| Clone Name | rbast39c03 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC166898.17| Medicago truncatula clone mth2-70l3, complete sequence Length = 100341 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Minus Query: 87 ccatgcatgcattgcacactc 107 ||||||||||||||||||||| Sbjct: 75508 ccatgcatgcattgcacactc 75488
>gb|AC147963.2| Medicago truncatula chromosome 1 BAC clone mth2-42e19, complete sequence Length = 106951 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Minus Query: 87 ccatgcatgcattgcacactc 107 ||||||||||||||||||||| Sbjct: 68521 ccatgcatgcattgcacactc 68501
>emb|BX571946.9| Zebrafish DNA sequence from clone DKEY-232H18 in linkage group 22, complete sequence Length = 179796 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Plus Query: 202 atggttggatggatggatcga 222 ||||||||||||||||||||| Sbjct: 150383 atggttggatggatggatcga 150403
>gb|AC151752.1| Ornithorhynchus anatinus chromosome UNK clone OABb-503A1, complete sequence Length = 132108 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 177 tgatgcagcaaaattaatca 196 |||||||||||||||||||| Sbjct: 28313 tgatgcagcaaaattaatca 28332
>gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 9, complete sequence Length = 1178688 Score = 40.1 bits (20), Expect = 3.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 202 atggttggatggatggatcgagagcgag 229 |||| ||||||||||||| ||||||||| Sbjct: 522227 atgggtggatggatggatggagagcgag 522200
>gb|AC154566.2| Mus musculus BAC clone RP23-407A17 from chromosome 17, complete sequence Length = 204306 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 81 tcttggccatgcatgcattg 100 |||||||||||||||||||| Sbjct: 158025 tcttggccatgcatgcattg 158044
>ref|XM_572973.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein (CNI01890) partial mRNA Length = 3316 Score = 40.1 bits (20), Expect = 3.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 202 atggttggatggatggatcgagagcgag 229 |||| ||||||||||||| ||||||||| Sbjct: 63 atgggtggatggatggatggagagcgag 36
>gb|AC132367.3| Mus musculus BAC clone RP23-465K21 from chromosome 17, complete sequence Length = 192971 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 81 tcttggccatgcatgcattg 100 |||||||||||||||||||| Sbjct: 39389 tcttggccatgcatgcattg 39408
>gb|AC125782.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0095P22, complete sequence Length = 162766 Score = 40.1 bits (20), Expect = 3.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 200 gcatggttggatggatggatcgag 223 |||||| ||||||||||||||||| Sbjct: 126609 gcatggatggatggatggatcgag 126632
>emb|CR383660.9| Zebrafish DNA sequence from clone DKEY-1H22 in linkage group 14, complete sequence Length = 139631 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 188 aattaatcatcagcatggtt 207 |||||||||||||||||||| Sbjct: 6035 aattaatcatcagcatggtt 6016
>emb|AL354833.9| Human DNA sequence from clone RP11-157L14 on chromosome 13 Contains an olfactory receptor pseudogene, a novel gene (RGC32), the 3' end of a novel gene (contains KIAA0564 and FLJ21779) possible ortholog of RIKEN cDNA 1300010F03 gene, and 2 CpG islands, complete sequence Length = 158871 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 200 gcatggttggatggatggat 219 |||||||||||||||||||| Sbjct: 117612 gcatggttggatggatggat 117593
>emb|AL031733.3|HS455J7 Human DNA sequence from clone RP3-455J7 on chromosome 1q24 Contains the 5' end of the CD3Z gene for CD3Z antigen zeta polypeptide (TiT3 complex), an aldo-keto reductase family 1 member D1 (delta 4-3-ketosteroid-5-beta-reductase) (AKR1D1) pseudogene, the CREG gene for cellular repressor of E1A-stimulated genes, a ribosomal protein S18 (RPS18) pseudogene, a novel gene, the 5' end of the gene for a novel protein and a CpG island, complete sequence Length = 215861 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 200 gcatggttggatggatggat 219 |||||||||||||||||||| Sbjct: 173722 gcatggttggatggatggat 173703
>gb|AC145349.1| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0096I10, complete sequence Length = 171946 Score = 40.1 bits (20), Expect = 3.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 200 gcatggttggatggatggatcgag 223 |||||| ||||||||||||||||| Sbjct: 83489 gcatggatggatggatggatcgag 83466
>emb|BX571852.20| Zebrafish DNA sequence from clone DKEY-175N6 in linkage group 10, complete sequence Length = 178333 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 200 gcatggttggatggatggat 219 |||||||||||||||||||| Sbjct: 35176 gcatggttggatggatggat 35195
>emb|BX510332.10| Zebrafish DNA sequence from clone CH211-225M7, complete sequence Length = 171212 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 200 gcatggttggatggatggat 219 |||||||||||||||||||| Sbjct: 117937 gcatggttggatggatggat 117956
>emb|BX548054.19| Zebrafish DNA sequence from clone CH211-237N4 in linkage group 14, complete sequence Length = 128658 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 188 aattaatcatcagcatggtt 207 |||||||||||||||||||| Sbjct: 112433 aattaatcatcagcatggtt 112452
>ref|XM_392958.2| PREDICTED: Apis mellifera similar to sex-lethal (LOC409446), mRNA Length = 1346 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 61 cacatcaaataccatcaagt 80 |||||||||||||||||||| Sbjct: 22 cacatcaaataccatcaagt 41
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 40.1 bits (20), Expect = 3.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 200 gcatggttggatggatggatcgag 223 |||||| ||||||||||||||||| Sbjct: 24325500 gcatggatggatggatggatcgag 24325523
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 40.1 bits (20), Expect = 3.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 204 ggttggatggatggatcgagagcg 227 ||||||||||||||||||| |||| Sbjct: 31720891 ggttggatggatggatcgacagcg 31720914
>dbj|AP003268.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0503C12 Length = 147180 Score = 40.1 bits (20), Expect = 3.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 204 ggttggatggatggatcgagagcg 227 ||||||||||||||||||| |||| Sbjct: 134623 ggttggatggatggatcgacagcg 134646
>emb|BX890617.13| Zebrafish DNA sequence from clone DKEYP-84F11 in linkage group 19, complete sequence Length = 182182 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 200 gcatggttggatggatggat 219 |||||||||||||||||||| Sbjct: 65036 gcatggttggatggatggat 65055 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 200 gcatggttggatggatggat 219 |||||||||||||||||||| Sbjct: 64700 gcatggttggatggatggat 64719
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 40.1 bits (20), Expect = 3.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 200 gcatggttggatggatggatcgag 223 |||||| ||||||||||||||||| Sbjct: 24637169 gcatggatggatggatggatcgag 24637192
>emb|AL935193.9| Zebrafish DNA sequence from clone CH211-209H11, complete sequence Length = 208059 Score = 40.1 bits (20), Expect = 3.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 199 agcatggttggatggatggatcga 222 ||||||| |||||||||||||||| Sbjct: 170460 agcatggatggatggatggatcga 170437
>emb|BX000451.4| Zebrafish DNA sequence from clone CH211-30E10, complete sequence Length = 153155 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 200 gcatggttggatggatggat 219 |||||||||||||||||||| Sbjct: 37223 gcatggttggatggatggat 37242 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,535,086 Number of Sequences: 3902068 Number of extensions: 2535086 Number of successful extensions: 213328 Number of sequences better than 10.0: 24 Number of HSP's better than 10.0 without gapping: 24 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 212911 Number of HSP's gapped (non-prelim): 417 length of query: 287 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 265 effective length of database: 17,147,199,772 effective search space: 4544007939580 effective search space used: 4544007939580 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)