeba balamuthi histone H3 mRNA, c...	180	2e-42
93	ref|NM_178205.1| Mus musculus histone 1, H3e (Hist1h3e), mRNA	178	8e-42
94	ref|NM_175653.1| Mus musculus histone1, H3c (Hist1h3c), mRNA	178	8e-42
95	ref|XM_870476.1| PREDICTED: Bos taurus similar to histone 1, H2a...	178	8e-42
96	ref|XM_590015.2| PREDICTED: Bos taurus similar to histone 1, H2a...	178	8e-42
97	ref|NM_178206.2| Mus musculus histone 1, H3h (Hist1h3h), mRNA	178	8e-42
98	gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co...	178	8e-42
99	emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143	178	8e-42
100	emb|X80326.1|MPMPH312 M.pahari mpH312 gene	178	8e-42
101	emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr...	178	8e-42
102	emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr...	178	8e-42
103	emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr...	178	8e-42
104	gb|U62671.1|MMU62671 Mus musculus histone H3.2-B (H3-B) gene, co...	178	8e-42
105	gb|AY158950.1| Mus musculus histone protein Hist1h3c gene, compl...	178	8e-42
106	gb|AY158948.1| Mus musculus histone protein Hist1h3e gene, compl...	178	8e-42
107	gb|AY158944.1| Mus musculus histone protein Hist1h3h gene, compl...	178	8e-42
108	gb|M32462.1|MUSHIS3D Mouse histone H3 (H3.1-291) gene, complete cds	178	8e-42
109	ref|XM_782287.1| PREDICTED: Strongylocentrotus purpuratus simila...	176	3e-41
110	gb|DQ393931.1| Cydia pomonella clone Cp4.61 microsatellite sequence	176	3e-41
111	gb|U38423.1|TAU38423 Triticum aestivum histone H3 gene, partial ...	174	1e-40
112	dbj|AB185067.1| Conocephalum conicum H3 gene for histone 3, comp...	172	5e-40
113	ref|NM_013548.2| Mus musculus histone 1, H3f (Hist1h3f), mRNA	170	2e-39
114	ref|NM_178216.1| Mus musculus histone 2, H3c1 (Hist2h3c1), trans...	170	2e-39
115	gb|BC107285.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMA...	170	2e-39
116	ref|NM_178203.1| Mus musculus histone 1, H3b (Hist1h3b), mRNA	170	2e-39
117	ref|XM_871299.1| PREDICTED: Bos taurus similar to histone 1, H2a...	170	2e-39
118	gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339	170	2e-39
119	ref|XM_865002.1| PREDICTED: Bos taurus similar to histone 1, H2a...	170	2e-39
120	ref|NM_145073.2| Mus musculus histone 1, H3g (Hist1h3g), mRNA	170	2e-39
121	ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h...	170	2e-39
122	gb|BC103549.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC...	170	2e-39
123	emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23	170	2e-39
124	emb|X80325.1|MPMPH315 M.pahari mpH315 gene	170	2e-39
125	dbj|AK134918.1| Mus musculus adult male olfactory brain cDNA, RI...	170	2e-39
126	dbj|AK010121.1| Mus musculus adult male tongue cDNA, RIKEN full-...	170	2e-39
127	gb|U62675.1|MMU62675 Mus musculus histone H3.2-616 (H3-616), and...	170	2e-39
128	gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), ...	170	2e-39
129	ref|NG_002616.1| Homo sapiens histone 2, H3b (HIST2H3B) pseudoge...	170	2e-39
130	gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, comple...	170	2e-39
131	gb|BC094041.1| Mus musculus histone 2, H3c1, mRNA (cDNA clone MG...	170	2e-39
132	gb|AF531306.1| Homo sapiens histone H3 (HIST2H3B) pseudogene, co...	170	2e-39
133	gb|AY158955.1| Mus musculus histone protein Hist2h3b gene, compl...	170	2e-39
134	gb|AY158954.1| Mus musculus histone protein Hist2h3c1 gene, comp...	170	2e-39
135	gb|AY158951.1| Mus musculus histone protein Hist1h3b gene, compl...	170	2e-39
136	gb|AY158947.1| Mus musculus histone protein Hist1h3f gene, compl...	170	2e-39
137	gb|AY158946.1| Mus musculus histone protein Hist1h3g gene, compl...	170	2e-39
138	gb|AY158941.1| Mus musculus histone protein Hist2h2bb gene, comp...	170	2e-39
139	gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, comp...	170	2e-39
140	gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, comple...	170	2e-39
141	gb|BC101955.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC...	170	2e-39
142	gb|BC101956.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC...	170	2e-39
143	gb|BC101954.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC...	170	2e-39
144	ref|NM_178215.1| Mus musculus histone 2, H3b (Hist2h3b), mRNA	170	2e-39
145	emb|X01685.1|MMHISH32 Mouse gene (H3.2) for histone H3	170	2e-39
146	emb|X01684.1|MMHISH31 Mouse gene (H3.1) for histone H3	170	2e-39
147	gb|M32461.1|MUSHIS3C Mouse histone H3 (H3.2-614) gene, complete cds	170	2e-39
148	gb|M32460.1|MUSHIS3B Mouse histone H3 (H3.1-221) gene, complete cds	170	2e-39
149	gb|M32459.1|MUSHIS3A Mouse histone H3 (H3.2-221) gene, complete cds	170	2e-39
150	ref|XM_780065.1| PREDICTED: Strongylocentrotus purpuratus simila...	168	8e-39
151	emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 a...	168	8e-39
152	ref|XM_227461.2| PREDICTED: Rattus norvegicus similar to histone...	168	8e-39
153	gb|AC151366.3| Aotus nancymaae clone CH258-105B22, complete sequ...	165	1e-37
154	ref|XM_603864.2| PREDICTED: Bos taurus similar to histone 1, H2a...	165	1e-37
155	gb|AY181030.1| Toxoplasma gondii histone H3 mRNA, complete cds	165	1e-37
156	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	165	1e-37
157	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	165	1e-37
158	emb|AL844879.5|CNS08CB2 Oryza sativa chromosome 12, . BAC OSJNBa...	165	1e-37
159	ref|NM_019469.1| Mus musculus histone 2, H3c1 (Hist2h3c1), trans...	163	5e-37
160	ref|XM_518299.1| PREDICTED: Pan troglodytes similar to Histone H...	163	5e-37
161	gb|L19706.1| Rattus norvegicus H3 histone gene, complete cds	163	5e-37
162	gb|BC062305.1| Homo sapiens cDNA clone IMAGE:3162462	163	5e-37
163	gb|BC015270.1| Mus musculus histone 2, H3c2, mRNA (cDNA clone MG...	163	5e-37
164	gb|BC007518.2| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC...	163	5e-37
165	ref|NM_054045.2| Mus musculus histone 2, H3c2 (Hist2h3c2), mRNA	163	5e-37
166	ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@...	163	5e-37
167	ref|NM_003536.2| Homo sapiens histone 1, H3h (HIST1H3H), mRNA	163	5e-37
168	gb|AF531281.1| Homo sapiens histone H3 (HIST1H3H) gene, complete...	163	5e-37
169	emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 o...	163	5e-37
170	emb|Z30939.1|MDH3HIST Mus domesticus partial mRNA for histone H3...	163	5e-37
171	emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, his...	163	5e-37
172	emb|X80324.1|MPMPH3110 M.pahari mpH3110 gene	163	5e-37
173	emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes	163	5e-37
174	emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A...	163	5e-37
175	gb|BC096130.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC...	163	5e-37
176	gb|BC096128.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC...	163	5e-37
177	gb|BC096129.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC...	163	5e-37
178	emb|Z83735.1|HSZ83735 H.sapiens hH3/k gene	163	5e-37
179	dbj|AK006742.1| Mus musculus adult male testis cDNA, RIKEN full-...	163	5e-37
180	gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and hist...	163	5e-37
181	ref|NM_067207.3| Caenorhabditis elegans HIStone family member (h...	163	5e-37
182	ref|NM_001013056.1| Rattus norvegicus histone 1, H2ai (predicted...	163	5e-37
183	gb|AY158952.1| Mus musculus histone protein Hist1h3a gene, compl...	163	5e-37
184	emb|X85102.1|OSRNAHIS3 O.sativa mRNA for histone H3	163	5e-37
185	emb|CR760429.2| Xenopus tropicalis finished cDNA, clone TNeu057j11	163	5e-37
186	gb|AY749755.1| Griseargiolestes albescens histone H3 (H3) gene, ...	163	5e-37
187	gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene...	163	5e-37
188	gb|M33989.1|MUSH2AX1X Mouse histone H3.2 gene, complete cds	163	5e-37
189	gb|J01175.1|SULHISL34 Sea urchin (L.pictus) late-stage histone H...	163	5e-37
190	emb|Z98866.1|CEY49E10 Caenorhabditis elegans YAC Y49E10, complet...	161	2e-36
191	ref|XM_683134.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	161	2e-36
192	ref|XM_227460.3| PREDICTED: Rattus norvegicus histone 2, H3c2 (p...	161	2e-36
193	emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 ...	161	2e-36
194	gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I...	161	2e-36
195	gb|M14396.1|CIIHISH3A Duck H3.4 variant histone gene	161	2e-36
196	ref|XM_781054.1| PREDICTED: Strongylocentrotus purpuratus simila...	159	7e-36
197	gb|U38422.1|TAU38422 Triticum aestivum histone H3 gene, partial ...	159	7e-36
198	gb|U38420.1|HVU38420 Hordeum vulgare histone H3 gene, partial cd...	159	7e-36
199	ref|XM_868935.1| PREDICTED: Bos taurus similar to histone 1, H2a...	157	3e-35
200	ref|NM_013550.3| Mus musculus histone 1, H3a (Hist1h3a), mRNA	155	1e-34
201	gb|BC107287.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMA...	155	1e-34
202	ref|NM_178204.1| Mus musculus histone1, H3d (Hist1h3d), mRNA	155	1e-34
203	ref|XM_868913.1| PREDICTED: Bos taurus similar to histone 1, H2a...	155	1e-34
204	emb|X58895.1|UCHISTO U.caupo gene for H2A, H2B, H3, and H4 histones	155	1e-34
205	gb|AY125232.1| Pterophylla camellifolia histone 3 gene, partial cds	155	1e-34
206	emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for hist...	155	1e-34
207	dbj|AK155722.1| Mus musculus B6-derived CD11 +ve dendritic cells...	155	1e-34
208	gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016	155	1e-34
209	gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108	155	1e-34
210	gb|U62670.1|MMU62670 Mus musculus histone H3.1-I (H3-I) gene, co...	155	1e-34
211	gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone...	155	1e-34
212	dbj|AK018952.1| Mus musculus adult male testis cDNA, RIKEN full-...	155	1e-34
213	gb|AY158949.1| Mus musculus histone protein Hist1h3d gene, compl...	155	1e-34
214	gb|AY158945.1| Mus musculus histone protein Hist1h3i gene, compl...	155	1e-34
215	ref|NM_178207.2| Mus musculus histone 1, H3i (Hist1h3i), mRNA	155	1e-34
216	gb|AY749744.1| Dipteromimus sp. EP150 histone H3 (H3) gene, part...	155	1e-34
217	gb|AY749743.1| Ichthybotus hudsoni histone H3 (H3) gene, partial...	155	1e-34
218	gb|AY749718.1| Siphlonurus sp. EP084 histone H3 (H3) gene, parti...	155	1e-34
219	gb|AY749709.1| Mystaxiops venatoris histone H3 (H3) gene, partia...	155	1e-34
220	gb|AY749705.1| Choroterpes sp. EP024 histone H3 (H3) gene, parti...	155	1e-34
221	ref|XM_524859.1| PREDICTED: Pan troglodytes LOC469476 (LOC469476...	153	5e-34
222	gb|BC069303.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC...	153	5e-34
223	gb|BC067490.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC...	153	5e-34
224	gb|BC067491.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC...	153	5e-34
225	ref|NG_001335.1| Homo sapiens genomic large histone family clust...	153	5e-34
226	ref|NM_003529.2| Homo sapiens histone 1, H3a (HIST1H3A), mRNA	153	5e-34
227	gb|AF531274.1| Homo sapiens histone H3 (HIST1H3A) gene, complete...	153	5e-34
228	emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch...	153	5e-34
229	ref|XM_777897.1| PREDICTED: Strongylocentrotus purpuratus simila...	153	5e-34
230	emb|X00593.1|LPH3H4 Lytechinus pictus H3 and H4 gene	153	5e-34
231	ref|XM_684297.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	153	5e-34
232	ref|XM_687893.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	153	5e-34
233	gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, h...	153	5e-34
234	ref|XM_497711.2| PREDICTED: Homo sapiens similar to H3 histone, ...	153	5e-34
235	ref|XM_693458.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	153	5e-34
236	emb|CR541858.1| Homo sapiens full open reading frame cDNA clone ...	153	5e-34
237	gb|AY923964.1| Phenacolepas osculans isolate PHE1 histone H3 (H3...	153	5e-34
238	emb|Z61129.1|HS45E8R H.sapiens CpG island DNA genomic Mse1 fragm...	153	5e-34
239	gb|BC066246.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC...	153	5e-34
240	gb|BC066245.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC...	153	5e-34
241	gb|BC066247.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC...	153	5e-34
242	gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo...	153	5e-34
243	gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I...	153	5e-34
244	gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I...	153	5e-34
245	gb|AY338636.1| Calopteryx aequabilis histone 3 gene, partial cds	153	5e-34
246	gb|AY338628.1| Isonychia sp. EP017 histone 3 gene, partial cds	153	5e-34
247	emb|Z46261.1|HSHISH3A H.sapiens DNA for histone H3a	153	5e-34
248	gb|AF517884.1| Griffithsia japonica isolate Gj475 histone H3.3 p...	151	2e-33
249	gb|DQ275319.1| Graphoderus zonatus voucher BYU KBMGrzo66 histone...	151	2e-33
250	ref|XM_780236.1| PREDICTED: Strongylocentrotus purpuratus simila...	149	7e-33
251	ref|XM_527604.1| PREDICTED: Pan troglodytes similar to histone 1...	147	3e-32
252	ref|NM_021059.2| Homo sapiens histone 2, H3c (HIST2H3C), mRNA	147	3e-32
253	gb|AY648851.1| Homo sapiens histone H3/o gene, complete cds	147	3e-32
254	gb|BC084311.1| Xenopus laevis cDNA clone IMAGE:6865011	147	3e-32
255	gb|BC067492.1| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC...	147	3e-32
256	gb|AF531279.1| Homo sapiens histone H3 (HIST1H3F) gene, complete...	147	3e-32
257	emb|CR716243.2|CNS0GFLO Tetraodon nigroviridis full-length cDNA	147	3e-32
258	gb|BC063540.1| Homo sapiens cDNA clone IMAGE:4523373, **** WARNI...	147	3e-32
259	gb|BC015544.1| Homo sapiens histone 2, H3c, mRNA (cDNA clone IMA...	147	3e-32
260	gb|AY125233.1| Isoperla davisi histone 3 gene, partial cds	147	3e-32
261	emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 o...	147	3e-32
262	emb|AJ556872.1|XLA556872 Expression vector pET3-H3 H3 gene for X...	147	3e-32
263	gb|BC096131.1| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC...	147	3e-32
264	ref|NM_021018.2| Homo sapiens histone 1, H3f (HIST1H3F), mRNA	147	3e-32
265	ref|XM_694120.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	147	3e-32
266	ref|XM_928391.1| PREDICTED: Homo sapiens similar to CG31613-PA (...	147	3e-32
267	emb|CR542011.1| Homo sapiens full open reading frame cDNA clone ...	147	3e-32
268	emb|CR541983.1| Homo sapiens full open reading frame cDNA clone ...	147	3e-32
269	dbj|AK020421.1| Mus musculus 12 days embryo embryonic body betwe...	147	3e-32
270	ref|NG_002617.1| Homo sapiens histone 2, H3a (HIST2H3A) pseudoge...	147	3e-32
271	ref|NM_001005464.1| Homo sapiens histone H3/o (H3/o), mRNA	147	3e-32
272	gb|BC074969.2| Homo sapiens histone H3/o, mRNA (cDNA clone IMAGE...	147	3e-32
273	ref|XM_344595.2| PREDICTED: Rattus norvegicus histone 1, H4a (pr...	147	3e-32
274	gb|AF531307.1| Homo sapiens histone H3 (HIST2H3C) gene, complete...	147	3e-32
275	gb|AF531305.1| Homo sapiens histone H3 (HIST2H3A) pseudogene, co...	147	3e-32
276	emb|Z56112.1|HS89C12R H.sapiens CpG island DNA genomic Mse1 frag...	147	3e-32
277	emb|Z56111.1|HS89C12F H.sapiens CpG island DNA genomic Mse1 frag...	147	3e-32
278	emb|Z63365.1|HS81H7R H.sapiens CpG island DNA genomic Mse1 fragm...	147	3e-32
279	gb|BC069818.1| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC...	147	3e-32
280	gb|AY338626.1| Coloburiscus humeralis histone 3 gene, partial cds	147	3e-32
281	gb|AY749737.1| Platybaetis probus histone H3 (H3) gene, partial cds	147	3e-32
282	gb|AY749708.1| Baetis tricaudatus histone H3 (H3) gene, partial cds	147	3e-32
283	gb|AY749702.1| Thraulodes sp. EP014 histone H3 (H3) gene, partia...	147	3e-32
284	gb|J00869.1|CHKH3A Chicken histone H3 gene (intronless)	147	3e-32
285	emb|Z80786.1|HSH3I H.sapiens H3/i gene	147	3e-32
286	ref|XM_527253.1| PREDICTED: Pan troglodytes similar to histone 1...	145	1e-31
287	ref|XM_950910.1| Neurospora crassa OR74A HISTONE H3 (NCU01635.1)...	145	1e-31
288	ref|XM_328073.1| Neurospora crassa OR74A HISTONE H3 (NCU01635.1)...	145	1e-31
289	gb|AF520775.1| Hypocrea jecorina histone H3 gene, complete cds	145	1e-31
290	emb|X06964.1|VCHIS34A Volvox carteri H3-II and H4-II genes for h...	145	1e-31
291	emb|AL670001.1|NCB14H13 Neurospora crassa DNA linkage group II B...	145	1e-31
292	emb|AL670543.1|NCB7K22 Neurospora crassa DNA linkage group II BA...	145	1e-31
293	gb|AY521721.1| Gryllotalpidae sp. BYU_ACOR020 histone H3 (H3) ge...	145	1e-31
294	gb|AY521718.1| Romalea sp. BYU_ACOR015 histone H3 (H3) gene, par...	145	1e-31
295	gb|AY062173.1| Neurospora crassa histone H3 (hh3) and histone H4...	145	1e-31
296	ref|XM_684517.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	145	1e-31
297	dbj|AB185035.1| Conocephalum supradecompositum H3 gene for histo...	145	1e-31
298	gb|AY338619.1| Baetis sp. Eph11 histone 3 gene, partial cds	145	1e-31
299	gb|AY749746.1| Proboscidoplocia sp. EP162 histone H3 (H3) gene, ...	145	1e-31
300	ref|XM_789723.1| PREDICTED: Strongylocentrotus purpuratus simila...	143	4e-31
301	gb|AY749741.1| Rhoenanthus sp. EP143 histone H3 (H3) gene, parti...	143	4e-31
302	gb|DQ284054.1| Boophis albilabris histone H3a gene, partial cds	141	2e-30
303	ref|XM_871486.1| PREDICTED: Bos taurus similar to H3 histone, fa...	139	7e-30
304	ref|XM_871460.1| PREDICTED: Bos taurus similar to H3 histone, fa...	139	7e-30
305	ref|XM_866756.1| PREDICTED: Bos taurus similar to H3 histone, fa...	139	7e-30
306	ref|XM_866686.1| PREDICTED: Bos taurus similar to H3 histone, fa...	139	7e-30
307	gb|DQ096858.1| Xenopus laevis h3r mRNA, complete sequence	139	7e-30
308	gb|BC097059.1| Danio rerio zgc:113983, mRNA (cDNA clone MGC:1139...	139	7e-30
309	ref|NM_001025171.1| Danio rerio zgc:113983 (zgc:113983), mRNA	139	7e-30
310	ref|XM_686806.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	139	7e-30
311	ref|XM_694088.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	139	7e-30
312	gb|DQ275318.1| Graphoderus fascicollis voucher BYU KBMGrfa65 his...	139	7e-30
313	gb|AY338635.1| Chaquihua sp. EP080 histone 3 gene, partial cds	139	7e-30
314	gb|AY749729.1| Edmundsius agilis histone H3 (H3) gene, partial cds	139	7e-30
315	gb|AY749723.1| Siphlaenigma janae histone H3 (H3) gene, partial cds	139	7e-30
316	gb|J00984.1|XELHIS3LB x.laevis histone gene h3 and flanks	139	7e-30
317	gb|AY725673.1| Cylindrocladium multiphialidicum strain CBS 11267...	137	3e-29
318	emb|X03952.1|SPHISH34 Sea urchin (S. purpuratus) late embryonic ...	137	3e-29
319	gb|AY521731.1| Hydropsyche sp. BYU_ACTR020 histone H3 (H3) gene,...	137	3e-29
320	ref|XM_684015.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	137	3e-29
321	ref|XM_683485.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	137	3e-29
322	ref|XM_694149.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	137	3e-29
323	dbj|AB185075.1| Conocephalum conicum H3 gene for histone 3, comp...	137	3e-29
324	dbj|AB185072.1| Conocephalum conicum H3 gene for histone 3, comp...	137	3e-29
325	ref|NM_214547.1| Strongylocentrotus purpuratus late embryonic hi...	137	3e-29
326	ref|XM_560604.1| Anopheles gambiae str. PEST ENSANGP00000025641 ...	137	3e-29
327	ref|XM_318362.1| Anopheles gambiae str. PEST ENSANGP00000016005 ...	137	3e-29
328	ref|XM_307081.1| Anopheles gambiae str. PEST ENSANGP00000001387 ...	137	3e-29
329	ref|XM_305996.1| Anopheles gambiae str. PEST ENSANGP00000012784 ...	137	3e-29
330	emb|X82257.1|DMH33A D.melanogaster mRNA for histone H3.3 variant	135	1e-28
331	gb|AY119629.1| Drosophila melanogaster RE21618 full insert cDNA	135	1e-28
332	ref|NM_078755.2| Drosophila melanogaster Histone H3.3A CG5825-RA...	135	1e-28
333	gb|AF348241.1| Cylindrocladium pseudospathiphylli strain 1623 hi...	135	1e-28
334	gb|AF348237.1| Cylindrocladium spathiphylli strain STE-U2188 his...	135	1e-28
335	gb|AF348230.1| Cylindrocladium spathiphylli strain ATCC 44730 hi...	135	1e-28
336	gb|AY071057.1| Drosophila melanogaster RE14004 full length cDNA	135	1e-28
337	gb|AC008233.3|AC008233 Drosophila melanogaster, chromosome 2L, r...	135	1e-28
338	gb|AF404631.1| Lewia infectoria isolate CR31 histone gene, parti...	135	1e-28
339	gb|AE003608.5| Drosophila melanogaster chromosome 2L, section 17...	135	1e-28
340	gb|AY749703.1| Callibaetis sp. EP020 histone H3 (H3) gene, parti...	135	1e-28
341	gb|AY752255.1| Davidiella tassiana strain ATCC 66670 histone H3 ...	133	4e-28
342	gb|AC024696.1| Caenorhabditis elegans cosmid F07B7, complete seq...	133	4e-28
343	gb|U64843.2| Caenorhabditis elegans cosmid K06C4, complete sequence	133	4e-28
344	gb|U64845.1| Caenorhabditis elegans cosmid F45F2, complete sequence	133	4e-28
345	gb|DQ284377.1| Rana guentheri histone H3a gene, partial cds	133	4e-28
346	gb|DQ284287.1| Rana guentheri histone H3a gene, partial cds	133	4e-28
347	gb|DQ284245.1| Rana johnsi histone H3a gene, partial cds	133	4e-28
348	gb|DQ284223.1| Rana aurora histone H3a gene, partial cds	133	4e-28
349	gb|DQ284219.1| Rana clamitans histone H3a gene, partial cds	133	4e-28
350	gb|DQ284185.1| Chaperina fusca histone H3a gene, partial cds	133	4e-28
351	gb|DQ284180.1| Staurois tuberilinguis histone H3a gene, partial cds	133	4e-28
352	gb|DQ284177.1| Rana japonica histone H3a gene, partial cds	133	4e-28
353	gb|DQ284168.1| Pseudoamolops sauteri histone H3a gene, partial cds	133	4e-28
354	gb|DQ284053.1| Boophis tephraeomystax histone H3a gene, partial cds	133	4e-28
355	ref|NM_072891.1| Caenorhabditis elegans HIStone family member (h...	133	4e-28
356	ref|NM_072896.2| Caenorhabditis elegans HIStone family member (h...	133	4e-28
357	ref|NM_072798.1| Caenorhabditis elegans HIStone family member (h...	133	4e-28
358	ref|NM_072875.1| Caenorhabditis elegans HIStone family member (h...	133	4e-28
359	gb|AY662898.1| Paretroplus cf. kieneri 'Amboaboa' histone H3a ge...	133	4e-28
360	gb|AY662892.1| Etroplus maculatus histone H3a gene, partial cds	133	4e-28
361	gb|AF026803.1|AF026803 Onobrychis viciifolia histone H3 mRNA, co...	133	4e-28
362	gb|BC054666.1| Danio rerio zgc:66241, mRNA (cDNA clone MGC:66241...	131	2e-27
363	ref|XM_580747.2| PREDICTED: Bos taurus similar to CG31613-PA (LO...	131	2e-27
364	gb|AY788897.1| Mnais nawai histone 3 gene, partial cds	131	2e-27
365	gb|AY125219.1| Echinosoma sp. DM11 histone 3 gene, partial cds	131	2e-27
366	ref|NM_199745.1| Danio rerio zgc:66241 (zgc:66241), mRNA	131	2e-27
367	dbj|AB195975.1| Lilium longiflorum YAH3 mRNA for histone H3, com...	131	2e-27
368	gb|AY749738.1| Jubabaetis sp. EP139 histone H3 (H3) gene, partia...	131	2e-27
369	gb|AY749736.1| Atopopus sp. EP134 histone H3 (H3) gene, partial cds	131	2e-27
370	gb|AY749725.1| Rallidens mcfarlanei histone H3 (H3) gene, partia...	131	2e-27
371	gb|AY749724.1| Nesameletus ornatus histone H3 (H3) gene, partial...	131	2e-27
372	gb|AY749717.1| Siphlonella sp. EP083 histone H3 (H3) gene, parti...	131	2e-27
373	gb|AY749711.1| Ecdyonurus dispar histone H3 (H3) gene, partial cds	131	2e-27
374	gb|AY749701.1| Paraleptophlebia vaciva histone H3 (H3) gene, par...	131	2e-27
375	gb|AY749699.1| Epeorus longimanus histone H3 (H3) gene, partial cds	131	2e-27
376	gb|AY669068.1| Chaetomium globosum histone H3 mRNA, complete cds	129	7e-27
377	emb|AL357493.8| Human DNA sequence from clone RP11-439A17 on chr...	129	7e-27
378	emb|AL109948.9|HSJ998N21 Human DNA sequence from clone RP5-998N2...	129	7e-27
379	ref|XM_779415.1| PREDICTED: Strongylocentrotus purpuratus simila...	129	7e-27
380	emb|X01064.1|SGHIS2A3 Rainbow trout histone H2A and H3 genes	129	7e-27
381	emb|X01612.1|NCHISH3 Neurospora crassa DNA for histone H3	129	7e-27
382	ref|NM_001025303.1| Homo sapiens similar to histone H2B histone ...	129	7e-27
383	gb|DQ284352.1| Rana chapaensis histone H3a gene, partial cds	129	7e-27
384	gb|DQ284260.1| Bufo andrewsi histone H3a gene, partial cds	129	7e-27
385	gb|DQ284224.1| Rana muscosa histone H3a gene, partial cds	129	7e-27
386	dbj|AB185074.1| Conocephalum conicum H3 gene for histone 3, comp...	129	7e-27
387	ref|XM_307606.1| Anopheles gambiae str. PEST ENSANGP00000016172 ...	129	7e-27
388	gb|AY338629.1| Heptagenia sp. EP018 histone 3 gene, partial cds	129	7e-27
389	gb|AY749740.1| Isonychia sp. EP142 histone H3 (H3) gene, partial...	129	7e-27
390	emb|X72949.1|XLH3HIS X.laevis H3r gene for histone H3	127	3e-26
391	ref|NM_074632.1| Caenorhabditis elegans HIStone family member (h...	127	3e-26
392	emb|Z93388.1|CET10C6 Caenorhabditis elegans Cosmid T10C6, comple...	127	3e-26
393	gb|AY749714.1| Meridialaris diguillina histone H3 (H3) gene, par...	127	3e-26
394	gb|AY752254.1| Cladosporium cladosporioides strain ATCC 66669 hi...	125	1e-25
395	gb|AY655596.1| Atherinomorus sp. Karianga histone H3a gene, part...	125	1e-25
396	gb|AY655583.1| Teramulus waterloti histone H3a gene, partial cds	125	1e-25
397	gb|BC069079.1| Homo sapiens histone 3, H3, mRNA (cDNA clone MGC:...	125	1e-25
398	ref|XM_793816.1| PREDICTED: Strongylocentrotus purpuratus simila...	125	1e-25
399	emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chr...	125	1e-25
400	emb|Z49861.1|HS2132H3 H.sapiens gene for histone H3	125	1e-25
401	emb|X53330.1|PDHISTCL P.dumerilii histone gene cluster for core ...	125	1e-25
402	ref|NM_003493.2| Homo sapiens histone 3, H3 (HIST3H3), mRNA	125	1e-25
403	gb|DQ284391.1| Scaphiophryne marmorata histone H3a gene, partial...	125	1e-25
404	gb|DQ284386.1| Elachistocleis ovalis histone H3a gene, partial cds	125	1e-25
405	gb|DQ284359.1| Rana maosonensis histone H3a gene, partial cds	125	1e-25
406	gb|DQ284356.1| Fejervarya limnocharis histone H3a gene, partial cds	125	1e-25
407	gb|DQ284309.1| Rana maculata histone H3a gene, partial cds	125	1e-25
408	gb|DQ284280.1| Rana warszewitschii histone H3a gene, partial cds	125	1e-25
409	gb|DQ284267.1| Rana grahami histone H3a gene, partial cds	125	1e-25
410	gb|DQ284242.1| Batrachylodes vertebralis histone H3a gene, parti...	125	1e-25
411	gb|DQ284174.1| Nyctixalus pictus histone H3a gene, partial cds	125	1e-25
412	gb|DQ284163.1| Rana adenopleura histone H3a gene, partial cds	125	1e-25
413	gb|DQ284094.1| Synapturanus mirandaribeiroi histone H3a gene, pa...	125	1e-25
414	gb|DQ284080.1| Theloderma corticale histone H3a gene, partial cds	125	1e-25
415	dbj|AB185078.1| Conocephalum conicum H3 gene for histone 3, comp...	125	1e-25
416	gb|AF531308.1| Homo sapiens histone H3 (HIST3H3) gene, complete cds	125	1e-25
417	gb|AY923963.1| Nerita polita isolate NR2 histone H3 (H3) gene, p...	125	1e-25
418	ref|XM_320335.2| Anopheles gambiae str. PEST ENSANGP00000014183 ...	125	1e-25
419	ref|XM_314446.2| Anopheles gambiae str. PEST ENSANGP00000016066 ...	125	1e-25
420	gb|AY662912.1| Paratilapia sp. 'Ifasy' histone H3a gene, partial...	125	1e-25
421	gb|AY662905.1| Paretroplus sp. 'Kamoro' histone H3a gene, partia...	125	1e-25
422	gb|AY662903.1| Paretroplus polyactis 'South' histone H3a gene, p...	125	1e-25
423	gb|AY662895.1| Paretroplus kieneri 'Kinkony' histone H3a gene, p...	125	1e-25
424	gb|AY662890.1| Etroplus canarensis histone H3a gene, partial cds	125	1e-25
425	gb|BC101837.1| Homo sapiens histone 3, H3, mRNA (cDNA clone MGC:...	125	1e-25
426	gb|BC101839.1| Homo sapiens histone 3, H3, mRNA (cDNA clone MGC:...	125	1e-25
427	ref|XM_610495.1| PREDICTED: Bos taurus similar to CG31613-PA (LO...	123	4e-25
428	emb|X72950.1|XLH3LHIS X.laevis H3l gene for histone H3	123	4e-25
429	ref|XM_688063.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	123	4e-25
430	gb|AF370817.1|AF370817 Locusta migratoria histone H3 gene, parti...	123	4e-25
431	dbj|AB185030.1| Conocephalum conicum H3 gene for histone 3, comp...	123	4e-25
432	gb|AY749721.1| Coloburiscoides sp. EP094 histone H3 (H3) gene, p...	123	4e-25
433	gb|AY749713.1| Penaphlebia sp. EP076 histone H3 (H3) gene, parti...	123	4e-25
434	gb|AY749707.1| Leptophlebiidae sp. EP030 histone H3 (H3) gene, p...	123	4e-25
435	gb|AY749704.1| Rhithrogena sp. EP021 histone H3 (H3) gene, parti...	123	4e-25
436	gb|AY655576.1| Marosatherina ladigesi histone H3a gene, partial cds	121	2e-24
437	ref|XM_356549.3| PREDICTED: Mus musculus similar to histone 1, H...	121	2e-24
438	emb|X95625.1|NPHISTOH3 N.pseudonarcissus mRNA for histone H3	121	2e-24
439	ref|NM_001016636.3| Xenopus tropicalis histone 2, H3c (hist1h3g)...	121	2e-24
440	gb|AY521728.1| Aphanicerca capensis voucher BYU_ACPL028 histone ...	121	2e-24
441	gb|AY521726.1| Pteronarcys californica voucher BYU_ACPL006 histo...	121	2e-24
442	gb|AY521713.1| Tyrannophasma gladiator voucher BYU_ACMP002 histo...	121	2e-24
443	gb|AY521699.1| Blatta orientalis voucher BYU_ACBL006 histone H3 ...	121	2e-24
444	gb|DQ284421.1| Pachytriton brevipes histone H3a gene, partial cds	121	2e-24
445	gb|DQ284374.1| Bufo maculatus histone H3a gene, partial cds	121	2e-24
446	gb|DQ284201.1| Bufo regularis histone H3a gene, partial cds	121	2e-24
447	gb|DQ284170.1| Rana temporaria histone H3a gene, partial cds	121	2e-24
448	ref|XM_686609.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	121	2e-24
449	dbj|AB185039.1| Conocephalum supradecompositum H3 gene for histo...	121	2e-24
450	gb|AF404640.1| Alternaria alternata s.l. STE-U4267 isolate CR26 ...	121	2e-24
451	gb|AF404639.1| Alternaria arborescens isolate CR3 histone gene, ...	121	2e-24
452	gb|AF404638.1| Alternaria alternata s.l. STE-U4257 isolate CR16 ...	121	2e-24
453	gb|AF404637.1| Alternaria alternata s.l. STE-U4258 isolate CR17 ...	121	2e-24
454	gb|AF404635.1| Alternaria arborescens isolate MA22 histone gene,...	121	2e-24
455	gb|AF404634.1| Alternaria tenuissima isolate MA6 histone gene, p...	121	2e-24
456	gb|AF404633.1| Alternaria tenuissima isolate MA1 histone gene, p...	121	2e-24
457	gb|AF404632.1| Alternaria alternata s.l. STE-U4262 isolate CR21 ...	121	2e-24
458	gb|AF404630.1| Alternaria arborescens isolate CR5 histone gene, ...	121	2e-24
459	gb|AF404628.1| Alternaria alternata s.l. STE-U4266 isolate CR25 ...	121	2e-24
460	gb|AF404627.1| Alternaria alternata s.l. STE-U4263 isolate CR22 ...	121	2e-24
461	gb|AF404626.1| Alternaria alternata s.l. STE-U4249 isolate CR8 h...	121	2e-24
462	gb|AF404625.1| Alternaria alternata s.l. STE-U4259 isolate CR18 ...	121	2e-24
463	gb|AF404624.1| Alternaria alternata s.l. STE-U4265 isolate CR24 ...	121	2e-24
464	gb|AF404622.1| Alternaria tenuissima isolate CR27 histone gene, ...	121	2e-24
465	gb|AF404621.1| Alternaria sp. STE-U4255 isolate CR14 histone gen...	121	2e-24
466	gb|AF404620.1| Alternaria alternata s.l. STE-U4242 isolate CR1 h...	121	2e-24
467	gb|AF404619.1| Alternaria sp. STE-U4264 isolate CR23 histone gen...	121	2e-24
468	gb|AF404618.1| Alternaria sp. STE-U4247 isolate CR6 histone gene...	121	2e-24
469	gb|AF404617.1| Alternaria alternata s.l. STE-U4248 isolate CR7 h...	121	2e-24
470	gb|AF404616.1| Alternaria alternata s.l. STE-U4260 isolate CR19 ...	121	2e-24
471	gb|AF404615.1| Alternaria alternata s.l. STE-U4261 isolate CR20 ...	121	2e-24
472	gb|AF404614.1| Alternaria alternata s.l. STE-U4349 isolate MA26 ...	121	2e-24
473	gb|AF404613.1| Alternaria alternata s.l. STE-U4328 isolate MA5 h...	121	2e-24
474	gb|AF404612.1| Alternaria alternata s.l. STE-U4327 isolate MA4 h...	121	2e-24
475	gb|AF404611.1| Alternaria alternata s.l. STE-U4326 isolate MA3 h...	121	2e-24
476	gb|AF404610.1| Alternaria alternata s.l. STE-U4325 isolate MA2 h...	121	2e-24
477	gb|AF404609.1| Alternaria alternata s.l. STE-U4348 isolate MA25 ...	121	2e-24
478	gb|AF404608.1| Alternaria alternata s.l. STE-U4344 isolate MA21 ...	121	2e-24
479	gb|AF404607.1| Alternaria alternata s.l. STE-U4342 isolate MA19 ...	121	2e-24
480	gb|AF404606.1| Alternaria alternata s.l. STE-U4341 isolate MA18 ...	121	2e-24
481	gb|AF404605.1| Alternaria alternata s.l. STE-U4340 isolate MA17 ...	121	2e-24
482	gb|AF404604.1| Alternaria alternata s.l. STE-U4339 isolate MA16 ...	121	2e-24
483	gb|AF404603.1| Alternaria alternata s.l. STE-U4338 isolate MA15 ...	121	2e-24
484	gb|AF404602.1| Alternaria alternata s.l. STE-U4337 isolate MA14 ...	121	2e-24
485	gb|AF404601.1| Alternaria alternata s.l. STE-U4336 isolate MA13 ...	121	2e-24
486	gb|AF404600.1| Alternaria alternata s.l. STE-U4332 isolate MA9 h...	121	2e-24
487	gb|AF404599.1| Alternaria alternata s.l. STE-U4346 isolate MA23 ...	121	2e-24
488	gb|AF404598.1| Alternaria alternata s.l. STE-U4335 isolate MA12 ...	121	2e-24
489	gb|AF404597.1| Alternaria alternata s.l. STE-U4333 isolate MA10 ...	121	2e-24
490	gb|AF404596.1| Alternaria alternata s.l. STE-U4330 isolate MA7 h...	121	2e-24
491	gb|AF404595.1| Alternaria alternata s.l. STE-U4347 isolate MA24 ...	121	2e-24
492	gb|AF404594.1| Alternaria alternata s.l. STE-U4343 isolate MA20 ...	121	2e-24
493	gb|AF404593.1| Alternaria alternata s.l. STE-U4334 isolate MA11 ...	121	2e-24
494	gb|AF404592.1| Alternaria alternata s.l. STE-U4331 isolate MA8 h...	121	2e-24
495	emb|CR855729.2| Xenopus tropicalis finished cDNA, clone TGas081o10	121	2e-24
496	gb|AY662904.1| Paretroplus tsimoly histone H3a gene, partial cds	121	2e-24
497	gb|AY662899.1| Paretroplus maculatus histone H3a gene, partial cds	121	2e-24
498	emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chr...	121	2e-24
499	gb|AY338642.1| Malenka californica histone 3 gene, partial cds	121	2e-24
500	gb|AY338638.1| Hetaerina americana histone 3 gene, partial cds	121	2e-24

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  307 bits (155), Expect = 1e-80
 Identities = 170/175 (97%)
 Strand = Plus / Minus

                                                                            
Query: 180      cctaggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 239
                |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 37507567 cctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 37507508

                                                                            
Query: 240      cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcct 299
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 37507507 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcct 37507448

                                                                       
Query: 300      cggctgcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
                |||| |||||||| ||||||| |||||||||||||||||||||||||||||||||
Sbjct: 37507447 cggccgcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtctt 37507393



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 195     cgcggatgcggcgggcgagct 215
               |||||||||||||||||||||
Sbjct: 9911750 cgcggatgcggcgggcgagct 9911730

---

>dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0505D12
          Length = 146951

 Score =  307 bits (155), Expect = 1e-80
 Identities = 170/175 (97%)
 Strand = Plus / Minus

                                                                          
Query: 180    cctaggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 239
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 102104 cctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 102045

                                                                          
Query: 240    cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcct 299
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 102044 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcct 101985

                                                                     
Query: 300    cggctgcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
              |||| |||||||| ||||||| |||||||||||||||||||||||||||||||||
Sbjct: 101984 cggccgcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtctt 101930

---

>dbj|AK108078.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-138-E03, full
           insert sequence
          Length = 1296

 Score =  307 bits (155), Expect = 1e-80
 Identities = 170/175 (97%)
 Strand = Plus / Minus

                                                                       
Query: 180 cctaggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 239
           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 490 cctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 431

                                                                       
Query: 240 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcct 299
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 430 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcct 371

                                                                  
Query: 300 cggctgcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||| |||||||| ||||||| |||||||||||||||||||||||||||||||||
Sbjct: 370 cggccgcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtctt 316

---

>ref|NM_190750.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  305 bits (154), Expect = 5e-80
 Identities = 169/174 (97%)
 Strand = Plus / Minus

                                                                       
Query: 181 ctaggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 240
           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 411 ctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 241 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctc 300
           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 351 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctc 292

                                                                 
Query: 301 ggctgcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||| |||||||| ||||||| |||||||||||||||||||||||||||||||||
Sbjct: 291 ggccgcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtctt 238

---

>ref|XM_475315.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  297 bits (150), Expect = 1e-77
 Identities = 165/170 (97%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 288

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| ||||||| |||||||||||||||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtctt 238

---

>gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0042J17, complete sequence
          Length = 124139

 Score =  297 bits (150), Expect = 1e-77
 Identities = 165/170 (97%)
 Strand = Plus / Plus

                                                                         
Query: 185   gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
             ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 72765 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 72824

                                                                         
Query: 245   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
             |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 72825 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 72884

                                                               
Query: 305   gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
             |||||||| ||||||| |||||||||||||||||||||||||||||||||
Sbjct: 72885 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtctt 72934

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  297 bits (150), Expect = 1e-77
 Identities = 165/170 (97%)
 Strand = Plus / Plus

                                                                            
Query: 185      gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
                ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21355443 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 21355502

                                                                            
Query: 245      ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
                |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 21355503 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 21355562

                                                                  
Query: 305      gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
                |||||||| ||||||| |||||||||||||||||||||||||||||||||
Sbjct: 21355563 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtctt 21355612

---

>dbj|AK120955.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023039F20, full
           insert sequence
          Length = 735

 Score =  297 bits (150), Expect = 1e-77
 Identities = 165/170 (97%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 492 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 433

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 432 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 373

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| ||||||| |||||||||||||||||||||||||||||||||
Sbjct: 372 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtctt 323

---

>gb|AC134048.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0076K20,
              complete sequence
          Length = 127338

 Score =  280 bits (141), Expect = 3e-72
 Identities = 156/161 (96%)
 Strand = Plus / Minus

                                                                          
Query: 194    ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 118165 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 118106

                                                                          
Query: 254    atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
              ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||
Sbjct: 118105 atggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgg 118046

                                                       
Query: 314    agcgcggagacggcggagctctggaagcggaggtcggtctt 354
              ||||||| |||||||||||||||||| |||||||| |||||
Sbjct: 118045 agcgcggcgacggcggagctctggaaccggaggtccgtctt 118005

---

>gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0030I09 map C83B, complete sequence
          Length = 123477

 Score =  280 bits (141), Expect = 3e-72
 Identities = 156/161 (96%)
 Strand = Plus / Minus

                                                                         
Query: 194   ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 13771 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 13712

                                                                         
Query: 254   atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
             ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||
Sbjct: 13711 atggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgg 13652

                                                      
Query: 314   agcgcggagacggcggagctctggaagcggaggtcggtctt 354
             ||||||| |||||||||||||||||| |||||||| |||||
Sbjct: 13651 agcgcggcgacggcggagctctggaaccggaggtccgtctt 13611

---

>emb|X13680.1|OSHIS321 Oryza sativa H3 histone H3R-21 clone RH3-2
          Length = 1200

 Score =  280 bits (141), Expect = 3e-72
 Identities = 156/161 (96%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 798 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 739

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||
Sbjct: 738 atggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgg 679

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||||||| |||||||||||||||||| |||||||| |||||
Sbjct: 678 agcgcggcgacggcggagctctggaaccggaggtccgtctt 638

---

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  280 bits (141), Expect = 3e-72
 Identities = 156/161 (96%)
 Strand = Plus / Plus

                                                                           
Query: 194     ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2608633 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 2608692

                                                                           
Query: 254     atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
               ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||
Sbjct: 2608693 atggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgg 2608752

                                                        
Query: 314     agcgcggagacggcggagctctggaagcggaggtcggtctt 354
               ||||||| |||||||||||||||||| |||||||| |||||
Sbjct: 2608753 agcgcggcgacggcggagctctggaaccggaggtccgtctt 2608793

---

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  280 bits (141), Expect = 3e-72
 Identities = 156/161 (96%)
 Strand = Plus / Plus

                                                                           
Query: 194     ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2617664 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 2617723

                                                                           
Query: 254     atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
               ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||
Sbjct: 2617724 atggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgg 2617783

                                                        
Query: 314     agcgcggagacggcggagctctggaagcggaggtcggtctt 354
               ||||||| |||||||||||||||||| |||||||| |||||
Sbjct: 2617784 agcgcggcgacggcggagctctggaaccggaggtccgtctt 2617824

---

>gb|U77296.1|OSU77296 Oryza sativa histone 3 mRNA, complete cds
          Length = 642

 Score =  280 bits (141), Expect = 3e-72
 Identities = 156/161 (96%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 469 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 410

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||
Sbjct: 409 atggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgg 350

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||||||| |||||||||||||||||| |||||||| |||||
Sbjct: 349 agcgcggcgacggcggagctctggaaccggaggtccgtctt 309

---

>emb|X00937.1|TAHI02 Wheat histone H3 gene
          Length = 811

 Score =  278 bits (140), Expect = 1e-71
 Identities = 170/180 (94%)
 Strand = Plus / Minus

                                                                       
Query: 175 agcaacctaggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgat 234
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 664 agcagcctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgat 605

                                                                       
Query: 235 ggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggta 294
           |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 604 ggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagaggcccacgaggta 545

                                                                       
Query: 295 tgcctcggctgcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
            |||||||| |||||||| || |||||||||||||||  |||||||||||||||||||||
Sbjct: 544 ggcctcggcggcctcctgcagggcggagacggcggaggactggaagcggaggtcggtctt 485

---

>ref|NM_185612.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  264 bits (133), Expect = 2e-67
 Identities = 154/161 (95%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 398 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 339

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||| |||||||||||||||||||||||||| ||||| || |||||||| 
Sbjct: 338 atggcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccgcggcctcctgc 279

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||||||| |||||||||||||||||||||||||||||||||
Sbjct: 278 agcgcggcgacggcggagctctggaagcggaggtcggtctt 238

---

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  264 bits (133), Expect = 2e-67
 Identities = 154/161 (95%)
 Strand = Plus / Plus

                                                                           
Query: 194     ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3054217 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 3054276

                                                                           
Query: 254     atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
               |||||||| ||||| |||||||||||||||||||||||||| ||||| || |||||||| 
Sbjct: 3054277 atggcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccgcggcctcctgc 3054336

                                                        
Query: 314     agcgcggagacggcggagctctggaagcggaggtcggtctt 354
               ||||||| |||||||||||||||||||||||||||||||||
Sbjct: 3054337 agcgcggcgacggcggagctctggaagcggaggtcggtctt 3054377



 Score =  256 bits (129), Expect = 4e-65
 Identities = 153/161 (95%)
 Strand = Plus / Plus

                                                                           
Query: 194     ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
               |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3045570 ccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 3045629

                                                                           
Query: 254     atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
               |||||||| ||||||||||||||||| |||||||||||||| |||||||| |||||||| 
Sbjct: 3045630 atggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgc 3045689

                                                        
Query: 314     agcgcggagacggcggagctctggaagcggaggtcggtctt 354
               ||||||| |||||||||||||||||||||||||||||||||
Sbjct: 3045690 agcgcggcgacggcggagctctggaagcggaggtcggtctt 3045730



 Score =  256 bits (129), Expect = 4e-65
 Identities = 156/165 (94%)
 Strand = Plus / Plus

                                                                           
Query: 190     ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
               |||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 3039536 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 3039595

                                                                           
Query: 250     gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
               ||||||||| || ||||||||||||||||| |||||||||||||| |||||||| |||||
Sbjct: 3039596 gtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctc 3039655

                                                            
Query: 310     ctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
               ||| ||||||| |||||||||||||||||||||||||||||||||
Sbjct: 3039656 ctgcagcgcggcgacggcggagctctggaagcggaggtcggtctt 3039700



 Score =  248 bits (125), Expect = 1e-62
 Identities = 155/165 (93%)
 Strand = Plus / Minus

                                                                           
Query: 190     ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
               |||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 3055564 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 3055505

                                                                           
Query: 250     gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
               |||||||||||| ||||||||||||||||| |||||||||||||| ||||| || |||||
Sbjct: 3055504 gtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcggcctc 3055445

                                                            
Query: 310     ctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
               ||| || |||| |||||||||||||||||||||||||||||||||
Sbjct: 3055444 ctgcagggcggcgacggcggagctctggaagcggaggtcggtctt 3055400



 Score =  248 bits (125), Expect = 1e-62
 Identities = 155/165 (93%)
 Strand = Plus / Plus

                                                                           
Query: 190     ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1644705 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 1644764

                                                                           
Query: 250     gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
               ||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 1644765 gtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcggcctc 1644824

                                                            
Query: 310     ctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
               |||||| |||   || |||  ||||||||||||||||||||||||
Sbjct: 1644825 ctggagggcgagcaccgcgtggctctggaagcggaggtcggtctt 1644869

---

>dbj|AP005828.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0702F05
          Length = 145018

 Score =  264 bits (133), Expect = 2e-67
 Identities = 154/161 (95%)
 Strand = Plus / Plus

                                                                          
Query: 194    ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142166 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 142225

                                                                          
Query: 254    atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
              |||||||| ||||| |||||||||||||||||||||||||| ||||| || |||||||| 
Sbjct: 142226 atggcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccgcggcctcctgc 142285

                                                       
Query: 314    agcgcggagacggcggagctctggaagcggaggtcggtctt 354
              ||||||| |||||||||||||||||||||||||||||||||
Sbjct: 142286 agcgcggcgacggcggagctctggaagcggaggtcggtctt 142326



 Score =  256 bits (129), Expect = 4e-65
 Identities = 153/161 (95%)
 Strand = Plus / Plus

                                                                          
Query: 194    ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
              |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 133519 ccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 133578

                                                                          
Query: 254    atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
              |||||||| ||||||||||||||||| |||||||||||||| |||||||| |||||||| 
Sbjct: 133579 atggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgc 133638

                                                       
Query: 314    agcgcggagacggcggagctctggaagcggaggtcggtctt 354
              ||||||| |||||||||||||||||||||||||||||||||
Sbjct: 133639 agcgcggcgacggcggagctctggaagcggaggtcggtctt 133679



 Score =  256 bits (129), Expect = 4e-65
 Identities = 156/165 (94%)
 Strand = Plus / Plus

                                                                          
Query: 190    ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
              |||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 127485 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 127544

                                                                          
Query: 250    gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
              ||||||||| || ||||||||||||||||| |||||||||||||| |||||||| |||||
Sbjct: 127545 gtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctc 127604

                                                           
Query: 310    ctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
              ||| ||||||| |||||||||||||||||||||||||||||||||
Sbjct: 127605 ctgcagcgcggcgacggcggagctctggaagcggaggtcggtctt 127649



 Score =  248 bits (125), Expect = 1e-62
 Identities = 155/165 (93%)
 Strand = Plus / Minus

                                                                          
Query: 190    ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
              |||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 143513 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 143454

                                                                          
Query: 250    gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
              |||||||||||| ||||||||||||||||| |||||||||||||| ||||| || |||||
Sbjct: 143453 gtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcggcctc 143394

                                                           
Query: 310    ctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
              ||| || |||| |||||||||||||||||||||||||||||||||
Sbjct: 143393 ctgcagggcggcgacggcggagctctggaagcggaggtcggtctt 143349

---

>dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
            clone:P0681F10
          Length = 170371

 Score =  264 bits (133), Expect = 2e-67
 Identities = 154/161 (95%)
 Strand = Plus / Plus

                                                                        
Query: 194  ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 8402 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 8461

                                                                        
Query: 254  atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
            |||||||| ||||| |||||||||||||||||||||||||| ||||| || |||||||| 
Sbjct: 8462 atggcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccgcggcctcctgc 8521

                                                     
Query: 314  agcgcggagacggcggagctctggaagcggaggtcggtctt 354
            ||||||| |||||||||||||||||||||||||||||||||
Sbjct: 8522 agcgcggcgacggcggagctctggaagcggaggtcggtctt 8562



 Score =  248 bits (125), Expect = 1e-62
 Identities = 155/165 (93%)
 Strand = Plus / Minus

                                                                        
Query: 190  ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
            |||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 9749 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 9690

                                                                        
Query: 250  gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
            |||||||||||| ||||||||||||||||| |||||||||||||| ||||| || |||||
Sbjct: 9689 gtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcggcctc 9630

                                                         
Query: 310  ctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
            ||| || |||| |||||||||||||||||||||||||||||||||
Sbjct: 9629 ctgcagggcggcgacggcggagctctggaagcggaggtcggtctt 9585

---

>gb|M36658.1|MZEH3A Corn histone H3 (H3C3) gene, complete cds
          Length = 1177

 Score =  260 bits (131), Expect = 3e-66
 Identities = 164/175 (93%)
 Strand = Plus / Minus

                                                                       
Query: 180 cctaggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 239
           ||||||| | ||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 957 cctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 898

                                                                       
Query: 240 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcct 299
           |||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||
Sbjct: 897 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaacaggccgacgaggtaggcct 838

                                                                  
Query: 300 cggctgcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||| |||||||| ||||||| ||||||||||  |||||||||||||||||||||
Sbjct: 837 cggcggcctcctgcagcgcggcgacggcggaggactggaagcggaggtcggtctt 783

---

>ref|NM_185607.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  256 bits (129), Expect = 4e-65
 Identities = 156/165 (94%)
 Strand = Plus / Minus

                                                                       
Query: 190 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
           |||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 250 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
           ||||||||| || ||||||||||||||||| |||||||||||||| |||||||| |||||
Sbjct: 342 gtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctc 283

                                                        
Query: 310 ctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||| ||||||| |||||||||||||||||||||||||||||||||
Sbjct: 282 ctgcagcgcggcgacggcggagctctggaagcggaggtcggtctt 238

---

>ref|NM_185609.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 432

 Score =  256 bits (129), Expect = 4e-65
 Identities = 153/161 (95%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 419 ccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 360

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||||||||||||||| |||||||||||||| |||||||| |||||||| 
Sbjct: 359 atggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgc 300

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||||||| |||||||||||||||||||||||||||||||||
Sbjct: 299 agcgcggcgacggcggagctctggaagcggaggtcggtctt 259

---

>emb|X13678.1|OSHIS311 Oryza sativa H3 histone gene H3R-11
          Length = 1200

 Score =  256 bits (129), Expect = 4e-65
 Identities = 156/165 (94%)
 Strand = Plus / Minus

                                                                       
Query: 190 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
           |||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 802 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 743

                                                                       
Query: 250 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
           ||||||||| || ||||||||||||||||| |||||||||||||| |||||||| |||||
Sbjct: 742 gtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctc 683

                                                        
Query: 310 ctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||| ||||||| |||||||||||||||||||||||||||||||||
Sbjct: 682 ctgcagcgcggcgacggcggagctctggaagcggaggtcggtctt 638

---

>emb|X13679.1|OSHIS3PS Oryza sativa H3 histone pseudogene H3R-12
          Length = 1920

 Score =  256 bits (129), Expect = 4e-65
 Identities = 153/161 (95%)
 Strand = Plus / Minus

                                                                        
Query: 194  ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
            |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1518 ccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 1459

                                                                        
Query: 254  atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
            |||||||| ||||||||||||||||| |||||||||||||| |||||||| |||||||| 
Sbjct: 1458 atggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgc 1399

                                                     
Query: 314  agcgcggagacggcggagctctggaagcggaggtcggtctt 354
            ||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1398 agcgcggcgacggcggagctctggaagcggaggtcggtctt 1358

---

>gb|M35388.1|MZEHISH3A Zea mays histone H3 gene, complete cds
          Length = 411

 Score =  250 bits (126), Expect = 3e-63
 Identities = 159/170 (93%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           ||||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctcgcccctgatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| 
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccacgaggtaggcctcggcg 288

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| ||||||| ||| ||||||  |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgcggcgacagcggaggactggaagcggaggtcggtctt 238

---

>gb|M13378.1|MZEH3C2 Maize (Zea mays) histone H3 gene (H3C2), complete cds
          Length = 1001

 Score =  250 bits (126), Expect = 3e-63
 Identities = 159/170 (93%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           ||||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 828 gccctctcgcccctgatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 769

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| 
Sbjct: 768 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccacgaggtaggcctcggcg 709

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| ||||||| ||| ||||||  |||||||||||||||||||||
Sbjct: 708 gcctcctgcagcgcggcgacagcggaggactggaagcggaggtcggtctt 659

---

>ref|XM_493701.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 411

 Score =  248 bits (125), Expect = 1e-62
 Identities = 155/165 (93%)
 Strand = Plus / Minus

                                                                       
Query: 190 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 250 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
           ||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcggcctc 283

                                                        
Query: 310 ctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||| |||   || |||  ||||||||||||||||||||||||
Sbjct: 282 ctggagggcgagcaccgcgtggctctggaagcggaggtcggtctt 238

---

>ref|NM_185613.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  248 bits (125), Expect = 1e-62
 Identities = 155/165 (93%)
 Strand = Plus / Minus

                                                                       
Query: 190 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
           |||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 250 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
           |||||||||||| ||||||||||||||||| |||||||||||||| ||||| || |||||
Sbjct: 342 gtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcggcctc 283

                                                        
Query: 310 ctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||| || |||| |||||||||||||||||||||||||||||||||
Sbjct: 282 ctgcagggcggcgacggcggagctctggaagcggaggtcggtctt 238

---

>gb|BT017805.1| Zea mays clone EL01N0506E02.c mRNA sequence
          Length = 638

 Score =  248 bits (125), Expect = 1e-62
 Identities = 152/161 (94%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 340 ccgcggatgcggcgggcgagctgaatgtccttgggcatgatggtgacgcgcttggcgtgg 281

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           ||||||||||||||||||||||||||||| ||||||||||| ||||| || |||||||| 
Sbjct: 280 atggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctccgcggcctcctgc 221

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||||||| ||||||||||  |||||||||||||||||||||
Sbjct: 220 agcgcggcgacggcggaggactggaagcggaggtcggtctt 180

---

>dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
             clone:P0493C11
          Length = 143113

 Score =  248 bits (125), Expect = 1e-62
 Identities = 155/165 (93%)
 Strand = Plus / Plus

                                                                         
Query: 190   ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 47876 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 47935

                                                                         
Query: 250   gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
             ||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 47936 gtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcggcctc 47995

                                                          
Query: 310   ctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
             |||||| |||   || |||  ||||||||||||||||||||||||
Sbjct: 47996 ctggagggcgagcaccgcgtggctctggaagcggaggtcggtctt 48040

---

>gb|AF093633.1|AF093633 Oryza sativa histone H3 mRNA, complete cds
          Length = 793

 Score =  248 bits (125), Expect = 1e-62
 Identities = 155/165 (93%)
 Strand = Plus / Minus

                                                                       
Query: 190 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 490 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 431

                                                                       
Query: 250 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
           ||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 430 gtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcggcctc 371

                                                        
Query: 310 ctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||| |||   || |||  ||||||||||||||||||||||||
Sbjct: 370 ctggagggcgagcaccgcgtggctctggaagcggaggtcggtctt 326

---

>gb|BT018930.1| Zea mays clone Contig60.F mRNA sequence
          Length = 887

 Score =  246 bits (124), Expect = 4e-62
 Identities = 160/172 (93%)
 Strand = Plus / Plus

                                                                       
Query: 183 aggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 242
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 224 aggccctctcgccccggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 283

                                                                       
Query: 243 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcgg 302
           |||||||||||||||||||||||||||||||||||||||| || |||||||| |||||||
Sbjct: 284 gcttggcgtggatggcgcagaggttggtgtcctcgaagaggcccacgaggtaggcctcgg 343

                                                               
Query: 303 ctgcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           | |||||||| |||||||  |||||||||  |||||| |||||||| |||||
Sbjct: 344 cggcctcctgcagcgcggccacggcggaggactggaaccggaggtccgtctt 395

---

>emb|X84377.1|ZMHIS3DNA Z.mays histone H3 gene
          Length = 1119

 Score =  246 bits (124), Expect = 4e-62
 Identities = 160/172 (93%)
 Strand = Plus / Minus

                                                                       
Query: 183 aggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 242
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 793 aggccctctcgccccggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 734

                                                                       
Query: 243 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcgg 302
           |||||||||||||||||||||||||||||||||||||||| || |||||||| |||||||
Sbjct: 733 gcttggcgtggatggcgcagaggttggtgtcctcgaagaggcccacgaggtaggcctcgg 674

                                                               
Query: 303 ctgcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           | |||||||| |||||||  |||||||||  |||||| |||||||| |||||
Sbjct: 673 cggcctcctgcagcgcggccacggcggaggactggaaccggaggtccgtctt 622

---

>ref|XM_472456.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  242 bits (122), Expect = 6e-61
 Identities = 158/170 (92%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| 
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcg 288

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| ||||||| |||||||||   |||||| |||||||| |||||
Sbjct: 287 gcctcctgcagcgcggcgacggcggacgactggaaccggaggtccgtctt 238

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  242 bits (122), Expect = 6e-61
 Identities = 158/170 (92%)
 Strand = Plus / Minus

                                                                            
Query: 185      gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
                ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20749059 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 20749000

                                                                            
Query: 245      ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
                |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| 
Sbjct: 20748999 ttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcg 20748940

                                                                  
Query: 305      gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
                |||||||| ||||||| |||||||||   |||||| |||||||| |||||
Sbjct: 20748939 gcctcctgcagcgcggcgacggcggacgactggaaccggaggtccgtctt 20748890



 Score =  113 bits (57), Expect = 4e-22
 Identities = 90/101 (89%)
 Strand = Plus / Minus

                                                                            
Query: 212      agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtg 271
                ||||| |||||||||||||||||||| || |||||||| ||||||||||| |||||||||
Sbjct: 22438361 agctgaatgtccttgggcatgatggtcacacgcttggcatggatggcgcacaggttggtg 22438302

                                                         
Query: 272      tcctcgaagagcccgacgaggtatgcctcggctgcctcctg 312
                ||||||||||| || || ||||| |||||||| || |||||
Sbjct: 22438301 tcctcgaagagacccaccaggtacgcctcggcagcttcctg 22438261

---

>emb|AL606618.4|OSJN00062 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0108J11,
             complete sequence
          Length = 124629

 Score =  242 bits (122), Expect = 6e-61
 Identities = 158/170 (92%)
 Strand = Plus / Minus

                                                                         
Query: 185   gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
             ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 95210 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 95151

                                                                         
Query: 245   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
             |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| 
Sbjct: 95150 ttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcg 95091

                                                               
Query: 305   gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
             |||||||| ||||||| |||||||||   |||||| |||||||| |||||
Sbjct: 95090 gcctcctgcagcgcggcgacggcggacgactggaaccggaggtccgtctt 95041

---

>dbj|AB205017.1| Lolium multiflorum gene for replacement histone H3, exon 1-2,
           complete cds
          Length = 784

 Score =  228 bits (115), Expect = 1e-56
 Identities = 133/139 (95%)
 Strand = Plus / Minus

                                                                       
Query: 180 cctaggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 239
           ||||||| | ||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 576 cctaggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 517

                                                                       
Query: 240 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcct 299
           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 516 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcct 457

                              
Query: 300 cggctgcctcctggagcgc 318
           |||| ||||||||||||||
Sbjct: 456 cggccgcctcctggagcgc 438

---

>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
            (LOC417953), mRNA
          Length = 2271

 Score =  226 bits (114), Expect = 4e-56
 Identities = 156/170 (91%)
 Strand = Plus / Minus

                                                                        
Query: 185  gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
            |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2267 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 2208

                                                                        
Query: 245  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
            ||||||||||||||||| ||||||||||||||||||||||| || ||||| ||||||   
Sbjct: 2207 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctc 2148

                                                              
Query: 305  gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
            |||||||| |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 2147 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtctt 2098

---

>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene
          Length = 8384

 Score =  226 bits (114), Expect = 4e-56
 Identities = 156/170 (91%)
 Strand = Plus / Plus

                                                                        
Query: 185  gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
            |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3348 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 3407

                                                                        
Query: 245  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
            ||||||||||||||||| ||||||||||||||||||||||| || ||||| ||||||   
Sbjct: 3408 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctc 3467

                                                              
Query: 305  gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
            |||||||| |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 3468 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtctt 3517

---

>gb|BT018950.1| Zea mays clone Contig110.F mRNA sequence
          Length = 636

 Score =  224 bits (113), Expect = 1e-55
 Identities = 152/165 (92%)
 Strand = Plus / Plus

                                                                       
Query: 190 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 142 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttagc 201

                                                                       
Query: 250 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
           ||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 202 gtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcggcctc 261

                                                        
Query: 310 ctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||||    ||||||  ||||||||| |||||||| |||||
Sbjct: 262 ctggagcgccagcacggcgtggctctggaatcggaggtctgtctt 306

---

>emb|X79714.1|LTMRHIS3 L.temulentum mRNA for histone H3
          Length = 657

 Score =  224 bits (113), Expect = 1e-55
 Identities = 122/125 (97%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 449 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 390

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| |||||||||||||||||||||||||||||||| |||||||| |||||||||
Sbjct: 389 atggcgcacaggttggtgtcctcgaagagcccgacgaggtaggcctcggccgcctcctgg 330

                
Query: 314 agcgc 318
           |||||
Sbjct: 329 agcgc 325

---

>gb|U25664.1|OSU25664 Oryza sativa histone H3 gene, complete cds
          Length = 711

 Score =  224 bits (113), Expect = 1e-55
 Identities = 149/161 (92%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 628 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 569

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||| ||||||||||||||||||||||||||   ||| || |||||||| 
Sbjct: 568 atggcgcacaggttagtgtcctcgaagagcccgacgaggtaccgctccgcggcctcctgc 509

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||||||  |||||||||  ||||||||||||||||||||||
Sbjct: 508 agcgcgcggacggcggacgtctggaagcggaggtcggtctt 468

---

>gb|M15664.1|RICHIS3 Rice histone 3 gene, complete cds
          Length = 568

 Score =  224 bits (113), Expect = 1e-55
 Identities = 149/161 (92%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 535 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 476

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||| ||||||||||||||||||||||||||   ||| || |||||||| 
Sbjct: 475 atggcgcacaggttagtgtcctcgaagagcccgacgaggtaccgctccgcggcctcctgc 416

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||||||  |||||||||  ||||||||||||||||||||||
Sbjct: 415 agcgcgcggacggcggacgtctggaagcggaggtcggtctt 375

---

>ref|XM_545420.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488298), mRNA
          Length = 411

 Score =  222 bits (112), Expect = 6e-55
 Identities = 157/172 (91%)
 Strand = Plus / Minus

                                                                       
Query: 183 aggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 242
           |||||||||| |||||||||||||| || |||||||||||||||||||||||||||||||
Sbjct: 409 aggccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgc 350

                                                                       
Query: 243 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcgg 302
           ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 349 gcttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgc 290

                                                               
Query: 303 ctgcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
             |||||||| |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 289 acgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtctt 238

---

>ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 3 (LOC480760), mRNA
          Length = 862

 Score =  220 bits (111), Expect = 2e-54
 Identities = 156/171 (91%)
 Strand = Plus / Minus

                                                                       
Query: 184 ggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcg 243
           ||||||||| |||||||||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 408 ggccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcg 349

                                                                       
Query: 244 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggc 303
           |||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||  
Sbjct: 348 cttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgca 289

                                                              
Query: 304 tgcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
            |||||||| |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 288 cgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtctt 238

---

>ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 1 (LOC480760), mRNA
          Length = 1422

 Score =  220 bits (111), Expect = 2e-54
 Identities = 156/171 (91%)
 Strand = Plus / Minus

                                                                       
Query: 184 ggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcg 243
           ||||||||| |||||||||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 408 ggccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcg 349

                                                                       
Query: 244 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggc 303
           |||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||  
Sbjct: 348 cttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgca 289

                                                              
Query: 304 tgcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
            |||||||| |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 288 cgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtctt 238

---

>ref|XM_849194.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611519), mRNA
          Length = 471

 Score =  218 bits (110), Expect = 9e-54
 Identities = 155/170 (91%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| |||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 467 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 408

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||   
Sbjct: 407 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 348

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 347 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtctt 298

---

>ref|XM_545399.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488277), mRNA
          Length = 411

 Score =  218 bits (110), Expect = 9e-54
 Identities = 155/170 (91%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| |||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtctt 238

---

>ref|XM_545397.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488275), mRNA
          Length = 459

 Score =  218 bits (110), Expect = 9e-54
 Identities = 155/170 (91%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| |||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 455 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 396

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||   
Sbjct: 395 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 336

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 335 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtctt 286

---

>ref|XM_848782.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611138), mRNA
          Length = 411

 Score =  218 bits (110), Expect = 9e-54
 Identities = 155/170 (91%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| |||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtctt 238

---

>ref|XM_545429.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488307), mRNA
          Length = 411

 Score =  218 bits (110), Expect = 9e-54
 Identities = 155/170 (91%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| |||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtctt 238

---

>ref|XM_545385.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488263), mRNA
          Length = 411

 Score =  218 bits (110), Expect = 9e-54
 Identities = 155/170 (91%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| |||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtctt 238

---

>emb|Y08528.1|OSHISTON3 Oryza sativa mRNA for histone 3
          Length = 529

 Score =  218 bits (110), Expect = 9e-54
 Identities = 143/155 (92%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 470 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggagacgcgcttggcgtgg 411

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           ||||||||||||||||| || |||||||||| |||||||||  | ||||| || || |||
Sbjct: 410 atggcgcagaggttggtntcntcgaagagccngacgaggtagccttcggcggcttcttgg 351

                                              
Query: 314 agcgcggagacggcggagctctggaagcggaggtc 348
           ||||||| |||||||||||||||||| ||||||||
Sbjct: 350 agcgcggcgacggcggagctctggaaccggaggtc 316

---

>ref|XM_425464.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
           (LOC427890), mRNA
          Length = 600

 Score =  216 bits (109), Expect = 4e-53
 Identities = 148/161 (91%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 587 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 528

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 527 atggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgc 468

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 467 agcgccatgacggccgagctctggaagcgcaggtcggtctt 427

---

>ref|XM_416198.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417958),
           mRNA
          Length = 1512

 Score =  216 bits (109), Expect = 4e-53
 Identities = 148/161 (91%)
 Strand = Plus / Plus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 581 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 640

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 641 atggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgc 700

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 701 agcgccatgacggccgagctctggaagcgcaggtcggtctt 741

---

>ref|XM_416190.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417949),
           mRNA
          Length = 752

 Score =  216 bits (109), Expect = 4e-53
 Identities = 148/161 (91%)
 Strand = Plus / Plus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 326 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 385

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 386 atggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgc 445

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 446 agcgccatgacggccgagctctggaagcgcaggtcggtctt 486

---

>ref|XM_416186.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417945),
           mRNA
          Length = 972

 Score =  216 bits (109), Expect = 4e-53
 Identities = 148/161 (91%)
 Strand = Plus / Plus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 389 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 448

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 449 atggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgc 508

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 509 agcgccatgacggccgagctctggaagcgcaggtcggtctt 549

---

>emb|CR390239.1| Gallus gallus finished cDNA, clone ChEST932d15
          Length = 578

 Score =  216 bits (109), Expect = 4e-53
 Identities = 148/161 (91%)
 Strand = Plus / Plus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 145 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 204

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 205 atggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgc 264

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 265 agcgccatgacggccgagctctggaagcgcaggtcggtctt 305

---

>emb|X62291.1|GGHISH3IV G.gallus gene for histone H3-IV
          Length = 1094

 Score =  216 bits (109), Expect = 4e-53
 Identities = 148/161 (91%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 812 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 753

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 752 atggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgc 693

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 692 agcgccatgacggccgagctctggaagcgcaggtcggtctt 652

---

>gb|U37579.1|GGU37579 Gallus gallus histone H3-VIII gene, complete cds
          Length = 1809

 Score =  216 bits (109), Expect = 4e-53
 Identities = 148/161 (91%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 869 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 810

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 809 atggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgc 750

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 749 agcgccatgacggccgagctctggaagcgcaggtcggtctt 709

---

>gb|U37578.1|GGU37578 Gallus gallus histone H3-VII gene, complete cds
          Length = 1204

 Score =  216 bits (109), Expect = 4e-53
 Identities = 148/161 (91%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 886 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 827

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 826 atggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgc 767

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 766 agcgccatgacggccgagctctggaagcgcaggtcggtctt 726

---

>gb|U37577.1|GGU37577 Gallus gallus histone H3-VI gene, complete cds
          Length = 1271

 Score =  216 bits (109), Expect = 4e-53
 Identities = 148/161 (91%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 682 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 623

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 622 atggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgc 563

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 562 agcgccatgacggccgagctctggaagcgcaggtcggtctt 522

---

>gb|M61154.1|CHKH3AA Chicken histone H3 gene, complete cds
          Length = 784

 Score =  216 bits (109), Expect = 4e-53
 Identities = 148/161 (91%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 751 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 692

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 691 atggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgc 632

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 631 agcgccatgacggccgagctctggaagcgcaggtcggtctt 591

---

>gb|BT018179.1| Zea mays clone EL01N0557G06.c mRNA sequence
          Length = 716

 Score =  214 bits (108), Expect = 1e-52
 Identities = 156/172 (90%)
 Strand = Plus / Minus

                                                                       
Query: 183 aggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 242
           |||||||||| || | ||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 469 aggccctctctcccctgatgcggcgcgcgagctggatgtccttgggcatgatggtgacgc 410

                                                                       
Query: 243 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcgg 302
           ||||||||||||||||||| ||| | |||||||| |||||||| |||||||| |||||||
Sbjct: 409 gcttggcgtggatggcgcacagggtagtgtcctcaaagagccccacgaggtaggcctcgg 350

                                                               
Query: 303 ctgcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           | |||||||| ||||| ||||||||||||  |||||||||||| ||||||||
Sbjct: 349 cggcctcctgcagcgcagagacggcggaggactggaagcggagatcggtctt 298

---

>ref|XM_848810.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611167), mRNA
          Length = 504

 Score =  212 bits (107), Expect = 6e-52
 Identities = 152/167 (91%)
 Strand = Plus / Minus

                                                                       
Query: 188 ctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 247
           ||||| |||||||||||||| || ||||||||||||||||||||||||||||||||||||
Sbjct: 497 ctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttg 438

                                                                       
Query: 248 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcc 307
           |||||||||||||||||||||||||||||||||||||| || ||||| ||||||   |||
Sbjct: 437 gcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcc 378

                                                          
Query: 308 tcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||||| |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 377 tcctgcagcgccatgacggccgagctctggaagcgcaggtcggtctt 331

---

>gb|M34928.1|BLYHISH3PA Barley histone H3 mRNA, 3' end
          Length = 505

 Score =  210 bits (106), Expect = 2e-51
 Identities = 118/122 (96%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 230 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 171

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||||||||||||||| |||||||||||||| |||||||| |||||||||
Sbjct: 170 atggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgg 111

             
Query: 314 ag 315
           ||
Sbjct: 110 ag 109

---

>ref|XM_545428.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488306), mRNA
          Length = 411

 Score =  208 bits (105), Expect = 9e-51
 Identities = 147/161 (91%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 398 ccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 339

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 338 atggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctcctgc 279

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 278 agcgccatgacggccgagctctggaagcgcaggtcggtctt 238

---

>emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes
          Length = 4717

 Score =  208 bits (105), Expect = 9e-51
 Identities = 147/161 (91%)
 Strand = Plus / Minus

                                                                        
Query: 194  ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3233 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 3174

                                                                        
Query: 254  atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
            |||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 3173 atggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgc 3114

                                                     
Query: 314  agcgcggagacggcggagctctggaagcggaggtcggtctt 354
            |||||    ||||| |||||||||||||| |||||||||||
Sbjct: 3113 agcgccatcacggccgagctctggaagcgcaggtcggtctt 3073



 Score =  208 bits (105), Expect = 9e-51
 Identities = 147/161 (91%)
 Strand = Plus / Plus

                                                                        
Query: 194  ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1488 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 1547

                                                                        
Query: 254  atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
            |||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 1548 atggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgc 1607

                                                     
Query: 314  agcgcggagacggcggagctctggaagcggaggtcggtctt 354
            |||||    ||||| |||||||||||||| |||||||||||
Sbjct: 1608 agcgccatcacggccgagctctggaagcgcaggtcggtctt 1648

---

>emb|X62292.1|GGHISH3V G.gallus gene for histone H3-V
          Length = 1107

 Score =  208 bits (105), Expect = 9e-51
 Identities = 147/161 (91%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 812 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcatgg 753

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 752 atggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgc 693

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 692 agcgccatgacggccgagctctggaagcgcaggtcggtctt 652

---

>gb|M61155.1|CHKH3AB Chicken histone H3 gene, complete cds
          Length = 1017

 Score =  208 bits (105), Expect = 9e-51
 Identities = 147/161 (91%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 558 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgc 499

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 498 atggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgc 439

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 438 agcgccatgacggccgagctctggaagcgcaggtcggtctt 398

---

>gb|M13379.1|MZEH3C4 Maize (Zea mays) histone H3 gene (H3C4), complete cds
          Length = 1264

 Score =  206 bits (104), Expect = 4e-50
 Identities = 155/172 (90%)
 Strand = Plus / Minus

                                                                       
Query: 183 aggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 242
           |||||||||| || | ||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 934 aggccctctctcccctgatgcggcgcgcgagctgaatgtccttgggcatgatggtgacgc 875

                                                                       
Query: 243 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcgg 302
           ||||||||||||||||||||||||| |||||||| |||||||| || ||||| |||||||
Sbjct: 874 gcttggcgtggatggcgcagaggttagtgtcctcaaagagccccacaaggtaggcctcgg 815

                                                               
Query: 303 ctgcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           | |||||||| ||||| | ||||||||||  |||||||||||| ||||||||
Sbjct: 814 cggcctcctgcagcgcagcgacggcggaggactggaagcggagatcggtctt 763

---

>gb|BT017332.1| Zea mays clone EL01N0320H03.c mRNA sequence
          Length = 639

 Score =  202 bits (102), Expect = 5e-49
 Identities = 120/126 (95%)
 Strand = Plus / Minus

                                                                       
Query: 190 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 401 ctcgccgcggatgcggcgggcgagctggatgtctttgggcatgatggtgacgcgcttggc 342

                                                                       
Query: 250 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
           |||||||||||||||||||||||||||||| || ||||||||||| |||||||| || ||
Sbjct: 341 gtggatggcgcagaggttggtgtcctcgaacaggccgacgaggtaggcctcggcggcttc 282

                 
Query: 310 ctggag 315
           ||||||
Sbjct: 281 ctggag 276

---

>ref|XM_870218.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC617888), mRNA
          Length = 714

 Score =  194 bits (98), Expect = 1e-46
 Identities = 155/174 (89%)
 Strand = Plus / Minus

                                                                       
Query: 181 ctaggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 240
           |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 714 ctaggccctctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgac 655

                                                                       
Query: 241 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctc 300
           |||||||||||||||||| || |||||||||||||||||||| || || ||||| |||||
Sbjct: 654 gcgcttggcgtggatggcacacaggttggtgtcctcgaagagtcccaccaggtaggcctc 595

                                                                 
Query: 301 ggctgcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |   |||||||| |||||    || || |||||||||||||| |||||||||||
Sbjct: 594 gcacgcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtctt 541

---

>ref|XM_599846.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC521581), mRNA
          Length = 411

 Score =  194 bits (98), Expect = 1e-46
 Identities = 152/170 (89%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           |||||||||||||| || ||||||||||||||||||||||| || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| |||||    || || |||||||||||||| |||||||||||
Sbjct: 287 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtctt 238

---

>ref|XM_540290.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform
           2 (LOC483172), mRNA
          Length = 525

 Score =  194 bits (98), Expect = 1e-46
 Identities = 152/170 (89%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||| ||| |||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 521 gcccgctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 462

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| ||||||||||||||||||||||| || ||||| ||||||   
Sbjct: 461 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctc 402

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| |||||   |||||| |||||||||||||| ||||| |||||
Sbjct: 401 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtctt 352

---

>ref|XM_540285.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform
           2 (LOC483167), mRNA
          Length = 525

 Score =  194 bits (98), Expect = 1e-46
 Identities = 152/170 (89%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||| ||| |||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 521 gcccgctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 462

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| ||||||||||||||||||||||| || ||||| ||||||   
Sbjct: 461 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctc 402

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| |||||   |||||| |||||||||||||| ||||| |||||
Sbjct: 401 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtctt 352

---

>ref|XM_845651.1| PREDICTED: Canis familiaris similar to CG31613-PA (LOC608586), mRNA
          Length = 411

 Score =  194 bits (98), Expect = 1e-46
 Identities = 155/174 (89%)
 Strand = Plus / Minus

                                                                       
Query: 181 ctaggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 240
           |||||| | ||| |||||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 411 ctaggcgcgctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 241 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctc 300
           ||||||||||||||||||||| ||||||||||||||||||||||| || ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 292

                                                                 
Query: 301 ggctgcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |   |||||||| |||||   |||||| |||||||||||||| ||||| |||||
Sbjct: 291 gctcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtctt 238

---

>gb|BT016934.1| Zea mays clone E04912703G10.c mRNA sequence
          Length = 663

 Score =  186 bits (94), Expect = 3e-44
 Identities = 124/134 (92%)
 Strand = Plus / Plus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           ||||||||||| | |||||||||||||||||||||||||||||||||||||||||| | |
Sbjct: 154 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgaccctc 213

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||||||||||||||||||||||||||| || ||||| ||||| || 
Sbjct: 214 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtacgcctccgcg 273

                         
Query: 305 gcctcctggagcgc 318
           |||||||| |||||
Sbjct: 274 gcctcctgcagcgc 287

---

>ref|XM_871261.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618948), mRNA
          Length = 484

 Score =  186 bits (94), Expect = 3e-44
 Identities = 151/170 (88%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcgaatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           |||||||||||||| || ||||||||||||||||||||||| || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| |||||    || || |||||||||||||| |||||||||||
Sbjct: 287 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtctt 238

---

>ref|XM_591827.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC540148), mRNA
          Length = 484

 Score =  186 bits (94), Expect = 3e-44
 Identities = 151/170 (88%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcgaatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           |||||||||||||| || ||||||||||||||||||||||| || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| |||||    || || |||||||||||||| |||||||||||
Sbjct: 287 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtctt 238

---

>ref|XM_601510.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC523214), mRNA
          Length = 1459

 Score =  186 bits (94), Expect = 3e-44
 Identities = 151/170 (88%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 927 gccctttctccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 868

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           |||||||||||||| || ||||||||||||||||||||||| || ||||| ||||||   
Sbjct: 867 ttggcgtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 808

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| |||||    || || |||||||||||||| |||||||||||
Sbjct: 807 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtctt 758

---

>gb|AY125231.1| Melanoplus sp. OR18 histone 3 gene, partial cds
          Length = 372

 Score =  186 bits (94), Expect = 3e-44
 Identities = 124/134 (92%)
 Strand = Plus / Minus

                                                                       
Query: 221 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 280
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 309

                                                                       
Query: 281 agcccgacgaggtatgcctcggctgcctcctggagcgcggagacggcggagctctggaag 340
           || ||||||||||| ||||||   |||||||| |||||   |||||||||||||||||||
Sbjct: 308 aggccgacgaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaag 249

                         
Query: 341 cggaggtcggtctt 354
           || |||||||||||
Sbjct: 248 cgcaggtcggtctt 235

---

>gb|AY125229.1| Argia vivida histone 3 gene, partial cds
          Length = 372

 Score =  186 bits (94), Expect = 3e-44
 Identities = 124/134 (92%)
 Strand = Plus / Minus

                                                                       
Query: 221 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 280
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 309

                                                                       
Query: 281 agcccgacgaggtatgcctcggctgcctcctggagcgcggagacggcggagctctggaag 340
           || ||||||||||| |||||||  |||||||| || ||   |||||||||||||||||||
Sbjct: 308 agaccgacgaggtaggcctcggacgcctcctgcagagccatgacggcggagctctggaag 249

                         
Query: 341 cggaggtcggtctt 354
           ||||||||||||||
Sbjct: 248 cggaggtcggtctt 235

---

>gb|AY749753.1| Diphlebia coerulescens histone H3 (H3) gene, partial cds
          Length = 373

 Score =  186 bits (94), Expect = 3e-44
 Identities = 124/134 (92%)
 Strand = Plus / Minus

                                                                       
Query: 221 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 280
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 370 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 311

                                                                       
Query: 281 agcccgacgaggtatgcctcggctgcctcctggagcgcggagacggcggagctctggaag 340
           || || |||||||| ||||||   ||||||||||| ||   |||||||||||||||||||
Sbjct: 310 agacccacgaggtaagcctcgctggcctcctggagtgccatgacggcggagctctggaag 251

                         
Query: 341 cggaggtcggtctt 354
           ||||||||||||||
Sbjct: 250 cggaggtcggtctt 237

---

>ref|XM_848995.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611340), mRNA
          Length = 573

 Score =  184 bits (93), Expect = 1e-43
 Identities = 129/141 (91%)
 Strand = Plus / Minus

                                                                       
Query: 214 ctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtc 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 450 ctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtc 391

                                                                       
Query: 274 ctcgaagagcccgacgaggtatgcctcggctgcctcctggagcgcggagacggcggagct 333
           |||||||||||| || ||||| ||||||   |||||||| |||||   |||||| |||||
Sbjct: 390 ctcgaagagccccaccaggtaggcctcgcacgcctcctgcagcgccatgacggccgagct 331

                                
Query: 334 ctggaagcggaggtcggtctt 354
           ||||||||| |||||||||||
Sbjct: 330 ctggaagcgcaggtcggtctt 310

---

>gb|DQ393956.1| Cydia pomonella clone Cp4.140 microsatellite sequence
          Length = 517

 Score =  184 bits (93), Expect = 1e-43
 Identities = 144/161 (89%)
 Strand = Plus / Plus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           |||||||| | ||| || ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 129 ccgcggatcctgcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtgg 188

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| |||||||||||||||||||| ||||||||||| ||||||   |||||||||
Sbjct: 189 atggcgcacaggttggtgtcctcgaagagaccgacgaggtaagcctcgctggcctcctgg 248

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           || ||    |||||||||||||||||||| |||||||||||
Sbjct: 249 agagccataacggcggagctctggaagcgcaggtcggtctt 289

---

>gb|DQ393939.1| Cydia pomonella clone Cp4.P microsatellite sequence
          Length = 517

 Score =  184 bits (93), Expect = 1e-43
 Identities = 144/161 (89%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           |||||||| | ||| || ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 389 ccgcggatcctgcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtgg 330

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| |||||||||||||||||||| ||||||||||| ||||||   |||||||||
Sbjct: 329 atggcgcacaggttggtgtcctcgaagagaccgacgaggtaagcctcgctggcctcctgg 270

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           || ||    |||||||||||||||||||| |||||||||||
Sbjct: 269 agagccataacggcggagctctggaagcgcaggtcggtctt 229

---

>gb|DQ393935.1| Cydia pomonella clone Cp4.118 microsatellite sequence
          Length = 438

 Score =  184 bits (93), Expect = 1e-43
 Identities = 144/161 (89%)
 Strand = Plus / Plus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           |||||||| | ||| || ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 50  ccgcggatcctgcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtgg 109

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| |||||||||||||||||||| ||||||||||| ||||||   |||||||||
Sbjct: 110 atggcgcacaggttggtgtcctcgaagagaccgacgaggtaagcctcgctggcctcctgg 169

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           || ||    |||||||||||||||||||| |||||||||||
Sbjct: 170 agagccataacggcggagctctggaagcgcaggtcggtctt 210

---

>gb|DQ393934.1| Cydia pomonella clone Cp4.100 microsatellite sequence
          Length = 490

 Score =  184 bits (93), Expect = 1e-43
 Identities = 144/161 (89%)
 Strand = Plus / Plus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           |||||||| | ||| || ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 103 ccgcggatcctgcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtgg 162

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| |||||||||||||||||||| ||||||||||| ||||||   |||||||||
Sbjct: 163 atggcgcacaggttggtgtcctcgaagagaccgacgaggtaagcctcgctggcctcctgg 222

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           || ||    |||||||||||||||||||| |||||||||||
Sbjct: 223 agagccataacggcggagctctggaagcgcaggtcggtctt 263

---

>dbj|AB185026.1| Conocephalum conicum H3 gene for histone 3, complete cds, clone:
           T135
          Length = 473

 Score =  182 bits (92), Expect = 5e-43
 Identities = 146/164 (89%)
 Strand = Plus / Minus

                                                                       
Query: 190 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
           |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 464 ctcgcctcggatgcggcgggccagctggatgtccttgggcatgatggtgacgcgcttggc 405

                                                                       
Query: 250 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
           ||||||||||||||||||||||||||||||||| ||||| ||||| ||||| |  |||||
Sbjct: 404 gtggatggcgcagaggttggtgtcctcgaagaggccgaccaggtaggcctcagacgcctc 345

                                                       
Query: 310 ctggagcgcggagacggcggagctctggaagcggaggtcggtct 353
           ||| || ||    ||||| |||  ||||||||| ||||||||||
Sbjct: 344 ctgcagggccagcacggccgaggactggaagcgcaggtcggtct 301

---

>dbj|AB185023.1| Conocephalum conicum H3 gene for histone 3, complete cds, clone:
           T117
          Length = 474

 Score =  182 bits (92), Expect = 5e-43
 Identities = 146/164 (89%)
 Strand = Plus / Minus

                                                                       
Query: 190 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
           |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 465 ctcgcctcggatgcggcgggccagctggatgtccttgggcatgatggtgacgcgcttggc 406

                                                                       
Query: 250 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
           ||||||||||||||||||||||||||||||||| ||||| ||||| ||||| |  |||||
Sbjct: 405 gtggatggcgcagaggttggtgtcctcgaagaggccgaccaggtaggcctcagacgcctc 346

                                                       
Query: 310 ctggagcgcggagacggcggagctctggaagcggaggtcggtct 353
           ||| || ||    ||||| |||  ||||||||| ||||||||||
Sbjct: 345 ctgcagggccagcacggccgaggactggaagcgcaggtcggtct 302

---

>gb|AF140033.1|AF140033 Phreatamoeba balamuthi histone H3 mRNA, complete cds
          Length = 626

 Score =  180 bits (91), Expect = 2e-42
 Identities = 127/139 (91%)
 Strand = Plus / Minus

                                                                       
Query: 180 cctaggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 239
           ||||||| | |||||| |||||||||||||| ||||||||||||||||||||||| || |
Sbjct: 423 cctaggcgcgctcgccacggatgcggcgggccagctggatgtccttgggcatgatcgtca 364

                                                                       
Query: 240 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcct 299
           | |||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||
Sbjct: 363 cacgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtaggcct 304

                              
Query: 300 cggctgcctcctggagcgc 318
           |||| |||||||| |||||
Sbjct: 303 cggcggcctcctgcagcgc 285

---

>ref|NM_178205.1| Mus musculus histone 1, H3e (Hist1h3e), mRNA
          Length = 411

 Score =  178 bits (90), Expect = 8e-42
 Identities = 150/170 (88%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||| |||||||||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 407 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 348

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || |||||||| ||||||   
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 288

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 287 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 238

---

>ref|NM_175653.1| Mus musculus histone1, H3c (Hist1h3c), mRNA
          Length = 480

 Score =  178 bits (90), Expect = 8e-42
 Identities = 150/170 (88%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 431 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 372

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| ||||||   
Sbjct: 371 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 312

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   ||| || |||||||||||||| |||||||||||
Sbjct: 311 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtctt 262

---

>ref|XM_870476.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618149), mRNA
          Length = 411

 Score =  178 bits (90), Expect = 8e-42
 Identities = 150/170 (88%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| |||||||| |||||||| ||||||||||| |||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatccggcgggcaagctggatgtctttgggcatgatggtgacgcgc 348

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           |||||||||||||| || ||||||||||||||||||||||| || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcacacaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| |||||    || || |||||||||||||| |||||||||||
Sbjct: 287 gcctcctgcagcgccatcaccgcagagctctggaagcgcaggtcggtctt 238

---

>ref|XM_590015.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC539875), mRNA
          Length = 411

 Score =  178 bits (90), Expect = 8e-42
 Identities = 150/170 (88%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| |||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgagcaagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           |||||||||||||||||||| ||||||||||||||||| || || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcgcagagattggtgtcctcgaagaggcccaccaggtaggcctcgcac 288

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| |||||    || || |||||||| ||||| |||||||||||
Sbjct: 287 gcctcctgcagcgccatcaccgccgagctctgaaagcgcaggtcggtctt 238

---

>ref|NM_178206.2| Mus musculus histone 1, H3h (Hist1h3h), mRNA
          Length = 488

 Score =  178 bits (90), Expect = 8e-42
 Identities = 150/170 (88%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 438 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 379

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || |||||||| |||||    
Sbjct: 378 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 319

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 318 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 269

---

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score =  178 bits (90), Expect = 8e-42
 Identities = 150/170 (88%)
 Strand = Plus / Minus

                                                                         
Query: 185   gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
             |||| |||||||||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 73419 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 73360

                                                                         
Query: 245   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
             ||||||||||||||||| |||||||||||||| || || || |||||||| ||||||   
Sbjct: 73359 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 73300

                                                               
Query: 305   gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
             |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 73299 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 73250



 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Plus

                                                                         
Query: 185   gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
             |||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 99526 gccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 99585

                                                                         
Query: 245   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
             ||||||||||||||||| |||||||||||||| || || || |||||||| |||||    
Sbjct: 99586 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 99645

                                                               
Query: 305   gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
             |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 99646 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 99695



 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Plus

                                                                         
Query: 185   gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
             |||| |||||||||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 90487 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 90546

                                                                         
Query: 245   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
             ||||||||||||||||| |||||||||||||| || || || || ||||| ||||||   
Sbjct: 90547 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 90606

                                                               
Query: 305   gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
             |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 90607 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 90656



 Score =  155 bits (78), Expect = 1e-34
 Identities = 147/170 (86%)
 Strand = Plus / Plus

                                                                         
Query: 185   gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
             |||||||| || || ||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 59170 gccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 59229

                                                                         
Query: 245   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
             |||||||||||||| || |||||||||||||| || || || |||||||| ||||||   
Sbjct: 59230 ttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 59289

                                                               
Query: 305   gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
             |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 59290 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 59339

---

>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143
          Length = 3210

 Score =  178 bits (90), Expect = 8e-42
 Identities = 150/170 (88%)
 Strand = Plus / Minus

                                                                        
Query: 185  gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
            |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 3041 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 2982

                                                                        
Query: 245  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
            ||||||||||||||||| |||||||||||||| || || || || ||||| ||||||   
Sbjct: 2981 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 2922

                                                              
Query: 305  gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
            |||||||| || ||   ||| || |||||||||||||| |||||||||||
Sbjct: 2921 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtctt 2872

---

>emb|X80326.1|MPMPH312 M.pahari mpH312 gene
          Length = 580

 Score =  178 bits (90), Expect = 8e-42
 Identities = 150/170 (88%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 452 gccctctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 393

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| ||||||   
Sbjct: 392 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 333

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 332 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 283

---

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
             novel gene, the genes for three H1, four H2a, five H2b,
             four H3 and four H4 histone family members, the 3' end of
             a variant of the Hfe gene for hemochromatosis protein
             (Mr2) and ten CpG islands, complete sequence
          Length = 184730

 Score =  178 bits (90), Expect = 8e-42
 Identities = 150/170 (88%)
 Strand = Plus / Plus

                                                                         
Query: 185   gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
             |||| |||||||||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 42565 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 42624

                                                                         
Query: 245   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
             ||||||||||||||||| |||||||||||||| || || || |||||||| ||||||   
Sbjct: 42625 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 42684

                                                               
Query: 305   gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
             |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 42685 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 42734



 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Minus

                                                                         
Query: 185   gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
             |||| |||||||||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 25493 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 25434

                                                                         
Query: 245   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
             ||||||||||||||||| |||||||||||||| || || || || ||||| ||||||   
Sbjct: 25433 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 25374

                                                               
Query: 305   gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
             |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 25373 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 25324



 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Minus

                                                                         
Query: 185   gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
             |||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 16454 gccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 16395

                                                                         
Query: 245   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
             ||||||||||||||||| |||||||||||||| || || || |||||||| |||||    
Sbjct: 16394 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 16335

                                                               
Query: 305   gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
             |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 16334 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 16285



 Score =  155 bits (78), Expect = 1e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                         
Query: 185   gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
             |||||||| || || ||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 56814 gccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 56755

                                                                         
Query: 245   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
             |||||||||||||| || |||||||||||||| || || || |||||||| ||||||   
Sbjct: 56754 ttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 56695

                                                               
Query: 305   gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
             |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 56694 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 56645

---

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score =  178 bits (90), Expect = 8e-42
 Identities = 150/170 (88%)
 Strand = Plus / Minus

                                                                          
Query: 185    gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
              |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 139055 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 138996

                                                                          
Query: 245    ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
              ||||||||||||||||| |||||||||||||| || || || |||||||| |||||    
Sbjct: 138995 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 138936

                                                                
Query: 305    gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
              |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 138935 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 138886



 Score =  155 bits (78), Expect = 1e-34
 Identities = 147/170 (86%)
 Strand = Plus / Plus

                                                                          
Query: 185    gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
              |||||||| ||||| ||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 203954 gccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 204013

                                                                          
Query: 245    ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
              ||||||||||||||||| |||||||||||||| || || || |||||||| |||||    
Sbjct: 204014 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 204073

                                                                
Query: 305    gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
              |||||||| || ||   ||| || |||||||||||||| |||||||||||
Sbjct: 204074 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtctt 204123

---

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score =  178 bits (90), Expect = 8e-42
 Identities = 150/170 (88%)
 Strand = Plus / Minus

                                                                          
Query: 185    gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
              |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 143287 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 143228

                                                                          
Query: 245    ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
              ||||||||||||||||| |||||||||||||| || || || || ||||| ||||||   
Sbjct: 143227 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 143168

                                                                
Query: 305    gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
              |||||||| || ||   ||| || |||||||||||||| |||||||||||
Sbjct: 143167 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtctt 143118



 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Plus

                                                                          
Query: 185    gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
              |||||||| || || ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 135592 gccctctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 135651

                                                                          
Query: 245    ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
              ||||||||||||||||| |||||||||||||| || || || || ||||| ||||||   
Sbjct: 135652 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 135711

                                                                
Query: 305    gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
              |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 135712 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 135761



 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Minus

                                                                          
Query: 185    gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
              |||||||| ||||||||||||||||| || |||||||||||||||||||||||||| |||
Sbjct: 126431 gccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgc 126372

                                                                          
Query: 245    ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
              ||||||||||||||||| |||||||||||||| || || || || ||||| |||||    
Sbjct: 126371 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacag 126312

                                                                
Query: 305    gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
              |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 126311 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 126262

---

>gb|U62671.1|MMU62671 Mus musculus histone H3.2-B (H3-B) gene, complete cds
          Length = 1100

 Score =  178 bits (90), Expect = 8e-42
 Identities = 150/170 (88%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||| |||||||||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 893 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 834

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || |||||||| ||||||   
Sbjct: 833 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 774

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 773 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 724

---

>gb|AY158950.1| Mus musculus histone protein Hist1h3c gene, complete cds
          Length = 1408

 Score =  178 bits (90), Expect = 8e-42
 Identities = 150/170 (88%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 907 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 848

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| ||||||   
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 788

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   ||| || |||||||||||||| |||||||||||
Sbjct: 787 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtctt 738

---

>gb|AY158948.1| Mus musculus histone protein Hist1h3e gene, complete cds
          Length = 1408

 Score =  178 bits (90), Expect = 8e-42
 Identities = 150/170 (88%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||| |||||||||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 907 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 848

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || |||||||| ||||||   
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 788

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 787 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 738

---

>gb|AY158944.1| Mus musculus histone protein Hist1h3h gene, complete cds
          Length = 1408

 Score =  178 bits (90), Expect = 8e-42
 Identities = 150/170 (88%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 907 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 848

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || |||||||| |||||    
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 788

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 787 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 738

---

>gb|M32462.1|MUSHIS3D Mouse histone H3 (H3.1-291) gene, complete cds
          Length = 927

 Score =  178 bits (90), Expect = 8e-42
 Identities = 150/170 (88%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 745 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 686

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || |||||||| |||||    
Sbjct: 685 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 626

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 625 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 576

---

>ref|XM_782287.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC582332), mRNA
          Length = 411

 Score =  176 bits (89), Expect = 3e-41
 Identities = 146/165 (88%)
 Strand = Plus / Minus

                                                                       
Query: 190 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
           |||||| ||||| |||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 402 ctcgccacggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 343

                                                                       
Query: 250 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
           |||||||||||| |||||||||||||||||||| ||||| | ||||||||||   |||||
Sbjct: 342 gtggatggcgcacaggttggtgtcctcgaagagaccgaccaagtatgcctcgctggcctc 283

                                                        
Query: 310 ctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||| || ||   ||| |||||||||||||| ||||| ||||||||
Sbjct: 282 ctgaagagccatgactgcggagctctggaatcggagctcggtctt 238

---

>gb|DQ393931.1| Cydia pomonella clone Cp4.61 microsatellite sequence
          Length = 517

 Score =  176 bits (89), Expect = 3e-41
 Identities = 143/161 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           |||||||| | ||| || ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 388 ccgcggatcctgcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtgg 329

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| |||||||||||||||||| | ||||||||||| ||||||   |||||||||
Sbjct: 328 atggcgcacaggttggtgtcctcgaagggaccgacgaggtaagcctcgctggcctcctgg 269

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           || ||    |||||||||||||||||||| |||||||||||
Sbjct: 268 agagccataacggcggagctctggaagcgcaggtcggtctt 228

---

>gb|U38423.1|TAU38423 Triticum aestivum histone H3 gene, partial cds, clone W2
          Length = 486

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                       
Query: 212 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtg 271
           |||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 486 agctggatgtccttgggcatgatggtgacgcgcttggcatggatggcgcaggggttggtg 427

                                                       
Query: 272 tcctcgaagagcccgacgaggtatgcctcggctgcctcctggag 315
           ||||||||||||||||||||||| |||||||| |||||||||||
Sbjct: 426 tcctcgaagagcccgacgaggtacgcctcggcggcctcctggag 383

---

>dbj|AB185067.1| Conocephalum conicum H3 gene for histone 3, complete cds, clone:
           YFS1
          Length = 480

 Score =  172 bits (87), Expect = 5e-40
 Identities = 105/111 (94%)
 Strand = Plus / Minus

                                                                       
Query: 190 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
           |||||| ||||||||| |||| |||||||||||||||||||||||||||||||||||| |
Sbjct: 471 ctcgcctcggatgcggggggccagctggatgtccttgggcatgatggtgacgcgcttgac 412

                                                              
Query: 250 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctc 300
           ||||||| ||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 411 gtggatgacgcagaggttggtgtcctcgaagagaccgacgaggtatgcctc 361

---

>ref|NM_013548.2| Mus musculus histone 1, H3f (Hist1h3f), mRNA
          Length = 1851

 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||| |||||||||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 927 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 868

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| ||||||   
Sbjct: 867 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 808

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 807 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 758

---

>ref|NM_178216.1| Mus musculus histone 2, H3c1 (Hist2h3c1), transcript variant 2,
           mRNA
          Length = 546

 Score =  170 bits (86), Expect = 2e-39
 Identities = 140/158 (88%)
 Strand = Plus / Minus

                                                                       
Query: 197 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
           |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 530 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 471

                                                                       
Query: 257 gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
           ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 470 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 411

                                                 
Query: 317 gcggagacggcggagctctggaagcggaggtcggtctt 354
           ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 410 gccatgacggccgagctctggaagcgcaggtccgtctt 373

---

>gb|BC107285.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMAGE:40053006),
           partial cds
          Length = 417

 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||| |||||||||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 405 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 346

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || |||||||| |||||    
Sbjct: 345 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 286

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 285 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 236

---

>ref|NM_178203.1| Mus musculus histone 1, H3b (Hist1h3b), mRNA
          Length = 411

 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| || || ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 407 gccctctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 348

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 288

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 287 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 238

---

>ref|XM_871299.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618987), partial mRNA
          Length = 521

 Score =  170 bits (86), Expect = 2e-39
 Identities = 150/170 (88%), Gaps = 1/170 (0%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 410 gccctctctccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 351

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           |||||||||||||| || |||||||||||||| ||||| || || ||||| ||||||   
Sbjct: 350 ttggcgtggatggcacacaggttggtgtcctc-aagagtcccaccaggtaggcctcgcac 292

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| |||||    || || |||||||||||||| |||||||||||
Sbjct: 291 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtctt 242

---

>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339
          Length = 2972

 Score =  170 bits (86), Expect = 2e-39
 Identities = 140/158 (88%)
 Strand = Plus / Minus

                                                                        
Query: 197  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
            |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 1727 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 1668

                                                                        
Query: 257  gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
            ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 1667 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 1608

                                                  
Query: 317  gcggagacggcggagctctggaagcggaggtcggtctt 354
            ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 1607 gccatgacggccgagctctggaagcgcaggtccgtctt 1570

---

>ref|XM_865002.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC613840), partial mRNA
          Length = 547

 Score =  170 bits (86), Expect = 2e-39
 Identities = 150/170 (88%), Gaps = 1/170 (0%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 436 gccctctctccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 377

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           |||||||||||||| || |||||||||||||| ||||| || || ||||| ||||||   
Sbjct: 376 ttggcgtggatggcacacaggttggtgtcctc-aagagtcccaccaggtaggcctcgcac 318

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| |||||    || || |||||||||||||| |||||||||||
Sbjct: 317 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtctt 268

---

>ref|NM_145073.2| Mus musculus histone 1, H3g (Hist1h3g), mRNA
          Length = 492

 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 435 gccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 376

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || |||||||| |||||    
Sbjct: 375 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 316

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 315 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 266

---

>ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h3c1), mRNA
          Length = 2956

 Score =  170 bits (86), Expect = 2e-39
 Identities = 140/158 (88%)
 Strand = Plus / Minus

                                                                        
Query: 197  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
            |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 1727 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 1668

                                                                        
Query: 257  gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
            ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 1667 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 1608

                                                  
Query: 317  gcggagacggcggagctctggaagcggaggtcggtctt 354
            ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 1607 gccatgacggccgagctctggaagcgcaggtccgtctt 1570

---

>gb|BC103549.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123925
           IMAGE:40044771), complete cds
          Length = 1003

 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||| |||||||||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 840 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 781

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| ||||||   
Sbjct: 780 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 721

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 720 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 671

---

>emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23
          Length = 2724

 Score =  170 bits (86), Expect = 2e-39
 Identities = 140/158 (88%)
 Strand = Plus / Minus

                                                                        
Query: 197  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
            |||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2536 cggatgcggcggaccaactggatgtccttgggcatgatggtgacgcgcttggcgtggatg 2477

                                                                        
Query: 257  gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
            ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 2476 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 2417

                                                  
Query: 317  gcggagacggcggagctctggaagcggaggtcggtctt 354
            ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 2416 gccatgacggccgagctctggaagcgcaggtccgtctt 2379

---

>emb|X80325.1|MPMPH315 M.pahari mpH315 gene
          Length = 974

 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 588 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 529

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| |||||    
Sbjct: 528 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacag 469

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 468 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 419

---

>dbj|AK134918.1| Mus musculus adult male olfactory brain cDNA, RIKEN full-length
            enriched library, clone:6430517B15
            product:unclassifiable, full insert sequence
          Length = 3217

 Score =  170 bits (86), Expect = 2e-39
 Identities = 140/158 (88%)
 Strand = Plus / Plus

                                                                        
Query: 197  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
            |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 1203 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 1262

                                                                        
Query: 257  gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
            ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 1263 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 1322

                                                  
Query: 317  gcggagacggcggagctctggaagcggaggtcggtctt 354
            ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 1323 gccatgacggccgagctctggaagcgcaggtccgtctt 1360

---

>dbj|AK010121.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched
           library, clone:2310069A13 product:HISTONE H3-VI homolog
           [Gallus gallus], full insert sequence
          Length = 852

 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||| |||||||||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 429 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 370

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| ||||||   
Sbjct: 369 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 310

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 309 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 260

---

>gb|U62675.1|MMU62675 Mus musculus histone H3.2-616 (H3-616), and histone H2b-616
           (H2b-616) genes, complete cds
          Length = 2371

 Score =  170 bits (86), Expect = 2e-39
 Identities = 140/158 (88%)
 Strand = Plus / Minus

                                                                       
Query: 197 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
           |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 975 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 916

                                                                       
Query: 257 gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
           ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 915 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 856

                                                 
Query: 317 gcggagacggcggagctctggaagcggaggtcggtctt 354
           ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 855 gccatgacggccgagctctggaagcgcaggtccgtctt 818

---

>gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615),  and histone H3.2-615
            (H3-615) genes, complete cds
          Length = 2997

 Score =  170 bits (86), Expect = 2e-39
 Identities = 140/158 (88%)
 Strand = Plus / Minus

                                                                        
Query: 197  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
            |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 2710 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 2651

                                                                        
Query: 257  gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
            ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 2650 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 2591

                                                  
Query: 317  gcggagacggcggagctctggaagcggaggtcggtctt 354
            ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 2590 gccatgacggccgagctctggaagcgcaggtccgtctt 2553

---

>ref|NG_002616.1| Homo sapiens histone 2, H3b (HIST2H3B) pseudogene on chromosome 1
          Length = 1411

 Score =  170 bits (86), Expect = 2e-39
 Identities = 140/158 (88%)
 Strand = Plus / Minus

                                                                       
Query: 197 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
           |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 895 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 836

                                                                       
Query: 257 gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
           ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 835 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 776

                                                 
Query: 317 gcggagacggcggagctctggaagcggaggtcggtctt 354
           ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 775 gccatgacggccgagctctggaagcgcaggtccgtctt 738

---

>gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, complete sequence
          Length = 211945

 Score =  170 bits (86), Expect = 2e-39
 Identities = 152/174 (87%)
 Strand = Plus / Plus

                                                                          
Query: 181    ctaggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 240
              |||||| | ||| ||||||||||||||||| ||||||||||| |||||||||||||||||
Sbjct: 102348 ctaggctcgctccccgcggatgcggcgggccagctggatgtctttgggcatgatggtgac 102407

                                                                          
Query: 241    gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctc 300
               |||||||||||||||||||| ||||||||||||||||| || || || ||||| |||||
Sbjct: 102408 ccgcttggcgtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaagcctc 102467

                                                                    
Query: 301    ggctgcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
              |   | |||||| || ||   ||||||||||||||||||||| |||||||||||
Sbjct: 102468 gctggactcctgcagggccatgacggcggagctctggaagcgcaggtcggtctt 102521

---

>gb|BC094041.1| Mus musculus histone 2, H3c1, mRNA (cDNA clone MGC:102454
           IMAGE:5099464), complete cds
          Length = 1831

 Score =  170 bits (86), Expect = 2e-39
 Identities = 140/158 (88%)
 Strand = Plus / Minus

                                                                       
Query: 197 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
           |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 596 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 537

                                                                       
Query: 257 gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
           ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 536 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 477

                                                 
Query: 317 gcggagacggcggagctctggaagcggaggtcggtctt 354
           ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 476 gccatgacggccgagctctggaagcgcaggtccgtctt 439

---

>gb|AF531306.1| Homo sapiens histone H3 (HIST2H3B) pseudogene, complete sequence
          Length = 1411

 Score =  170 bits (86), Expect = 2e-39
 Identities = 140/158 (88%)
 Strand = Plus / Minus

                                                                       
Query: 197 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
           |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 895 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 836

                                                                       
Query: 257 gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
           ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 835 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 776

                                                 
Query: 317 gcggagacggcggagctctggaagcggaggtcggtctt 354
           ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 775 gccatgacggccgagctctggaagcgcaggtccgtctt 738

---

>gb|AY158955.1| Mus musculus histone protein Hist2h3b gene, complete cds
          Length = 1411

 Score =  170 bits (86), Expect = 2e-39
 Identities = 140/158 (88%)
 Strand = Plus / Minus

                                                                       
Query: 197 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
           |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 895 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 836

                                                                       
Query: 257 gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
           ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 835 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 776

                                                 
Query: 317 gcggagacggcggagctctggaagcggaggtcggtctt 354
           ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 775 gccatgacggccgagctctggaagcgcaggtccgtctt 738

---

>gb|AY158954.1| Mus musculus histone protein Hist2h3c1 gene, complete cds
          Length = 1675

 Score =  170 bits (86), Expect = 2e-39
 Identities = 140/158 (88%)
 Strand = Plus / Minus

                                                                        
Query: 197  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
            |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 1081 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 1022

                                                                        
Query: 257  gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
            ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 1021 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 962

                                                  
Query: 317  gcggagacggcggagctctggaagcggaggtcggtctt 354
            ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 961  gccatgacggccgagctctggaagcgcaggtccgtctt 924

---

>gb|AY158951.1| Mus musculus histone protein Hist1h3b gene, complete cds
          Length = 1411

 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| || || ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 907 gccctctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 848

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| ||||||   
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 788

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 787 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 738

---

>gb|AY158947.1| Mus musculus histone protein Hist1h3f gene, complete cds
          Length = 1851

 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||| |||||||||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 927 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 868

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| ||||||   
Sbjct: 867 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 808

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 807 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 758

---

>gb|AY158946.1| Mus musculus histone protein Hist1h3g gene, complete cds
          Length = 1405

 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 904 gccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 845

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || |||||||| |||||    
Sbjct: 844 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 785

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 784 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 735

---

>gb|AY158941.1| Mus musculus histone protein Hist2h2bb gene, complete cds
          Length = 1500

 Score =  170 bits (86), Expect = 2e-39
 Identities = 140/158 (88%)
 Strand = Plus / Plus

                                                                       
Query: 197 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
           |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 526 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 585

                                                                       
Query: 257 gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
           ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 586 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 645

                                                 
Query: 317 gcggagacggcggagctctggaagcggaggtcggtctt 354
           ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 646 gccatgacggccgagctctggaagcgcaggtccgtctt 683

---

>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence
          Length = 200326

 Score =  170 bits (86), Expect = 2e-39
 Identities = 140/158 (88%)
 Strand = Plus / Minus

                                                                         
Query: 197   cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
             |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 93727 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 93668

                                                                         
Query: 257   gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
             ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 93667 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 93608

                                                   
Query: 317   gcggagacggcggagctctggaagcggaggtcggtctt 354
             ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 93607 gccatgacggccgagctctggaagcgcaggtccgtctt 93570



 Score =  170 bits (86), Expect = 2e-39
 Identities = 140/158 (88%)
 Strand = Plus / Minus

                                                                         
Query: 197   cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
             |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 71919 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 71860

                                                                         
Query: 257   gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
             ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 71859 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 71800

                                                   
Query: 317   gcggagacggcggagctctggaagcggaggtcggtctt 354
             ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 71799 gccatgacggccgagctctggaagcgcaggtccgtctt 71762



 Score =  170 bits (86), Expect = 2e-39
 Identities = 140/158 (88%)
 Strand = Plus / Plus

                                                                         
Query: 197   cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
             |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 63186 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 63245

                                                                         
Query: 257   gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
             ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 63246 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 63305

                                                   
Query: 317   gcggagacggcggagctctggaagcggaggtcggtctt 354
             ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 63306 gccatgacggccgagctctggaagcgcaggtccgtctt 63343

---

>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence
          Length = 166720

 Score =  170 bits (86), Expect = 2e-39
 Identities = 140/158 (88%)
 Strand = Plus / Minus

                                                                         
Query: 197   cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
             |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 37507 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 37448

                                                                         
Query: 257   gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
             ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 37447 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 37388

                                                   
Query: 317   gcggagacggcggagctctggaagcggaggtcggtctt 354
             ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 37387 gccatgacggccgagctctggaagcgcaggtccgtctt 37350



 Score =  170 bits (86), Expect = 2e-39
 Identities = 140/158 (88%)
 Strand = Plus / Plus

                                                                         
Query: 197   cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
             |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 28774 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 28833

                                                                         
Query: 257   gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
             ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 28834 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 28893

                                                   
Query: 317   gcggagacggcggagctctggaagcggaggtcggtctt 354
             ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 28894 gccatgacggccgagctctggaagcgcaggtccgtctt 28931



 Score =  170 bits (86), Expect = 2e-39
 Identities = 140/158 (88%)
 Strand = Plus / Plus

                                                                        
Query: 197  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
            |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 6966 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 7025

                                                                        
Query: 257  gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
            ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 7026 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 7085

                                                  
Query: 317  gcggagacggcggagctctggaagcggaggtcggtctt 354
            ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 7086 gccatgacggccgagctctggaagcgcaggtccgtctt 7123

---

>gb|BC101955.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123923
           IMAGE:40044769), complete cds
          Length = 1004

 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||| |||||||||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 840 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 781

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| ||||||   
Sbjct: 780 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 721

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 720 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 671

---

>gb|BC101956.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123922
           IMAGE:40044765), complete cds
          Length = 1004

 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||| |||||||||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 840 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 781

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| ||||||   
Sbjct: 780 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 721

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 720 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 671

---

>gb|BC101954.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123924
           IMAGE:40044770), complete cds
          Length = 1004

 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||| |||||||||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 840 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 781

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| ||||||   
Sbjct: 780 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 721

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 720 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 671

---

>ref|NM_178215.1| Mus musculus histone 2, H3b (Hist2h3b), mRNA
          Length = 411

 Score =  170 bits (86), Expect = 2e-39
 Identities = 140/158 (88%)
 Strand = Plus / Minus

                                                                       
Query: 197 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
           |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 395 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 336

                                                                       
Query: 257 gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
           ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 335 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 276

                                                 
Query: 317 gcggagacggcggagctctggaagcggaggtcggtctt 354
           ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 275 gccatgacggccgagctctggaagcgcaggtccgtctt 238

---

>emb|X01685.1|MMHISH32 Mouse gene (H3.2) for histone H3
          Length = 702

 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||| |||||||||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 558 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 499

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| ||||||   
Sbjct: 498 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 439

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 438 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 389

---

>emb|X01684.1|MMHISH31 Mouse gene (H3.1) for histone H3
          Length = 1244

 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 759 gccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 700

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || |||||||| |||||    
Sbjct: 699 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 640

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 639 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 590

---

>gb|M32461.1|MUSHIS3C Mouse histone H3 (H3.2-614) gene, complete cds
          Length = 1110

 Score =  170 bits (86), Expect = 2e-39
 Identities = 140/158 (88%)
 Strand = Plus / Minus

                                                                       
Query: 197 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
           |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 734 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 675

                                                                       
Query: 257 gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
           ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 674 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 615

                                                 
Query: 317 gcggagacggcggagctctggaagcggaggtcggtctt 354
           ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 614 gccatgacggccgagctctggaagcgcaggtccgtctt 577

---

>gb|M32460.1|MUSHIS3B Mouse histone H3 (H3.1-221) gene, complete cds
          Length = 1125

 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 759 gccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 700

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || |||||||| |||||    
Sbjct: 699 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 640

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 639 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 590

---

>gb|M32459.1|MUSHIS3A Mouse histone H3 (H3.2-221) gene, complete cds
          Length = 982

 Score =  170 bits (86), Expect = 2e-39
 Identities = 149/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||| |||||||||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 815 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 756

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| ||||||   
Sbjct: 755 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 696

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 695 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 646

---

>ref|XM_780065.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC579977), mRNA
          Length = 411

 Score =  168 bits (85), Expect = 8e-39
 Identities = 145/165 (87%)
 Strand = Plus / Minus

                                                                       
Query: 190 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
           |||||| |||||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 402 ctcgccacggatgcgacgggcaagctggatgtccttgggcatgatggtgacacgcttggc 343

                                                                       
Query: 250 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
           |||||||||||| |||||||||||||||||||| ||||| | |||||| |||   |||||
Sbjct: 342 gtggatggcgcacaggttggtgtcctcgaagagaccgaccaagtatgcttcgctggcctc 283

                                                        
Query: 310 ctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||| || ||   ||| |||||||||||||| ||||| ||||||||
Sbjct: 282 ctgaagagccatgactgcggagctctggaatcggagctcggtctt 238

---

>emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 and H3.2
          Length = 2927

 Score =  168 bits (85), Expect = 8e-39
 Identities = 142/161 (88%)
 Strand = Plus / Minus

                                                                        
Query: 194  ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
            ||||||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||
Sbjct: 2753 ccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacgcgcttggcgtgg 2694

                                                                        
Query: 254  atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
            |||||||| ||||||||||||||||| || || || ||||| ||||||   |||||||| 
Sbjct: 2693 atggcgcacaggttggtgtcctcgaacagacccaccaggtaggcctcgctcgcctcctgc 2634

                                                     
Query: 314  agcgcggagacggcggagctctggaagcggaggtcggtctt 354
            |||||   |||||| |||||||||||||| ||||| |||||
Sbjct: 2633 agcgccatgacggccgagctctggaagcgcaggtccgtctt 2593

---

>ref|XM_227461.2| PREDICTED: Rattus norvegicus similar to histone protein Hist2h3c1
           (LOC310679), mRNA
          Length = 573

 Score =  168 bits (85), Expect = 8e-39
 Identities = 142/161 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||
Sbjct: 560 ccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacgcgcttggcgtgg 501

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||||||||||||||| || || || ||||| ||||||   |||||||| 
Sbjct: 500 atggcgcacaggttggtgtcctcgaacagacccaccaggtaggcctcgctcgcctcctgc 441

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||   |||||| |||||||||||||| ||||| |||||
Sbjct: 440 agcgccatgacggccgagctctggaagcgcaggtccgtctt 400

---

>gb|AC151366.3| Aotus nancymaae clone CH258-105B22, complete sequence
          Length = 188026

 Score =  165 bits (83), Expect = 1e-37
 Identities = 152/175 (86%)
 Strand = Plus / Plus

                                                                          
Query: 180    cctaggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 239
              ||||||||| ||| ||||||||||||||||| ||||||||||||||||||||||| || |
Sbjct: 183192 cctaggcccgctccccgcggatgcggcgggccagctggatgtccttgggcatgatagtca 183251

                                                                          
Query: 240    cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcct 299
              |||||||||||||||||||||| ||||| ||||| ||||| ||||| || ||||| ||||
Sbjct: 183252 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 183311

                                                                     
Query: 300    cggctgcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
              ||   |||||||| |||||    ||||| |||||||||||||| ||||| |||||
Sbjct: 183312 cgctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtctt 183366

---

>ref|XM_603864.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC525511), mRNA
          Length = 448

 Score =  165 bits (83), Expect = 1e-37
 Identities = 146/167 (87%)
 Strand = Plus / Minus

                                                                       
Query: 188 ctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 247
           ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 404 ctctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttg 345

                                                                       
Query: 248 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcc 307
           ||||||||||| || |||||||||||||| |||||||| || ||||| ||||||   |||
Sbjct: 344 gcgtggatggcacacaggttggtgtcctcaaagagccccaccaggtaggcctcgcacgcc 285

                                                          
Query: 308 tcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||||| |||||    || || ||||||||||| || | |||||||||
Sbjct: 284 tcctgcagcgccatcaccgcagagctctggaaacgcaagtcggtctt 238

---

>gb|AY181030.1| Toxoplasma gondii histone H3 mRNA, complete cds
          Length = 411

 Score =  165 bits (83), Expect = 1e-37
 Identities = 110/119 (92%)
 Strand = Plus / Minus

                                                                       
Query: 197 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
           ||||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 395 cggatgcggcgagcgagctgaatgtccttgggcatgatggtgacacgcttggcgtggatg 336

                                                                      
Query: 257 gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggag 315
           ||||| | |||||||||||||||||||||||||||||| ||||| || || ||||||||
Sbjct: 335 gcgcacaagttggtgtcctcgaagagcccgacgaggtaagcctcagcggcttcctggag 277

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  165 bits (83), Expect = 1e-37
 Identities = 146/167 (87%)
 Strand = Plus / Plus

                                                                            
Query: 178      aacctaggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 237
                |||||||||| ||||||| | ||||| ||| |||||||||||||||||||||||||||||
Sbjct: 12836776 aacctaggccttctcgcccccgatgcagcgtgcgagctggatgtccttgggcatgatggt 12836835

                                                                            
Query: 238      gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgc 297
                |||||| ||||| |||||| | |||||||||||||||||||||||||| || ||||| | 
Sbjct: 12836836 gacgcgtttggcatggatgacacagaggttggtgtcctcgaagagccccacaaggtaggt 12836895

                                                               
Query: 298      ctcggctgcctcctggagcgcggagacggcggagctctggaagcgga 344
                |||||| |||||||| ||| | |  | ||| ||||||||||||||||
Sbjct: 12836896 ctcggcagcctcctgcagcactgccatggcagagctctggaagcgga 12836942



 Score =  161 bits (81), Expect = 2e-36
 Identities = 144/165 (87%)
 Strand = Plus / Plus

                                                                            
Query: 178      aacctaggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 237
                |||||||||| ||||||| | ||||||||| |||||||||||||||||||||||||||||
Sbjct: 12852332 aacctaggccttctcgcccctgatgcggcgcgcgagctggatgtccttgggcatgatggt 12852391

                                                                            
Query: 238      gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgc 297
                |||||| ||||| |||||  | |||||||||||||||| ||||||||| || ||||| | 
Sbjct: 12852392 gacgcgtttggcatggataacacagaggttggtgtccttgaagagccccacaaggtaggt 12852451

                                                             
Query: 298      ctcggctgcctcctggagcgcggagacggcggagctctggaagcg 342
                |||||| |||||||| |||||    ||||| ||||||||||||||
Sbjct: 12852452 ctcggcagcctcctgcagcgcaaccacggcagagctctggaagcg 12852496

---

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  165 bits (83), Expect = 1e-37
 Identities = 146/167 (87%)
 Strand = Plus / Plus

                                                                            
Query: 178      aacctaggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 237
                |||||||||| ||||||| | ||||| ||| |||||||||||||||||||||||||||||
Sbjct: 12791050 aacctaggccttctcgcccccgatgcagcgtgcgagctggatgtccttgggcatgatggt 12791109

                                                                            
Query: 238      gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgc 297
                |||||| ||||| |||||| | |||||||||||||||||||||||||| || ||||| | 
Sbjct: 12791110 gacgcgtttggcatggatgacacagaggttggtgtcctcgaagagccccacaaggtaggt 12791169

                                                               
Query: 298      ctcggctgcctcctggagcgcggagacggcggagctctggaagcgga 344
                |||||| |||||||| ||| | |  | ||| ||||||||||||||||
Sbjct: 12791170 ctcggcagcctcctgcagcactgccatggcagagctctggaagcgga 12791216



 Score =  161 bits (81), Expect = 2e-36
 Identities = 144/165 (87%)
 Strand = Plus / Plus

                                                                            
Query: 178      aacctaggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 237
                |||||||||| ||||||| | ||||||||| |||||||||||||||||||||||||||||
Sbjct: 12806606 aacctaggccttctcgcccctgatgcggcgcgcgagctggatgtccttgggcatgatggt 12806665

                                                                            
Query: 238      gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgc 297
                |||||| ||||| |||||  | |||||||||||||||| ||||||||| || ||||| | 
Sbjct: 12806666 gacgcgtttggcatggataacacagaggttggtgtccttgaagagccccacaaggtaggt 12806725

                                                             
Query: 298      ctcggctgcctcctggagcgcggagacggcggagctctggaagcg 342
                |||||| |||||||| |||||    ||||| ||||||||||||||
Sbjct: 12806726 ctcggcagcctcctgcagcgcaaccacggcagagctctggaagcg 12806770

---

>emb|AL844879.5|CNS08CB2 Oryza sativa chromosome 12, . BAC OSJNBa0036H15 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 156724

 Score =  165 bits (83), Expect = 1e-37
 Identities = 146/167 (87%)
 Strand = Plus / Minus

                                                                         
Query: 178   aacctaggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 237
             |||||||||| ||||||| | ||||| ||| |||||||||||||||||||||||||||||
Sbjct: 82451 aacctaggccttctcgcccccgatgcagcgtgcgagctggatgtccttgggcatgatggt 82392

                                                                         
Query: 238   gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgc 297
             |||||| ||||| |||||| | |||||||||||||||||||||||||| || ||||| | 
Sbjct: 82391 gacgcgtttggcatggatgacacagaggttggtgtcctcgaagagccccacaaggtaggt 82332

                                                            
Query: 298   ctcggctgcctcctggagcgcggagacggcggagctctggaagcgga 344
             |||||| |||||||| ||| | |  | ||| ||||||||||||||||
Sbjct: 82331 ctcggcagcctcctgcagcactgccatggcagagctctggaagcgga 82285



 Score =  161 bits (81), Expect = 2e-36
 Identities = 144/165 (87%)
 Strand = Plus / Minus

                                                                         
Query: 178   aacctaggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 237
             |||||||||| ||||||| | ||||||||| |||||||||||||||||||||||||||||
Sbjct: 66895 aacctaggccttctcgcccctgatgcggcgcgcgagctggatgtccttgggcatgatggt 66836

                                                                         
Query: 238   gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgc 297
             |||||| ||||| |||||  | |||||||||||||||| ||||||||| || ||||| | 
Sbjct: 66835 gacgcgtttggcatggataacacagaggttggtgtccttgaagagccccacaaggtaggt 66776

                                                          
Query: 298   ctcggctgcctcctggagcgcggagacggcggagctctggaagcg 342
             |||||| |||||||| |||||    ||||| ||||||||||||||
Sbjct: 66775 ctcggcagcctcctgcagcgcaaccacggcagagctctggaagcg 66731

---

>ref|NM_019469.1| Mus musculus histone 2, H3c1 (Hist2h3c1), transcript variant 1,
           mRNA
          Length = 411

 Score =  163 bits (82), Expect = 5e-37
 Identities = 139/158 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
           |||||||||||||| | |||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 395 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgcatg 336

                                                                       
Query: 257 gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
           ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 335 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 276

                                                 
Query: 317 gcggagacggcggagctctggaagcggaggtcggtctt 354
           ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 275 gccatgacggccgagctctggaagcgcaggtccgtctt 238

---

>ref|XM_518299.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC462506),
           mRNA
          Length = 792

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           ||||||||||||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 788 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 729

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||| ||||||||||| |||||||||||||| |||||||| || ||||| ||||||  |
Sbjct: 728 ttggcatggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 669

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||||| || |||||    || ||||||||||||||||| |||||||||||
Sbjct: 668 gcctcttgcagcgccatcaccgcggagctctggaagcgcaggtcggtctt 619

---

>gb|L19706.1| Rattus norvegicus H3 histone gene, complete cds
          Length = 2040

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Minus

                                                                        
Query: 185  gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
            ||||||||||| || ||||||||||| |||||||||||||||||||||||||| || |||
Sbjct: 1923 gccctctcgccacgaatgcggcgggccagctggatgtccttgggcatgatggtcacacgc 1864

                                                                        
Query: 245  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
            ||||||||||||||||| |||||||||||||| || || || || ||||| |||||    
Sbjct: 1863 ttggcgtggatggcgcataggttggtgtcctcaaacagacccacaaggtaggcctcacag 1804

                                                              
Query: 305  gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
            |||||||| |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 1803 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtctt 1754

---

>gb|BC062305.1| Homo sapiens cDNA clone IMAGE:3162462
          Length = 2706

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Minus

                                                                        
Query: 185  gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
            ||||||||||||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 2289 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 2230

                                                                        
Query: 245  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
            ||||||||||||||||| |||||||||||||| |||||||| || ||||| ||||||  |
Sbjct: 2229 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 2170

                                                              
Query: 305  gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
            ||||| || |||||    || ||||||||||||||||| | |||||||||
Sbjct: 2169 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtctt 2120

---

>gb|BC015270.1| Mus musculus histone 2, H3c2, mRNA (cDNA clone MGC:18559
           IMAGE:4240748), complete cds
          Length = 1124

 Score =  163 bits (82), Expect = 5e-37
 Identities = 139/158 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
           |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 581 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 522

                                                                       
Query: 257 gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
           ||||| ||||||||||||||||| ||||| || || || ||||||   |||||||| |||
Sbjct: 521 gcgcacaggttggtgtcctcgaacagccccaccagataggcctcgctcgcctcctgcagc 462

                                                 
Query: 317 gcggagacggcggagctctggaagcggaggtcggtctt 354
           ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 461 gccatgacggccgagctctggaagcgcaggtccgtctt 424

---

>gb|BC007518.2| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC:4577
           IMAGE:3030790), complete cds
          Length = 1387

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           ||||||||||||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 545 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 486

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| |||||||| || ||||| ||||||  |
Sbjct: 485 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 426

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||||| || |||||    || ||||||||||||||||| | |||||||||
Sbjct: 425 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtctt 376

---

>ref|NM_054045.2| Mus musculus histone 2, H3c2 (Hist2h3c2), mRNA
          Length = 1124

 Score =  163 bits (82), Expect = 5e-37
 Identities = 139/158 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
           |||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 581 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 522

                                                                       
Query: 257 gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
           ||||| ||||||||||||||||| ||||| || || || ||||||   |||||||| |||
Sbjct: 521 gcgcacaggttggtgtcctcgaacagccccaccagataggcctcgctcgcctcctgcagc 462

                                                 
Query: 317 gcggagacggcggagctctggaagcggaggtcggtctt 354
           ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 461 gccatgacggccgagctctggaagcgcaggtccgtctt 424

---

>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6
          Length = 91567

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Plus

                                                                         
Query: 185   gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
             ||||||||||||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 83972 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 84031

                                                                         
Query: 245   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
             ||||||||||||||||| |||||||||||||| |||||||| || ||||| ||||||  |
Sbjct: 84032 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 84091

                                                               
Query: 305   gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
             ||||| || |||||    || ||||||||||||||||| | |||||||||
Sbjct: 84092 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtctt 84141



 Score =  107 bits (54), Expect = 2e-20
 Identities = 141/170 (82%)
 Strand = Plus / Minus

                                                                         
Query: 185   gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
             |||||||| || ||||||||||| || ||||||||||| || ||||| || |||||||| 
Sbjct: 22543 gccctctcccctcggatgcggcgcgcaagctggatgtctttaggcataatagtgacgcgt 22484

                                                                         
Query: 245   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
             |||||||| |||||||| |||||||| ||||| || ||||| || ||||| ||||||   
Sbjct: 22483 ttggcgtgaatggcgcacaggttggtatcctcaaatagccccaccaggtaggcctcgcaa 22424

                                                               
Query: 305   gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
             |||||||| |||||    || || |||||||||||||| || ||||||||
Sbjct: 22423 gcctcctgcagcgccatcaccgccgagctctggaagcgcagatcggtctt 22374



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 190  ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
            |||||| ||||| || || || |||||||||||||| ||||| || ||||| ||||||||
Sbjct: 4061 ctcgccacggatacgacgcgcaagctggatgtccttaggcataatagtgacacgcttggc 4002

                                             
Query: 250  gtggatggcgcagaggttggtgtcctcgaagag 282
            ||| || || |||||||||||||| || |||||
Sbjct: 4001 gtgaatagcacagaggttggtgtcttcaaagag 3969

---

>ref|NM_003536.2| Homo sapiens histone 1, H3h (HIST1H3H), mRNA
          Length = 473

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           ||||||||||||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 417 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 358

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| |||||||| || ||||| ||||||  |
Sbjct: 357 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 298

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||||| || |||||    || ||||||||||||||||| | |||||||||
Sbjct: 297 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtctt 248

---

>gb|AF531281.1| Homo sapiens histone H3 (HIST1H3H) gene, complete cds
          Length = 1227

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           ||||||||||||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 817 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 758

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| |||||||| || ||||| ||||||  |
Sbjct: 757 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 698

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||||| || |||||    || ||||||||||||||||| | |||||||||
Sbjct: 697 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtctt 648

---

>emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 on chromosome 6p21.3-22.2
              Contains a novel pseudogene, a 60S Ribosomal protein L30
              (RPL30) pseudogene, H4 histone family member F pseudogene
              H4FFP and histone genes H2BFC, H2AFC, H3FK. Contains ESTs,
              STSs, GSSs and two CpG islands, complete sequence
          Length = 139904

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Minus

                                                                          
Query: 185    gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
              ||||||||||||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 138631 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 138572

                                                                          
Query: 245    ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
              ||||||||||||||||| |||||||||||||| |||||||| || ||||| ||||||  |
Sbjct: 138571 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 138512

                                                                
Query: 305    gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
              ||||| || |||||    || ||||||||||||||||| | |||||||||
Sbjct: 138511 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtctt 138462

---

>emb|Z30939.1|MDH3HIST Mus domesticus partial mRNA for histone H3, CD-1
          Length = 287

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| || || ||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 173 gccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 114

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || |||||||| ||||||   
Sbjct: 113 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 54

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 53  gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 4

---

>emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, histone H3 and histone H1.1
          Length = 5597

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Plus

                                                                        
Query: 185  gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
            |||||||| ||||||||||||||||| || |||||||||||||||||||||||||| |||
Sbjct: 2130 gccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgc 2189

                                                                        
Query: 245  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
            ||||||||||||||||| |||||||||||||| || || || || ||||| |||||    
Sbjct: 2190 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacag 2249

                                                              
Query: 305  gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
            |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 2250 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 2299

---

>emb|X80324.1|MPMPH3110 M.pahari mpH3110 gene
          Length = 990

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||| |||||||||||||| |||||||||||||| |||
Sbjct: 847 gccctctccccgcggatgcggcgggccagctggatgtccttaggcatgatggtgacacgc 788

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| |||||    
Sbjct: 787 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacag 728

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 727 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 678

---

>emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes
          Length = 3098

 Score =  163 bits (82), Expect = 5e-37
 Identities = 139/158 (87%)
 Strand = Plus / Minus

                                                                        
Query: 197  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
            |||||||||||||| | |||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 2567 cggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgcatg 2508

                                                                        
Query: 257  gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
            ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 2507 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 2448

                                                  
Query: 317  gcggagacggcggagctctggaagcggaggtcggtctt 354
            ||   |||||| |||||||||||||| ||||| |||||
Sbjct: 2447 gccatgacggccgagctctggaagcgcaggtccgtctt 2410

---

>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3
            and H4
          Length = 8592

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Plus

                                                                        
Query: 185  gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
            |||||||| || ||||| | |||||| ||||||||||||||||||||||||||||| | |
Sbjct: 5556 gccctctctcctcggatcctgcgggccagctggatgtccttgggcatgatggtgactctc 5615

                                                                        
Query: 245  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
            ||||||||||||||||| ||||||||||||||||||||||| || || || ||||||   
Sbjct: 5616 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccagataagcctcgctg 5675

                                                              
Query: 305  gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
            |||||||| || ||   |||||| ||||||||||||||||| ||||||||
Sbjct: 5676 gcctcctgcagagccatgacggctgagctctggaagcggagatcggtctt 5725

---

>gb|BC096130.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC:116776
           IMAGE:40002510), complete cds
          Length = 463

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           ||||||||||||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 407 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 348

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| |||||||| || ||||| ||||||  |
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 288

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||||| || |||||    || ||||||||||||||||| | |||||||||
Sbjct: 287 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtctt 238

---

>gb|BC096128.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC:116774
           IMAGE:40002508), complete cds
          Length = 463

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           ||||||||||||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 407 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 348

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| |||||||| || ||||| ||||||  |
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 288

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||||| || |||||    || ||||||||||||||||| | |||||||||
Sbjct: 287 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtctt 238

---

>gb|BC096129.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC:116775
           IMAGE:40002509), complete cds
          Length = 463

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           ||||||||||||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 407 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 348

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| |||||||| || ||||| ||||||  |
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 288

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||||| || |||||    || ||||||||||||||||| | |||||||||
Sbjct: 287 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtctt 238

---

>emb|Z83735.1|HSZ83735 H.sapiens hH3/k gene
          Length = 819

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           ||||||||||||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 726 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 667

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| |||||||| || ||||| ||||||  |
Sbjct: 666 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 607

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||||| || |||||    || ||||||||||||||||| | |||||||||
Sbjct: 606 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtctt 557

---

>dbj|AK006742.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700049H14 product:H3 HISTONE homolog
           [Rattus norvegicus], full insert sequence
          Length = 514

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||| || |||||||||||||||||||||||||| |||
Sbjct: 420 gccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgc 361

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| |||||    
Sbjct: 360 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacag 301

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 300 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 251

---

>gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and histone H4-D (H4-D) genes,
           complete cds
          Length = 2321

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||| || |||||||||||||||||||||||||| |||
Sbjct: 758 gccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgc 699

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| |||||    
Sbjct: 698 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacag 639

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 638 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 589

---

>ref|NM_067207.3| Caenorhabditis elegans HIStone family member (his-72) (his-72)
           mRNA, complete cds
          Length = 634

 Score =  163 bits (82), Expect = 5e-37
 Identities = 112/122 (91%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||| | |||||| || |||||||| |||||||||||||||||||||||||||
Sbjct: 407 ccgcggatgcgtctggcgagttgcatgtcctttggcatgatggtgacgcgcttggcgtgg 348

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| |||||||||||||||||||| |||||||||||||| || | ||||||||||
Sbjct: 347 atggcgcacaggttggtgtcctcgaagagtccgacgaggtatgcttcagatgcctcctgg 288

             
Query: 314 ag 315
           ||
Sbjct: 287 ag 286

---

>ref|NM_001013056.1| Rattus norvegicus histone 1, H2ai (predicted)
           (Hist1h2ai_predicted), mRNA
          Length = 411

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           ||||||||||| || ||||||||||| |||||||||||||||||||||||||| || |||
Sbjct: 407 gccctctcgccacgaatgcggcgggccagctggatgtccttgggcatgatggtcacacgc 348

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| |||||    
Sbjct: 347 ttggcgtggatggcgcataggttggtgtcctcaaacagacccacaaggtaggcctcacag 288

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| |||||   |||||| |||||||||||||| |||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtctt 238

---

>gb|AY158952.1| Mus musculus histone protein Hist1h3a gene, complete cds
          Length = 1408

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||| || |||||||||||||||||||||||||| |||
Sbjct: 907 gccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgc 848

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| |||||    
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacag 788

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 787 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 738

---

>emb|X85102.1|OSRNAHIS3 O.sativa mRNA for histone H3
          Length = 274

 Score =  163 bits (82), Expect = 5e-37
 Identities = 88/90 (97%)
 Strand = Plus / Minus

                                                                       
Query: 190 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 90  ctcgccgcggatccggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 31

                                         
Query: 250 gtggatggcgcagaggttggtgtcctcgaa 279
           |||||||||||| |||||||||||||||||
Sbjct: 30  gtggatggcgcacaggttggtgtcctcgaa 1

---

>emb|CR760429.2| Xenopus tropicalis finished cDNA, clone TNeu057j11
          Length = 538

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           ||||||||||| ||||| | |||||| ||||||||||||||||||||||||||||| | |
Sbjct: 425 gccctctcgcctcggatcctgcgggccagctggatgtccttgggcatgatggtgaccctc 366

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| ||||| ||||| || || ||||||   
Sbjct: 365 ttggcgtggatggcgcacaggttggtgtcctcaaagagaccgaccagataagcctcgctg 306

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 305 gcctcctgcagagccatgacggctgagctctggaagcgcaggtcggtctt 256

---

>gb|AY749755.1| Griseargiolestes albescens histone H3 (H3) gene, partial cds
          Length = 361

 Score =  163 bits (82), Expect = 5e-37
 Identities = 118/130 (90%)
 Strand = Plus / Minus

                                                                       
Query: 225 tgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcc 284
           |||||||||||||||||||||| |||||||| ||||| |||||||||||||||||||| |
Sbjct: 361 tgggcatgatggtgacgcgcttagcgtggattgcgcacaggttggtgtcctcgaagagac 302

                                                                       
Query: 285 cgacgaggtatgcctcggctgcctcctggagcgcggagacggcggagctctggaagcgga 344
           |||||||||| ||||||   ||||||||||| ||   |||||||||||||||||||||||
Sbjct: 301 cgacgaggtaagcctcgctggcctcctggagtgccatgacggcggagctctggaagcgga 242

                     
Query: 345 ggtcggtctt 354
           ||||||||||
Sbjct: 241 ggtcggtctt 232

---

>gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and
            histone H3 gene, 3' end, gene cluster X1h3
          Length = 8608

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Plus

                                                                        
Query: 185  gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
            |||||||| || ||||| | |||||| ||||||||||||||||||||||||||||| | |
Sbjct: 5573 gccctctctcctcggatcctgcgggccagctggatgtccttgggcatgatggtgactctc 5632

                                                                        
Query: 245  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
            ||||||||||||||||| ||||||||||||||||||||||| || || || ||||||   
Sbjct: 5633 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccagataagcctcgctg 5692

                                                              
Query: 305  gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
            |||||||| || ||   |||||| ||||||||||||||||| ||||||||
Sbjct: 5693 gcctcctgcagagccatgacggctgagctctggaagcggagatcggtctt 5742

---

>gb|M33989.1|MUSH2AX1X Mouse histone H3.2 gene, complete cds
          Length = 693

 Score =  163 bits (82), Expect = 5e-37
 Identities = 148/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| || || ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 557 gccctctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 498

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| ||||||   
Sbjct: 497 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 438

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   ||| || |||||||||||||| |||||||||||
Sbjct: 437 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtctt 388

---

>gb|J01175.1|SULHISL34 Sea urchin (L.pictus) late-stage histone H3 and H4 genes
          Length = 2133

 Score =  163 bits (82), Expect = 5e-37
 Identities = 142/162 (87%)
 Strand = Plus / Minus

                                                                        
Query: 190  ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
            |||||| ||||| |||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1915 ctcgccacggatacggcgggcaagctggatgtccttgggcatgatggtgacacgcttggc 1856

                                                                        
Query: 250  gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
            |||||||||||| |||||||||||||||||||| ||||| | ||| || ||    |||||
Sbjct: 1855 gtggatggcgcaaaggttggtgtcctcgaagagaccgaccaagtaagcttccctggcctc 1796

                                                      
Query: 310  ctggagcgcggagacggcggagctctggaagcggaggtcggt 351
             ||||| ||   |||||||||||||||||||||||| |||||
Sbjct: 1795 ttggagggccatgacggcggagctctggaagcggagctcggt 1754

---

>emb|Z98866.1|CEY49E10 Caenorhabditis elegans YAC Y49E10, complete sequence
          Length = 125590

 Score =  161 bits (81), Expect = 2e-36
 Identities = 111/121 (91%)
 Strand = Plus / Plus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||| | |||||| || |||||||| |||||||||||||||||||||||||||
Sbjct: 297 ccgcggatgcgtctggcgagttgcatgtcctttggcatgatggtgacgcgcttggcgtgg 356

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| |||||||||||||||||||| |||||||||||||| || | ||||||||||
Sbjct: 357 atggcgcacaggttggtgtcctcgaagagtccgacgaggtatgcttcagatgcctcctgg 416

            
Query: 314 a 314
           |
Sbjct: 417 a 417

---

>ref|XM_683134.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC559765), mRNA
          Length = 411

 Score =  161 bits (81), Expect = 2e-36
 Identities = 132/149 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||| ||||||||||| ||||||||||||||||| | ||||||||||
Sbjct: 398 ccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggcgtgg 339

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||||||||||||||| || ||||| || || ||||||  ||||||||| 
Sbjct: 338 atggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgcttgcctcctga 279

                                        
Query: 314 agcgcggagacggcggagctctggaagcg 342
           || ||   |||||||||||||||||||||
Sbjct: 278 agagccatgacggcggagctctggaagcg 250

---

>ref|XM_227460.3| PREDICTED: Rattus norvegicus histone 2, H3c2 (predicted)
           (Hist2h3c2_predicted), mRNA
          Length = 411

 Score =  161 bits (81), Expect = 2e-36
 Identities = 141/161 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||| ||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 398 ccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 339

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||||||||||||||| || || || ||||| ||||||   |||||||| 
Sbjct: 338 atggcgcacaggttggtgtcctcgaacagacccaccaggtaggcctcgctcgcctcctgc 279

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||   |||||| |||||||||||||| ||||| |||||
Sbjct: 278 agcgccatgacggccgagctctggaagcgcaggtccgtctt 238

---

>emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 in linkage group 25,
              complete sequence
          Length = 167326

 Score =  161 bits (81), Expect = 2e-36
 Identities = 132/149 (88%)
 Strand = Plus / Plus

                                                                          
Query: 194    ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
              ||||||||||||||||| ||||||||||| ||||||||||||||||| | ||||||||||
Sbjct: 116397 ccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggcgtgg 116456

                                                                          
Query: 254    atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
              |||||||| ||||||||||||||||| || ||||| || || ||||||  ||||||||| 
Sbjct: 116457 atggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgcttgcctcctga 116516

                                           
Query: 314    agcgcggagacggcggagctctggaagcg 342
              || ||   |||||||||||||||||||||
Sbjct: 116517 agagccatgacggcggagctctggaagcg 116545



 Score =  153 bits (77), Expect = 5e-34
 Identities = 131/149 (87%)
 Strand = Plus / Plus

                                                                         
Query: 194   ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
             ||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||
Sbjct: 79282 ccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttggcgtgg 79341

                                                                         
Query: 254   atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
             |||||||| ||||||||||||||||| || ||||| || || ||||||   | |||||| 
Sbjct: 79342 atggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctggactcctga 79401

                                          
Query: 314   agcgcggagacggcggagctctggaagcg 342
             || ||   |||||||||||||||||||||
Sbjct: 79402 agagccatgacggcggagctctggaagcg 79430



 Score =  145 bits (73), Expect = 1e-31
 Identities = 130/149 (87%)
 Strand = Plus / Minus

                                                                         
Query: 194   ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
             ||||||||||||||||| ||||||||||| ||||||||||||||||| | ||||||||||
Sbjct: 63673 ccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggcgtgg 63614

                                                                         
Query: 254   atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
             |||||||| ||||||||||||||||| || ||||| || || ||||||   | |||||| 
Sbjct: 63613 atggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctggactcctga 63554

                                          
Query: 314   agcgcggagacggcggagctctggaagcg 342
             || ||   |||||||||||||||||||||
Sbjct: 63553 agagccatgacggcggagctctggaagcg 63525



 Score =  137 bits (69), Expect = 3e-29
 Identities = 129/149 (86%)
 Strand = Plus / Plus

                                                                         
Query: 194   ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
             ||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||
Sbjct: 99233 ccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttggcgtgg 99292

                                                                         
Query: 254   atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
             |||||||| ||||| ||||||||||| || ||||| || || || |||   | |||||| 
Sbjct: 99293 atggcgcacaggttagtgtcctcgaacagaccgaccagataagcttcgctggactcctga 99352

                                          
Query: 314   agcgcggagacggcggagctctggaagcg 342
             || ||   |||||||||||||||||||||
Sbjct: 99353 agagccatgacggcggagctctggaagcg 99381



 Score =  137 bits (69), Expect = 3e-29
 Identities = 129/149 (86%)
 Strand = Plus / Plus

                                                                         
Query: 194   ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
             ||||||||||||||||| ||||||||||| ||||||||||||||||| | ||||||||||
Sbjct: 85981 ccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggcgtgg 86040

                                                                         
Query: 254   atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
             |||||||| ||||||||||||||||| || ||||| || || || |||   | |||||| 
Sbjct: 86041 atggcgcacaggttggtgtcctcgaacagaccgaccagataagcttcgctggactcctga 86100

                                          
Query: 314   agcgcggagacggcggagctctggaagcg 342
             || ||   |||||||||||||||||||||
Sbjct: 86101 agagccatgacggcggagctctggaagcg 86129

---

>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4
           (ch4-III), histone H2B (ch2b-III) and histone H2A
           (ch2a-III) genes, complete cds
          Length = 4582

 Score =  161 bits (81), Expect = 2e-36
 Identities = 144/165 (87%)
 Strand = Plus / Plus

                                                                       
Query: 190 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
           |||||| |||||||||||||| |||||||||||||||||||||||||| || ||||||||
Sbjct: 473 ctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcacacgcttggc 532

                                                                       
Query: 250 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
           |||||||||||| ||||||||||||||||| || || || ||||| ||||| || |||||
Sbjct: 533 gtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaggcctcagcggcctc 592

                                                        
Query: 310 ctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||| |||||    |||||   |||||||||||| |||||||||||
Sbjct: 593 ctgcagcgccagcacggcctggctctggaagcgcaggtcggtctt 637

---

>gb|M14396.1|CIIHISH3A Duck H3.4 variant histone gene
          Length = 921

 Score =  161 bits (81), Expect = 2e-36
 Identities = 141/161 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           |||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |||
Sbjct: 738 ccgcggatgcggcgggtgagctggatgtccttgggcatgatggagacgcgcttggcatgg 679

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           ||||||||||||||||||||||| |||||||| || ||||| ||||||   |||||||| 
Sbjct: 678 atggcgcagaggttggtgtcctcaaagagccccaccaggtaggcctcgctggcctcctgc 619

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           || ||    ||||| || ||||||||||| || ||||||||
Sbjct: 618 agtgccatcacggctgaactctggaagcgcagatcggtctt 578

---

>ref|XM_781054.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC581030), mRNA
          Length = 411

 Score =  159 bits (80), Expect = 7e-36
 Identities = 143/164 (87%)
 Strand = Plus / Minus

                                                                       
Query: 191 tcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcg 250
           ||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||||||||
Sbjct: 401 tcgccacggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcg 342

                                                                       
Query: 251 tggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcc 310
           ||||||||||| |||||||||||||||||||| ||||| | ||| || |||   ||||||
Sbjct: 341 tggatggcgcacaggttggtgtcctcgaagagaccgaccaagtaggcttcgctagcctcc 282

                                                       
Query: 311 tggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           || || ||   |||||| ||||||||||| ||||| ||||||||
Sbjct: 281 tgaagagccatgacggcagagctctggaatcggagctcggtctt 238

---

>gb|U38422.1|TAU38422 Triticum aestivum histone H3 gene, partial cds, clone W1
          Length = 479

 Score =  159 bits (80), Expect = 7e-36
 Identities = 98/104 (94%)
 Strand = Plus / Minus

                                                                       
Query: 212 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtg 271
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 479 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 420

                                                       
Query: 272 tcctcgaagagcccgacgaggtatgcctcggctgcctcctggag 315
           |||||||| ||||| || ||||| |||||||| |||||||||||
Sbjct: 419 tcctcgaacagccccaccaggtacgcctcggccgcctcctggag 376

---

>gb|U38420.1|HVU38420 Hordeum vulgare histone H3 gene, partial cds, clone B1
          Length = 494

 Score =  159 bits (80), Expect = 7e-36
 Identities = 98/104 (94%)
 Strand = Plus / Minus

                                                                       
Query: 212 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtg 271
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 494 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 435

                                                       
Query: 272 tcctcgaagagcccgacgaggtatgcctcggctgcctcctggag 315
           |||||||| ||||||   |||||||||||||| |||||||||||
Sbjct: 434 tcctcgaacagcccgcgaaggtatgcctcggcagcctcctggag 391

---

>ref|XM_868935.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC616819), mRNA
          Length = 411

 Score =  157 bits (79), Expect = 3e-35
 Identities = 145/167 (86%)
 Strand = Plus / Minus

                                                                       
Query: 188 ctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 247
           ||||| |||||||||||||| || ||||||||||||||||||||||| ||||||||||||
Sbjct: 404 ctctccccgcggatgcggcgagcaagctggatgtccttgggcatgatagtgacgcgcttg 345

                                                                       
Query: 248 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcc 307
           ||||||||||| || ||||||||||| ||||||||||| || || || ||||||   |||
Sbjct: 344 gcgtggatggcacacaggttggtgtcttcgaagagccccaccagataggcctcgcacgcc 285

                                                          
Query: 308 tcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||||| |||||    ||||| |||||||||||||| ||||| |||||
Sbjct: 284 tcctgcagcgccatcacggccgagctctggaagcgcaggtcagtctt 238

---

>ref|NM_013550.3| Mus musculus histone 1, H3a (Hist1h3a), mRNA
          Length = 535

 Score =  155 bits (78), Expect = 1e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||| || |||||||||||||||||||||||||| |||
Sbjct: 441 gccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgc 382

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| |||||    
Sbjct: 381 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacag 322

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| |  ||   |||||| |||||||||||||| |||||||||||
Sbjct: 321 gcctcctgcaaagccatgacggccgagctctggaagcgcaggtcggtctt 272

---

>gb|BC107287.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMAGE:40053019),
           partial cds
          Length = 415

 Score =  155 bits (78), Expect = 1e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||| ||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 403 gccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 344

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || |||||||| |||||    
Sbjct: 343 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 284

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   ||| || |||||||||||||| |||||||||||
Sbjct: 283 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtctt 234

---

>ref|NM_178204.1| Mus musculus histone1, H3d (Hist1h3d), mRNA
          Length = 411

 Score =  155 bits (78), Expect = 1e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| || || ||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 407 gccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 348

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           |||||||||||||| || |||||||||||||| || || || |||||||| ||||||   
Sbjct: 347 ttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 288

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 287 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 238

---

>ref|XM_868913.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC616800), mRNA
          Length = 411

 Score =  155 bits (78), Expect = 1e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| |||||||||||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 407 gccctctccccgcggatgcggcgagcaagctggatgtccttgggcatgatagtgacgcgc 348

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           |||||||||||||| || ||||||||||| ||||||||||| || || || ||||||   
Sbjct: 347 ttggcgtggatggcacacaggttggtgtcttcgaagagccccaccagataggcctcgcac 288

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| |||||    || || ||||||||||| || |||||||||||
Sbjct: 287 gcctcctgcagcgccatcactgccgagctctggaaacgcaggtcggtctt 238

---

>emb|X58895.1|UCHISTO U.caupo gene for H2A, H2B, H3, and H4 histones
          Length = 4942

 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Minus

                                                                       
Query: 190 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
           |||||| ||||| || | ||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 747 ctcgccacggatacgtctggccagctggatgtccttgggcatgatggtgacacgcttggc 688

                                                                       
Query: 250 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
           |||||||||||| |||||||||||||||||||| ||||| | ||| ||||||   |||||
Sbjct: 687 gtggatggcgcacaggttggtgtcctcgaagagaccgaccaagtaggcctcgctagcctc 628

                                                     
Query: 310 ctggagcgcggagacggcggagctctggaagcggaggtcggt 351
           ||| || ||   |||||||||||||||||| || ||||||||
Sbjct: 627 ctgaagggccatgacggcggagctctggaaacgcaggtcggt 586

---

>gb|AY125232.1| Pterophylla camellifolia histone 3 gene, partial cds
          Length = 372

 Score =  155 bits (78), Expect = 1e-34
 Identities = 120/134 (89%)
 Strand = Plus / Minus

                                                                       
Query: 221 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 280
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcttcgaag 309

                                                                       
Query: 281 agcccgacgaggtatgcctcggctgcctcctggagcgcggagacggcggagctctggaag 340
           || ||||| ||||| ||||||   |||||||| |||||   |||||||||||||||||| 
Sbjct: 308 aggccgacaaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaac 249

                         
Query: 341 cggaggtcggtctt 354
           |||||||| |||||
Sbjct: 248 cggaggtccgtctt 235

---

>emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for histones H3 and H4
          Length = 1898

 Score =  155 bits (78), Expect = 1e-34
 Identities = 120/134 (89%)
 Strand = Plus / Minus

                                                                        
Query: 185  gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
            |||| |||||| || |||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 1510 gcccgctcgccacgaatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 1451

                                                                        
Query: 245  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
            ||||||||||||||||| |||||||| |||||||| || || || ||||| |||||||| 
Sbjct: 1450 ttggcgtggatggcgcacaggttggtatcctcgaacaggcccaccaggtaggcctcggca 1391

                          
Query: 305  gcctcctggagcgc 318
            |||||||| |||||
Sbjct: 1390 gcctcctgcagcgc 1377

---

>dbj|AK155722.1| Mus musculus B6-derived CD11 +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F730210F11
           product:histone 1, H3h, full insert sequence
          Length = 1806

 Score =  155 bits (78), Expect = 1e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||| ||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 435 gccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 376

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || |||||||| |||||    
Sbjct: 375 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 316

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   ||| || |||||||||||||| |||||||||||
Sbjct: 315 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtctt 266

---

>gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016
          Length = 2110

 Score =  155 bits (78), Expect = 1e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                        
Query: 185  gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
            |||||||| || || ||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 2008 gccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 1949

                                                                        
Query: 245  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
            |||||||||||||| || |||||||||||||| || || || |||||||| ||||||   
Sbjct: 1948 ttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 1889

                                                              
Query: 305  gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
            |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 1888 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 1839

---

>gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108
          Length = 2221

 Score =  155 bits (78), Expect = 1e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                        
Query: 185  gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
            |||||||| || || ||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 2006 gccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 1947

                                                                        
Query: 245  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
            |||||||||||||| || |||||||||||||| || || || |||||||| ||||||   
Sbjct: 1946 ttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 1887

                                                              
Query: 305  gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
            |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 1886 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 1837

---

>gb|U62670.1|MMU62670 Mus musculus histone H3.1-I (H3-I) gene, complete cds
          Length = 727

 Score =  155 bits (78), Expect = 1e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||| ||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 553 gccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 494

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || |||||||| |||||    
Sbjct: 493 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 434

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   ||| || |||||||||||||| |||||||||||
Sbjct: 433 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtctt 384

---

>gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone H2a.1-F (H2a-F),
           histone H2b-F (H2b-F) genes, complete cds
          Length = 2822

 Score =  155 bits (78), Expect = 1e-34
 Identities = 147/170 (86%)
 Strand = Plus / Plus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| || || ||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 91  gccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 150

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           |||||||||||||| || |||||||||||||| || || || |||||||| ||||||   
Sbjct: 151 ttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 210

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 211 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 260

---

>dbj|AK018952.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700111A06 product:H3 HISTONE homolog
           [Rattus norvegicus], full insert sequence
          Length = 535

 Score =  155 bits (78), Expect = 1e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||| || |||||||||||||||||||||||||| |||
Sbjct: 441 gccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgc 382

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || || ||||| |||||    
Sbjct: 381 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacag 322

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| |  ||   |||||| |||||||||||||| |||||||||||
Sbjct: 321 gcctcctgcaaagccatgacggccgagctctggaagcgcaggtcggtctt 272

---

>gb|AY158949.1| Mus musculus histone protein Hist1h3d gene, complete cds
          Length = 2249

 Score =  155 bits (78), Expect = 1e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| || || ||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 946 gccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 887

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           |||||||||||||| || |||||||||||||| || || || |||||||| ||||||   
Sbjct: 886 ttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 827

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   |||||| |||||||||||||| |||||||||||
Sbjct: 826 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtctt 777

---

>gb|AY158945.1| Mus musculus histone protein Hist1h3i gene, complete cds
          Length = 1408

 Score =  155 bits (78), Expect = 1e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||| ||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 907 gccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 848

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || |||||||| |||||    
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 788

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   ||| || |||||||||||||| |||||||||||
Sbjct: 787 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtctt 738

---

>ref|NM_178207.2| Mus musculus histone 1, H3i (Hist1h3i), mRNA
          Length = 483

 Score =  155 bits (78), Expect = 1e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||| ||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 434 gccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 375

                                                                       
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
           ||||||||||||||||| |||||||||||||| || || || |||||||| |||||    
Sbjct: 374 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 315

                                                             
Query: 305 gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           |||||||| || ||   ||| || |||||||||||||| |||||||||||
Sbjct: 314 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtctt 265

---

>gb|AY749744.1| Dipteromimus sp. EP150 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  155 bits (78), Expect = 1e-34
 Identities = 120/134 (89%)
 Strand = Plus / Minus

                                                                       
Query: 221 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 280
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaac 312

                                                                       
Query: 281 agcccgacgaggtatgcctcggctgcctcctggagcgcggagacggcggagctctggaag 340
           || ||||||||||| ||||||   |||||||| |||||   |||||| ||||||||||||
Sbjct: 311 agaccgacgaggtaagcctcgctggcctcctgcagcgccatgacggcagagctctggaag 252

                         
Query: 341 cggaggtcggtctt 354
           || ||||| |||||
Sbjct: 251 cgcaggtccgtctt 238

---

>gb|AY749743.1| Ichthybotus hudsoni histone H3 (H3) gene, partial cds
          Length = 375

 Score =  155 bits (78), Expect = 1e-34
 Identities = 120/134 (89%)
 Strand = Plus / Minus

                                                                       
Query: 221 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 280
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 281 agcccgacgaggtatgcctcggctgcctcctggagcgcggagacggcggagctctggaag 340
           || || |||||||| ||||||   |||||||| || ||    ||||||||||||||||| 
Sbjct: 311 agacccacgaggtaagcctcgctggcctcctgcagagccatcacggcggagctctggaaa 252

                         
Query: 341 cggaggtcggtctt 354
           ||||||||||||||
Sbjct: 251 cggaggtcggtctt 238

---

>gb|AY749718.1| Siphlonurus sp. EP084 histone H3 (H3) gene, partial cds
          Length = 357

 Score =  155 bits (78), Expect = 1e-34
 Identities = 120/134 (89%)
 Strand = Plus / Minus

                                                                       
Query: 221 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 280
           |||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||
Sbjct: 354 tccttgggcatgatggtgacacgcttggcgtggatggcgcacaggttggtgtcctcgaag 295

                                                                       
Query: 281 agcccgacgaggtatgcctcggctgcctcctggagcgcggagacggcggagctctggaag 340
           || ||||| ||||| ||||||  ||||||||| || ||   |||||| ||||||||||||
Sbjct: 294 agaccgaccaggtaagcctcgcttgcctcctgcagtgccatgacggcagagctctggaag 235

                         
Query: 341 cggaggtcggtctt 354
           ||||| ||||||||
Sbjct: 234 cggagatcggtctt 221

---

>gb|AY749709.1| Mystaxiops venatoris histone H3 (H3) gene, partial cds
          Length = 375

 Score =  155 bits (78), Expect = 1e-34
 Identities = 120/134 (89%)
 Strand = Plus / Minus

                                                                       
Query: 221 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 280
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 281 agcccgacgaggtatgcctcggctgcctcctggagcgcggagacggcggagctctggaag 340
           || ||||| ||||| ||||||   |||||||| || ||   |||||| ||||||||||||
Sbjct: 311 aggccgaccaggtaagcctcgctggcctcctgcagggccatgacggccgagctctggaag 252

                         
Query: 341 cggaggtcggtctt 354
           || |||||||||||
Sbjct: 251 cgcaggtcggtctt 238

---

>gb|AY749705.1| Choroterpes sp. EP024 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  155 bits (78), Expect = 1e-34
 Identities = 120/134 (89%)
 Strand = Plus / Minus

                                                                       
Query: 221 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 280
           ||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcaaag 312

                                                                       
Query: 281 agcccgacgaggtatgcctcggctgcctcctggagcgcggagacggcggagctctggaag 340
           || ||||||||||| ||||||   ||||||||||| ||   ||| || ||||||||||||
Sbjct: 311 agaccgacgaggtaggcctcgctggcctcctggagggccatgactgccgagctctggaag 252

                         
Query: 341 cggaggtcggtctt 354
           ||||||||||||||
Sbjct: 251 cggaggtcggtctt 238

---

>ref|XM_524859.1| PREDICTED: Pan troglodytes LOC469476 (LOC469476), mRNA
          Length = 576

 Score =  153 bits (77), Expect = 5e-34
 Identities = 149/173 (86%)
 Strand = Plus / Minus

                                                                       
Query: 182 taggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 241
           ||||||| ||| ||||||||||||||||| | |||||||||||||||||||||||| |||
Sbjct: 575 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 516

                                                                       
Query: 242 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcg 301
           |||||||| ||||||||||| ||||| ||||| ||||| ||||| || ||||| ||||||
Sbjct: 515 cgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcg 456

                                                                
Query: 302 gctgcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
              |||||||| |||||    ||||| |||||||||||||| ||||| |||||
Sbjct: 455 ctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtctt 403

---

>gb|BC069303.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:97421
           IMAGE:7262697), complete cds
          Length = 461

 Score =  153 bits (77), Expect = 5e-34
 Identities = 95/101 (94%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 407 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 348

                                                    
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagccc 285
           ||||||||||||||||| ||||| |||||||| || |||||
Sbjct: 347 ttggcgtggatggcgcacaggttagtgtcctcaaatagccc 307

---

>gb|BC067490.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79343
           IMAGE:7002071), complete cds
          Length = 465

 Score =  153 bits (77), Expect = 5e-34
 Identities = 95/101 (94%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 407 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 348

                                                    
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagccc 285
           ||||||||||||||||| ||||| |||||||| || |||||
Sbjct: 347 ttggcgtggatggcgcacaggttagtgtcctcaaatagccc 307

---

>gb|BC067491.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79344
           IMAGE:7002072), complete cds
          Length = 464

 Score =  153 bits (77), Expect = 5e-34
 Identities = 95/101 (94%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 407 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 348

                                                    
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagccc 285
           ||||||||||||||||| ||||| |||||||| || |||||
Sbjct: 347 ttggcgtggatggcgcacaggttagtgtcctcaaatagccc 307

---

>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on
            chromosome 6
          Length = 269712

 Score =  153 bits (77), Expect = 5e-34
 Identities = 95/101 (94%)
 Strand = Plus / Minus

                                                                        
Query: 185  gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
            |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 4838 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 4779

                                                     
Query: 245  ttggcgtggatggcgcagaggttggtgtcctcgaagagccc 285
            ||||||||||||||||| ||||| |||||||| || |||||
Sbjct: 4778 ttggcgtggatggcgcacaggttagtgtcctcaaatagccc 4738



 Score =  147 bits (74), Expect = 3e-32
 Identities = 146/170 (85%)
 Strand = Plus / Plus

                                                                          
Query: 185    gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
              |||||||| ||||| |||||||| |||||||||||||||||||||||||| || || |||
Sbjct: 234199 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 234258

                                                                          
Query: 245    ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
              ||||||||||| || || |||||||||||||| |||||||| || ||||| ||||||   
Sbjct: 234259 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 234318

                                                                
Query: 305    gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
              |||||||| |||||    || || |||||||||||||| |||||||||||
Sbjct: 234319 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtctt 234368



 Score =  115 bits (58), Expect = 1e-22
 Identities = 142/170 (83%)
 Strand = Plus / Minus

                                                                          
Query: 185    gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
              |||||||| || || ||||||||||| ||||||||||| || ||||||||||| ||||| 
Sbjct: 209561 gccctctccccacgaatgcggcgggcaagctggatgtctttaggcatgatggtcacgcgt 209502

                                                                          
Query: 245    ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
              ||||| || || ||||| ||||||||||||||||| ||||| || | ||| ||||||   
Sbjct: 209501 ttggcatgaatagcgcacaggttggtgtcctcgaaaagccccaccaagtaggcctcgcag 209442

                                                                
Query: 305    gcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
              |||||||| |||||    || ||||| ||||||||||| |||||||||||
Sbjct: 209441 gcctcctgcagcgccatcaccgcggaactctggaagcgcaggtcggtctt 209392



 Score =  115 bits (58), Expect = 1e-22
 Identities = 115/134 (85%)
 Strand = Plus / Plus

                                                                          
Query: 185    gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
              |||||||| || || |||||||| || ||||||||||||||||||||||| || || |||
Sbjct: 180844 gccctctccccacgaatgcggcgagcaagctggatgtccttgggcatgatagtcactcgc 180903

                                                                          
Query: 245    ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggct 304
              |||||||| |||||||| |||||||||||||| || ||||| || ||||| ||||||   
Sbjct: 180904 ttggcgtgaatggcgcataggttggtgtcctcaaacagccccaccaggtaggcctcgcag 180963

                            
Query: 305    gcctcctggagcgc 318
              |||||||| |||||
Sbjct: 180964 gcctcctgcagcgc 180977



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 132/161 (81%)
 Strand = Plus / Plus

                                                                         
Query: 194   ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
             ||||| |||||||| |||||||||||||| |||||||| || || || ||||| || |||
Sbjct: 15605 ccgcgaatgcggcgagcgagctggatgtctttgggcataatagtcactcgcttagcatgg 15664

                                                                         
Query: 254   atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
             |||||||| ||||| |||||||| |||||||| || | ||| |||||    |||||||| 
Sbjct: 15665 atggcgcaaaggtttgtgtcctcaaagagccctaccaagtaggcctcacaagcctcctgc 15724

                                                      
Query: 314   agcgcggagacggcggagctctggaagcggaggtcggtctt 354
             |||||    || || |||||||||||||| || ||||||||
Sbjct: 15725 agcgccatcaccgcagagctctggaagcgaagatcggtctt 15765



 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 75/86 (87%)
 Strand = Plus / Plus

                                                                          
Query: 200    atgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcg 259
              |||||||| |||||||| ||||||||||||||||| || || ||||| || |||||||| 
Sbjct: 254993 atgcggcgagcgagctgaatgtccttgggcatgatagtcactcgcttagcatggatggca 255052

                                        
Query: 260    cagaggttggtgtcctcgaagagccc 285
              || |||||||| ||||| ||||||||
Sbjct: 255053 cacaggttggtatcctcaaagagccc 255078



 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 88/104 (84%)
 Strand = Plus / Minus

                                                                         
Query: 197   cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
             |||||||| || || |||||||| || |||||||||||||||||||| || ||||| || 
Sbjct: 29747 cggatgcgacgtgccagctggatatctttgggcatgatggtgacgcgtttagcgtgaata 29688

                                                         
Query: 257   gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctc 300
             ||||| || |||||||| |||||||| || || ||||| |||||
Sbjct: 29687 gcgcacagattggtgtcttcgaagagtcccaccaggtaggcctc 29644

---

>ref|NM_003529.2| Homo sapiens histone 1, H3a (HIST1H3A), mRNA
          Length = 469

 Score =  153 bits (77), Expect = 5e-34
 Identities = 95/101 (94%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 407 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 348

                                                    
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagccc 285
           ||||||||||||||||| ||||| |||||||| || |||||
Sbjct: 347 ttggcgtggatggcgcacaggttagtgtcctcaaatagccc 307

---

>gb|AF531274.1| Homo sapiens histone H3 (HIST1H3A) gene, complete cds
          Length = 1227

 Score =  153 bits (77), Expect = 5e-34
 Identities = 95/101 (94%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 817 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 758

                                                    
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagccc 285
           ||||||||||||||||| ||||| |||||||| || |||||
Sbjct: 757 ttggcgtggatggcgcacaggttagtgtcctcaaatagccc 717

---

>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a
             ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
             (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of
             IgG, high affinity Ia, receptor for (CD64), a novel gene
             similar to histone 2, H2be (HIST2H2BE), a novel gene
             similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for
             histone 2, H4, the HIST2H3C gene for histone 2, H3c, the
             HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd
             pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene
             (HIST2H2BC), a novel gene similar to histone 2, H2aa
             (HIST2H2AA), a novel gene similar to histone 2, H3c
             (HIST2H3C), a novel gene similar to histone 1, H4
             (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the
             HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for
             histone 2, H2ab, a novel protein similar to histone 2, a
             novel gene, the SV2A gene for synaptic vesicle
             glycoprotein 2A, the 3' end of the SF3B4 gene for splicing
             factor 3b, subunit 4, 49kDa and five CpG islands, complete
             sequence
          Length = 188956

 Score =  153 bits (77), Expect = 5e-34
 Identities = 149/173 (86%)
 Strand = Plus / Plus

                                                                         
Query: 182   taggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 241
             ||||||| ||| ||||||||||||||||| | |||||||||||||||||||||||| |||
Sbjct: 74987 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 75046

                                                                         
Query: 242   cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcg 301
             |||||||| ||||||||||| ||||| ||||| ||||| ||||| || ||||| ||||||
Sbjct: 75047 cgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcg 75106

                                                                  
Query: 302   gctgcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
                |||||||| |||||    ||||| |||||||||||||| ||||| |||||
Sbjct: 75107 ctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtctt 75159



 Score =  147 bits (74), Expect = 3e-32
 Identities = 137/158 (86%)
 Strand = Plus / Minus

                                                                          
Query: 197    cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
              |||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 114771 cggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttggcgtggatg 114712

                                                                          
Query: 257    gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
              ||||| ||||| ||||| ||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 114711 gcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcctcctgcagc 114652

                                                    
Query: 317    gcggagacggcggagctctggaagcggaggtcggtctt 354
              ||    ||||| |||||||||||||| ||||| |||||
Sbjct: 114651 gccatcacggccgagctctggaagcgcaggtccgtctt 114614



 Score =  147 bits (74), Expect = 3e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                          
Query: 197    cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
              |||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 102495 cggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttggcgtggatg 102554

                                                                          
Query: 257    gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctggagc 316
              ||||| ||||| ||||| ||||| ||||| || ||||| ||||||   |||||||| |||
Sbjct: 102555 gcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcctcctgcagc 102614

                                                    
Query: 317    gcggagacggcggagctctggaagcggaggtcggtctt 354
              ||    ||||| |||||||||||||| ||||| |||||
Sbjct: 102615 gccatcacggccgagctctggaagcgcaggtccgtctt 102652

---

>ref|XM_777897.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC577682), mRNA
          Length = 411

 Score =  153 bits (77), Expect = 5e-34
 Identities = 143/165 (86%)
 Strand = Plus / Minus

                                                                       
Query: 190 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
           |||||| ||||| |||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 402 ctcgccacggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 343

                                                                       
Query: 250 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
           |||||||||||| |||||||||||||||||||| ||||| | ||| || |||   |||||
Sbjct: 342 gtggatggcgcacaggttggtgtcctcgaagagaccgaccaagtaggcttcgctagcctc 283

                                                        
Query: 310 ctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||| || ||   || ||| ||||||||||| ||||| ||||||||
Sbjct: 282 ctgaagagccatgatggcagagctctggaatcggagctcggtctt 238

---

>emb|X00593.1|LPH3H4 Lytechinus pictus H3 and H4 gene
          Length = 2029

 Score =  153 bits (77), Expect = 5e-34
 Identities = 143/165 (86%)
 Strand = Plus / Minus

                                                                        
Query: 190  ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
            |||||| ||||| |||||||| |||||||||||||| |||||||||||||| ||||| ||
Sbjct: 1879 ctcgccacggatacggcgggcaagctggatgtcctttggcatgatggtgacacgcttagc 1820

                                                                        
Query: 250  gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
            ||||||||| || ||||||||||||||||| || ||||| | ||| || |||   |||||
Sbjct: 1819 gtggatggcacacaggttggtgtcctcgaaaagaccgaccaagtaagcttcgctggcctc 1760

                                                         
Query: 310  ctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
            |||||| ||   |||||||||||||||||||||||| ||||||||
Sbjct: 1759 ctggagagccatgacggcggagctctggaagcggagctcggtctt 1715

---

>ref|XM_684297.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC560897), mRNA
          Length = 471

 Score =  153 bits (77), Expect = 5e-34
 Identities = 131/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||
Sbjct: 458 ccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttggcgtgg 399

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||||||||||||||| || ||||| || || ||||||   | |||||| 
Sbjct: 398 atggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctggactcctga 339

                                        
Query: 314 agcgcggagacggcggagctctggaagcg 342
           || ||   |||||||||||||||||||||
Sbjct: 338 agagccatgacggcggagctctggaagcg 310

---

>ref|XM_687893.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC564560), mRNA
          Length = 411

 Score =  153 bits (77), Expect = 5e-34
 Identities = 140/161 (86%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||| ||||||||||| ||||||||||||||||| | ||||||||||
Sbjct: 398 ccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggcgtgg 339

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||||||||||||||| || ||||| || || ||||||   | |||||| 
Sbjct: 338 atggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctggactcctga 279

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           || ||   ||||||||||||||||||||| || ||||||||
Sbjct: 278 agagccatgacggcggagctctggaagcgcagatcggtctt 238

---

>gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, histone 2A-like protein gene,
              hereditary haemochromatosis (HLA-H) gene, RoRet gene, and
              sodium phosphate transporter (NPT3) gene, complete cds
          Length = 246282

 Score =  153 bits (77), Expect = 5e-34
 Identities = 95/101 (94%)
 Strand = Plus / Plus

                                                                          
Query: 185    gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
              |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 120163 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 120222

                                                       
Query: 245    ttggcgtggatggcgcagaggttggtgtcctcgaagagccc 285
              ||||||||||||||||| ||||| |||||||| || |||||
Sbjct: 120223 ttggcgtggatggcgcacaggttagtgtcctcaaatagccc 120263



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 132/161 (81%)
 Strand = Plus / Minus

                                                                          
Query: 194    ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
              ||||| |||||||| |||||||||||||| |||||||| || || || ||||| || |||
Sbjct: 109396 ccgcgaatgcggcgagcgagctggatgtctttgggcataatagtcactcgcttagcatgg 109337

                                                                          
Query: 254    atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
              |||||||| ||||| |||||||| |||||||| || | ||| |||||    |||||||| 
Sbjct: 109336 atggcgcaaaggtttgtgtcctcaaagagccctaccaagtaggcctcacaagcctcctgc 109277

                                                       
Query: 314    agcgcggagacggcggagctctggaagcggaggtcggtctt 354
              |||||    || || |||||||||||||| || ||||||||
Sbjct: 109276 agcgccatcaccgcagagctctggaagcgaagatcggtctt 109236



 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 88/104 (84%)
 Strand = Plus / Plus

                                                                         
Query: 197   cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 256
             |||||||| || || |||||||| || |||||||||||||||||||| || ||||| || 
Sbjct: 95254 cggatgcgacgtgccagctggatatctttgggcatgatggtgacgcgtttagcgtgaata 95313

                                                         
Query: 257   gcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctc 300
             ||||| || |||||||| |||||||| || || ||||| |||||
Sbjct: 95314 gcgcacagattggtgtcttcgaagagtcccaccaggtaggcctc 95357

---

>ref|XM_497711.2| PREDICTED: Homo sapiens similar to H3 histone, family 2 isoform 2
           (LOC653604), mRNA
          Length = 543

 Score =  153 bits (77), Expect = 5e-34
 Identities = 149/173 (86%)
 Strand = Plus / Minus

                                                                       
Query: 182 taggccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 241
           ||||||| ||| ||||||||||||||||| | |||||||||||||||||||||||| |||
Sbjct: 542 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 483

                                                                       
Query: 242 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcg 301
           |||||||| ||||||||||| ||||| ||||| ||||| ||||| || ||||| ||||||
Sbjct: 482 cgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcg 423

                                                                
Query: 302 gctgcctcctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
              |||||||| |||||    ||||| |||||||||||||| ||||| |||||
Sbjct: 422 ctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtctt 370

---

>ref|XM_693458.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570028), mRNA
          Length = 725

 Score =  153 bits (77), Expect = 5e-34
 Identities = 140/161 (86%)
 Strand = Plus / Minus

                                                                       
Query: 194 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 253
           ||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||
Sbjct: 398 ccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttggcgtgg 339

                                                                       
Query: 254 atggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctcctgg 313
           |||||||| ||||| ||||||||||| || ||||| || || ||||||   | |||||| 
Sbjct: 338 atggcgcacaggtttgtgtcctcgaaaaggccgaccagataagcctcgctggactcctgc 279

                                                    
Query: 314 agcgcggagacggcggagctctggaagcggaggtcggtctt 354
           || ||   ||||||||||||||||||||| ||||| |||||
Sbjct: 278 agggccatgacggcggagctctggaagcgcaggtcagtctt 238

---

>emb|CR541858.1| Homo sapiens full open reading frame cDNA clone RZPDo834H0632D for
           gene HIST1H3A, histone 1, H3a; complete cds, incl.
           stopcodon
          Length = 411

 Score =  153 bits (77), Expect = 5e-34
 Identities = 95/101 (94%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 407 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 348

                                                    
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagccc 285
           ||||||||||||||||| ||||| |||||||| || |||||
Sbjct: 347 ttggcgtggatggcgcacaggttagtgtcctcaaatagccc 307

---

>gb|AY923964.1| Phenacolepas osculans isolate PHE1 histone H3 (H3) gene, partial
           cds
          Length = 369

 Score =  153 bits (77), Expect = 5e-34
 Identities = 117/131 (89%)
 Strand = Plus / Minus

                                                                       
Query: 224 ttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagc 283
           |||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| 
Sbjct: 369 ttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcaaagagg 310

                                                                       
Query: 284 ccgacgaggtatgcctcggctgcctcctggagcgcggagacggcggagctctggaagcgg 343
           ||||| ||||| ||||||   |||||||| |||||   ||||||||||||||||||||| 
Sbjct: 309 ccgaccaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaagcgc 250

                      
Query: 344 aggtcggtctt 354
           ||||| |||||
Sbjct: 249 aggtcsgtctt 239

---

>emb|Z61129.1|HS45E8R H.sapiens CpG island DNA genomic Mse1 fragment, clone 45e8, reverse
           read cpg45e8.rt1d
          Length = 257

 Score =  153 bits (77), Expect = 5e-34
 Identities = 95/101 (94%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 169 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 110

                                                    
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagccc 285
           ||||||||||||||||| ||||| |||||||| || |||||
Sbjct: 109 ttggcgtggatggcgcacaggttagtgtcctcaaatagccc 69

---

>gb|BC066246.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79341
           IMAGE:7002069), complete cds
          Length = 465

 Score =  153 bits (77), Expect = 5e-34
 Identities = 95/101 (94%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 407 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 348

                                                    
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagccc 285
           ||||||||||||||||| ||||| |||||||| || |||||
Sbjct: 347 ttggcgtggatggcgcacaggttagtgtcctcaaatagccc 307

---

>gb|BC066245.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79340
           IMAGE:7002068), complete cds
          Length = 465

 Score =  153 bits (77), Expect = 5e-34
 Identities = 95/101 (94%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 407 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 348

                                                    
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagccc 285
           ||||||||||||||||| ||||| |||||||| || |||||
Sbjct: 347 ttggcgtggatggcgcacaggttagtgtcctcaaatagccc 307

---

>gb|BC066247.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79342
           IMAGE:7002070), complete cds
          Length = 465

 Score =  153 bits (77), Expect = 5e-34
 Identities = 95/101 (94%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 407 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 348

                                                    
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagccc 285
           ||||||||||||||||| ||||| |||||||| || |||||
Sbjct: 347 ttggcgtggatggcgcacaggttagtgtcctcaaatagccc 307

---

>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and
           histone H2A genes, complete cds
          Length = 4358

 Score =  153 bits (77), Expect = 5e-34
 Identities = 143/165 (86%)
 Strand = Plus / Plus

                                                                       
Query: 190 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
           |||||| |||||||||||||| |||||||||||||||||||||||||| || ||||||||
Sbjct: 275 ctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcacacgcttggc 334

                                                                       
Query: 250 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
           |  ||||||||| ||||||||||||||||| || || || ||||| ||||| || |||||
Sbjct: 335 ggtgatggcgcacaggttggtgtcctcgaacaggcccaccaggtaagcctcagcggcctc 394

                                                        
Query: 310 ctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||| |||||   ||||||   |||||||||||| |||||||||||
Sbjct: 395 ctgcagcgccacgacggcctggctctggaagcgcaggtcggtctt 439

---

>gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I) and histone H4 (ch4-I)
           genes, complete cds
          Length = 1338

 Score =  153 bits (77), Expect = 5e-34
 Identities = 143/165 (86%)
 Strand = Plus / Plus

                                                                       
Query: 190 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
           |||||| |||||||||||||| |||||||||||||||||||||||||| || ||||||||
Sbjct: 209 ctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcacacgcttggc 268

                                                                       
Query: 250 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
           |||||||||||| ||||| ||||||||||| || || || ||||| ||||| || |||||
Sbjct: 269 gtggatggcgcacaggttcgtgtcctcgaacaggcccaccaggtaggcctcagcggcctc 328

                                                        
Query: 310 ctggagcgcggagacggcggagctctggaagcggaggtcggtctt 354
           ||| |||||    |||||   |||||||||||| |||||||||||
Sbjct: 329 ctgcagcgccagcacggcctggctctggaagcgcaggtcggtctt 373

---

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
           histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
           complete cds
          Length = 3777

 Score =  153 bits (77), Expect = 5e-34
 Identities = 116/129 (89%)
 Strand = Plus / Plus

                                                                       
Query: 190 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
           |||||| |||||||||||||| ||||||||||||||||||||||| || || ||||||||
Sbjct: 253 ctcgccacggatgcggcgggccagctggatgtccttgggcatgatcgtcacacgcttggc 312

                                                                       
Query: 250 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtatgcctcggctgcctc 309
           |||||||||||| ||||||||||||||||| || || || ||||| |||||||| |||||
Sbjct: 313 gtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaggcctcggcggcctc 372

                    
Query: 310 ctggagcgc 318
           ||| |||||
Sbjct: 373 ctgtagcgc 381

---

>gb|AY338636.1| Calopteryx aequabilis histone 3 gene, partial cds
          Length = 345

 Score =  153 bits (77), Expect = 5e-34
 Identities = 116/129 (89%)
 Strand = Plus / Minus

                                                                       
Query: 226 gggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 285
           |||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| ||
Sbjct: 345 gggcatgatggtgacgcgcttggcgtggatcgcgcacaggttggtgtcctcgaagagacc 286

                                                                       
Query: 286 gacgaggtatgcctcggctgcctcctggagcgcggagacggcggagctctggaagcggag 345
            |||||||| ||||||   ||||||||||| ||   |||||| |||||||||||||||||
Sbjct: 285 cacgaggtaagcctcgctggcctcctggagtgccatgacggcagagctctggaagcggag 226

                    
Query: 346 gtcggtctt 354
           |||||||||
Sbjct: 225 gtcggtctt 217

---

>gb|AY338628.1| Isonychia sp. EP017 histone 3 gene, partial cds
          Length = 345

 Score =  153 bits (77), Expect = 5e-34
 Identities = 116/129 (89%)
 Strand = Plus / Minus

                                                                       
Query: 226 gggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 285
           |||||||||||||||||||||||||||||||||||| | |||||||||||||||||| ||
Sbjct: 345 gggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcgaagagacc 286

                                                                       
Query: 286 gacgaggtatgcctcggctgcctcctggagcgcggagacggcggagctctggaagcggag 345
            |||||||| ||||||  ||||||||| || ||   ||||||||||||||||||||| ||
Sbjct: 285 tacgaggtaagcctcgcttgcctcctgcagggccatgacggcggagctctggaagcgcag 226

                    
Query: 346 gtcggtctt 354
           |||||||||
Sbjct: 225 gtcggtctt 217

---

>emb|Z46261.1|HSHISH3A H.sapiens DNA for histone H3a
          Length = 969

 Score =  153 bits (77), Expect = 5e-34
 Identities = 95/101 (94%)
 Strand = Plus / Minus

                                                                       
Query: 185 gccctctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 244
           |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 714 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 655

                                                    
Query: 245 ttggcgtggatggcgcagaggttggtgtcctcgaagagccc 285
           ||||||||||||||||| ||||| |||||||| || |||||
Sbjct: 654 ttggcgtggatggcgcacaggttagtgtcctcaaatagccc 614

---

>gb|AF517884.1| Griffithsia japonica isolate Gj475 histone H3.3 protein mRNA,
           complete cds
          Length = 610

 Score =  151 bits (76), Expect = 2e-33
 Identities = 143/163 (87%), Gaps = 3/163 (1%)
 Strand = Plus / Minus

                                                                       
Query: 191 tcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcg 250
           |||||||| || ||||| |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 502 tcgccgcgaatacggcgtgcgagctgaatgtccttgggcatgatggtgacgcgcttggcg 443

                                                                       
Query: 251 tggatggcgcagaggttggtgtcctcgaagag--cccgacg-aggtatgcctcggctgcc 307
           ||||||||||| | ||||||||||||||| ||  ||| ||| ||||| |||||||| |||
Sbjct: 442 tggatggcgcacaagttggtgtcctcgaacagtcccccacgaaggtaggcctcggcggcc 383

                                                      
Query: 308 tcctggagcgcggagacggcggagctctggaagcggaggtcgg 350
           || || ||||||   ||||| |||||||||||||| |||||||
Sbjct: 382 tcttgcagcgcgagcacggccgagctctggaagcgcaggtcgg 340

---

>gb|DQ275319.1| Graphoderus zonatus voucher BYU KBMGrzo66 histone 3 (H3) gene,
           partial cds
          Length = 376

 Score =  151 bits (76), Expect = 2e-33
 Identities = 119/134 (88%)
 Strand = Plus / Minus

                                                                       
Query: 221 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 280
           ||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||| 
Sbjct: 372 tccttgggcatgatggtgacgcgcttggcgtggatsgcgcacaagttggtgtcctcgaaa 313

                                                                       
Query: 281 agcccgacgaggtatgcctcggctgcctcctggagcgcggagacggcggagctctggaag 340
           || |||||||||||||| |||   |||||||| || ||   |||||||||||||||||||
Sbjct: 312 agaccgacgaggtatgcttcgctggcctcctgcagagccatgacggcggagctctggaag 253

                         
Query: 341 cggaggtcggtctt 354
           || |||||||||||
Sbjct: 252 cgcaggtcggtctt 239

---

>ref|XM_780236.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC580163), mRNA
          Length = 363

 Score =  149 bits (75), Expect = 7e-33
 Identities = 93/99 (93%)
 Strand = Plus / Minus

                                                                       
Query: 190 ctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 249
           |||||| |||||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 354 ctcgccacggatgcgacgggcaagctggatgtccttgggcatgatggtgacacgcttggc 295

                                                  
Query: 250 gtggatggcgcagaggttggtgtcctcgaagagcccgac 288
           |||||||||||| |||||||||||||||||||| |||||
Sbjct: 294 gtggatggcgcacaggttggtgtcctcgaagagaccgac 256


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,616,811
Number of Sequences: 3902068
Number of extensions: 2616811
Number of successful extensions: 55534
Number of sequences better than 10.0: 3291
Number of HSP's better than 10.0 without gapping: 3281
Number of HSP's successfully gapped in prelim test: 12
Number of HSP's that attempted gapping in prelim test: 49834
Number of HSP's gapped (non-prelim): 4664
length of query: 354
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 332
effective length of database: 17,147,199,772
effective search space: 5692870324304
effective search space used: 5692870324304
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---