>gb|AC009257.3|AC009257 Drosophila melanogaster, chromosome 2R, region 59D-59E, BAC clone
              BACR25I01, complete sequence
          Length = 218565

 Score = 44.1 bits (22), Expect = 0.062
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 56     agtaaattattgggggaaatga 77
              ||||||||||||||||||||||
Sbjct: 146257 agtaaattattgggggaaatga 146236

>gb|AC005639.2|AC005639 Drosophila melanogaster, chromosome 2R, region 59E3-59F4, BAC clone
            BACR48M01, complete sequence
          Length = 188272

 Score = 44.1 bits (22), Expect = 0.062
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 56   agtaaattattgggggaaatga 77
            ||||||||||||||||||||||
Sbjct: 1563 agtaaattattgggggaaatga 1542

>gb|AE003461.3| Drosophila melanogaster chromosome 2R, section 69 of 73 of the complete
             sequence
          Length = 598988

 Score = 44.1 bits (22), Expect = 0.062
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 56    agtaaattattgggggaaatga 77
             ||||||||||||||||||||||
Sbjct: 35103 agtaaattattgggggaaatga 35082

>emb|AL139330.17| Human DNA sequence from clone RP11-266C7 on chromosome 6q25.2-26
             Contains the SYNJ2 gene for synaptojanin 2 (inositol
             phosphate 5'-phosphatase 2, INPP5H) (contains FLJ23714 and
             DKFZp761E1512), a novel gene and the 3' end of the SNX9
             gene for sorting nexin 9 (SH3 and PX domain-containing
             protein (SH3PX1, SDP1), FLJ22984). Contains two CpG
             islands, complete sequence
          Length = 160974

 Score = 40.1 bits (20), Expect = 0.96
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 69    gggaaatgatacaatgcaaa 88
             ||||||||||||||||||||
Sbjct: 41456 gggaaatgatacaatgcaaa 41475

>gb|AC123298.4| Rattus norvegicus  BAC CH230-352N4 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 175621

 Score = 40.1 bits (20), Expect = 0.96
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 64     attgggggaaatgatacaat 83
              ||||||||||||||||||||
Sbjct: 143042 attgggggaaatgatacaat 143061

>gb|AC115393.5| Rattus norvegicus  BAC CH230-103E13 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 243316

 Score = 40.1 bits (20), Expect = 0.96
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 64    attgggggaaatgatacaat 83
             ||||||||||||||||||||
Sbjct: 30128 attgggggaaatgatacaat 30147

>emb|AL607070.19| Mouse DNA sequence from clone RP23-31C9 on chromosome 4, complete
              sequence
          Length = 215106

 Score = 40.1 bits (20), Expect = 0.96
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      tctaaatatccttaaaacat 21
              ||||||||||||||||||||
Sbjct: 152788 tctaaatatccttaaaacat 152807

>emb|AL671916.5| Mouse DNA sequence from clone RP23-294O1 on chromosome X, complete
              sequence
          Length = 205436

 Score = 40.1 bits (20), Expect = 0.96
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 70     ggaaatgatacaatgcaaat 89
              ||||||||||||||||||||
Sbjct: 180416 ggaaatgatacaatgcaaat 180435

>gb|AC006027.5| Homo sapiens BAC clone GS1-114I9 from 7, complete sequence
          Length = 68769

 Score = 38.2 bits (19), Expect = 3.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 53  aacagtaaattattgggggaaat 75
           ||||||||| |||||||||||||
Sbjct: 798 aacagtaaaatattgggggaaat 776

>gb|AC146040.2| Pan troglodytes BAC clone RP43-97N16 from 7, complete sequence
          Length = 175808

 Score = 38.2 bits (19), Expect = 3.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 53   aacagtaaattattgggggaaat 75
            ||||||||| |||||||||||||
Sbjct: 2686 aacagtaaaatattgggggaaat 2708

>gb|AC117238.3| Mus musculus BAC clone RP24-82N17 from 1, complete sequence
          Length = 214280

 Score = 38.2 bits (19), Expect = 3.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 59    aaattattgggggaaatga 77
             |||||||||||||||||||
Sbjct: 37802 aaattattgggggaaatga 37820

>emb|AL109842.7|HSDJ726A1 Human DNA sequence from clone RP4-726A1 on chromosome 6q22.2-23.1
             Contains part of the TCBA1 gene for T-cell lymphoma
             breakpoint associated target 1, complete sequence
          Length = 120998

 Score = 38.2 bits (19), Expect = 3.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 65    ttgggggaaatgatacaat 83
             |||||||||||||||||||
Sbjct: 94503 ttgggggaaatgatacaat 94485

>emb|AL713925.10| Mouse DNA sequence from clone RP23-298B18 on chromosome 11, complete
             sequence
          Length = 81699

 Score = 38.2 bits (19), Expect = 3.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 58    taaattattgggggaaatg 76
             |||||||||||||||||||
Sbjct: 45707 taaattattgggggaaatg 45689

>gb|AC114940.2| Homo sapiens chromosome 5 clone CTD-2285G11, complete sequence
          Length = 80059

 Score = 38.2 bits (19), Expect = 3.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 2     tctaaatatccttaaaaca 20
             |||||||||||||||||||
Sbjct: 62343 tctaaatatccttaaaaca 62361

>gb|AC087311.23| Homo sapiens 12 BAC RP11-267D19 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 159688

 Score = 38.2 bits (19), Expect = 3.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 5     aaatatccttaaaacatat 23
             |||||||||||||||||||
Sbjct: 40123 aaatatccttaaaacatat 40105

>gb|AC114285.2| Homo sapiens chromosome 5 clone CTD-2335A14, complete sequence
          Length = 122885

 Score = 38.2 bits (19), Expect = 3.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 2     tctaaatatccttaaaaca 20
             |||||||||||||||||||
Sbjct: 20058 tctaaatatccttaaaaca 20076

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 38.2 bits (19), Expect = 3.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 5       aaatatccttaaaacatat 23
               |||||||||||||||||||
Sbjct: 2920197 aaatatccttaaaacatat 2920179

>gb|AC091619.3| Papio anubis clone RP41-139B7, complete sequence
          Length = 181302

 Score = 38.2 bits (19), Expect = 3.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 53     aacagtaaattattgggggaaat 75
              ||||||||| |||||||||||||
Sbjct: 178608 aacagtaaaatattgggggaaat 178586

>gb|AC091530.4| Papio anubis clone RP41-444A14, complete sequence
          Length = 162413

 Score = 38.2 bits (19), Expect = 3.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 53    aacagtaaattattgggggaaat 75
             ||||||||| |||||||||||||
Sbjct: 16810 aacagtaaaatattgggggaaat 16788

>dbj|AP004461.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0443G08
          Length = 162139

 Score = 38.2 bits (19), Expect = 3.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 5     aaatatccttaaaacatat 23
             |||||||||||||||||||
Sbjct: 93259 aaatatccttaaaacatat 93241

>gb|AC091716.3| Pan troglodytes clone RP43-147G10, complete sequence
          Length = 122710

 Score = 38.2 bits (19), Expect = 3.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 53    aacagtaaattattgggggaaat 75
             ||||||||| |||||||||||||
Sbjct: 41703 aacagtaaaatattgggggaaat 41681

>emb|BX649303.18| Zebrafish DNA sequence from clone CH211-266C8 in linkage group 4,
             complete sequence
          Length = 65932

 Score = 38.2 bits (19), Expect = 3.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 21    tatctgggcatattggcat 39
             |||||||||||||||||||
Sbjct: 30309 tatctgggcatattggcat 30327

>gb|AC118589.10| Mus musculus chromosome 1, clone RP23-198G19, complete sequence
          Length = 217156

 Score = 38.2 bits (19), Expect = 3.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 59    aaattattgggggaaatga 77
             |||||||||||||||||||
Sbjct: 88964 aaattattgggggaaatga 88946


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 843,978
Number of Sequences: 3902068
Number of extensions: 843978
Number of successful extensions: 61333
Number of sequences better than 10.0: 23
Number of HSP's better than 10.0 without gapping: 23
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61275
Number of HSP's gapped (non-prelim): 58
length of query: 89
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 68
effective length of database: 17,151,101,840
effective search space: 1166274925120
effective search space used: 1166274925120
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)