| Clone Name | rbast37h05 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT018529.1| Zea mays clone EL01N0433D12.d mRNA sequence Length = 1172 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 295 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 237 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 236 gacctgatgcggttatg 220
>gb|AY095465.1| Nymphaea sp. MJZ-2002 26S ribosomal RNA gene, partial sequence Length = 3314 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1900 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1842 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1841 gacctgatgcggttatg 1825
>gb|AY292901.1| Nuphar sp. YLQ-2003 26S ribosomal RNA gene, partial sequence Length = 3568 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 2109 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 2051 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 2050 gacctgatgcggttatg 2034
>gb|AY292900.1| Nymphaea sp. YLQ-2003 26S ribosomal RNA gene, partial sequence Length = 3329 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1900 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1842 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1841 gacctgatgcggttatg 1825
>dbj|AP008225.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, fosmid clone:OSJNOa109J19 Length = 30481 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 23063 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 23005 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 23004 gacctgatgcggttatg 22988 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 15135 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 15077 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 15076 gacctgatgcggttatg 15060 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 7207 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 7149 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 7148 gacctgatgcggttatg 7132
>gb|AY049041.1| Triticum aestivum 28S ribosomal RNA gene, partial sequence Length = 3341 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1905 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1847 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1846 gacctgatgcggttatg 1830
>gb|DQ008647.1| Croomia pauciflora 26S ribosomal RNA gene, partial sequence Length = 2067 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1268 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1210 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1209 gacctgatgcggttatg 1193
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 28734012 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 28733954 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 28733953 gacctgatgcggttatg 28733937
>dbj|AP008245.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0013K10 Length = 129118 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 30719 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 30661 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 30660 gacctgatgcggttatg 30644 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 22791 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 22733 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 22732 gacctgatgcggttatg 22716 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 14863 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 14805 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 14804 gacctgatgcggttatg 14788 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 6935 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 6877 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 6876 gacctgatgcggttatg 6860
>dbj|AP004778.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0459B01 Length = 163087 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 50585 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 50527 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 50526 gacctgatgcggttatg 50510
>dbj|AK119812.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-177-A02, full insert sequence Length = 2780 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1032 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 974 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 973 gacctgatgcggttatg 957
>dbj|AK119809.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-176-H02, full insert sequence Length = 3078 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1145 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1087 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1086 gacctgatgcggttatg 1070
>dbj|AK119884.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-179-G12, full insert sequence Length = 2472 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1145 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1087 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1086 gacctgatgcggttatg 1070
>dbj|AK119873.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-179-D07, full insert sequence Length = 2841 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 76 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 18 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 17 gacctgatgcggttatg 1
>dbj|AK119746.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-165-D08, full insert sequence Length = 3917 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 779 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 721 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 720 gacctgatgcggttatg 704
>dbj|AK119652.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-G12, full insert sequence Length = 1890 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 277 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 219 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 218 gacctgatgcggttatg 202
>dbj|AK111221.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-179-C03, full insert sequence Length = 1815 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 448 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 390 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 389 gacctgatgcggttatg 373
>dbj|AK111213.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-179-A12, full insert sequence Length = 2495 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 474 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 416 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 415 gacctgatgcggttatg 399
>dbj|AK111208.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-178-G09, full insert sequence Length = 2395 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 463 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 405 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 404 gacctgatgcggttatg 388
>dbj|AK111153.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-176-F12, full insert sequence Length = 2816 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1147 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1089 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1088 gacctgatgcggttatg 1072
>dbj|AK110456.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-166-F02, full insert sequence Length = 2806 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 762 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 704 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 703 gacctgatgcggttatg 687
>dbj|AK110438.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-166-D01, full insert sequence Length = 2305 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 549 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 491 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 490 gacctgatgcggttatg 474
>dbj|AK110422.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-166-A07, full insert sequence Length = 3130 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 906 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 848 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 847 gacctgatgcggttatg 831
>dbj|AK110417.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-165-H07, full insert sequence Length = 2845 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1139 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1081 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1080 gacctgatgcggttatg 1064
>dbj|AK110408.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-165-G09, full insert sequence Length = 3620 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 534 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 476 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 475 gacctgatgcggttatg 459
>dbj|AK110378.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-165-C09, full insert sequence Length = 2695 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 788 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 730 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 729 gacctgatgcggttatg 713
>dbj|AK110338.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-164-F03, full insert sequence Length = 2885 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1011 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 953 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 952 gacctgatgcggttatg 936
>dbj|AK110317.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-164-C07, full insert sequence Length = 2440 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1127 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1069 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1068 gacctgatgcggttatg 1052
>dbj|AK110295.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-163-H01, full insert sequence Length = 2802 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 455 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 397 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 396 gacctgatgcggttatg 380
>dbj|AK110187.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-162-A01, full insert sequence Length = 3553 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1026 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 968 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 967 gacctgatgcggttatg 951
>dbj|AK110074.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-160-F02, full insert sequence Length = 3099 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 779 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 721 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 720 gacctgatgcggttatg 704
>dbj|AK110007.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-159-G04, full insert sequence Length = 3066 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1761 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1703 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1702 gacctgatgcggttatg 1686
>dbj|AK109985.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-159-E01, full insert sequence Length = 1802 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 448 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 390 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 389 gacctgatgcggttatg 373
>dbj|AK109969.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-159-C04, full insert sequence Length = 3464 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 759 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 701 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 700 gacctgatgcggttatg 684
>dbj|AK109482.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-202-E11, full insert sequence Length = 1835 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1819 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1761 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1760 gacctgatgcggttatg 1744
>dbj|AK108869.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-152-C06, full insert sequence Length = 2179 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 568 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 510 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 509 gacctgatgcggttatg 493
>dbj|AK106985.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-119-H12, full insert sequence Length = 1541 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 440 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 382 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 381 gacctgatgcggttatg 365
>dbj|AK106912.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-119-A08, full insert sequence Length = 1640 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 858 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 800 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 799 gacctgatgcggttatg 783
>dbj|AK106431.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-103-C05, full insert sequence Length = 1801 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 761 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 703 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 702 gacctgatgcggttatg 686
>dbj|AK105407.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-123-F01, full insert sequence Length = 2644 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1092 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1034 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1033 gacctgatgcggttatg 1017
>dbj|AK105300.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-116-H11, full insert sequence Length = 1765 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1030 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 972 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 971 gacctgatgcggttatg 955
>dbj|AK062150.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-H04, full insert sequence Length = 1584 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 762 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 704 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 703 gacctgatgcggttatg 687
>dbj|AK063163.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-100-B01, full insert sequence Length = 2669 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 542 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 484 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 483 gacctgatgcggttatg 467
>dbj|AK063268.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-113-B06, full insert sequence Length = 1742 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 858 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 800 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 799 gacctgatgcggttatg 783
>dbj|AK058406.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-015-B11, full insert sequence Length = 1207 Score = 129 bits (65), Expect = 1e-27 Identities = 75/77 (97%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 812 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 754 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 753 gacctgatgcggttatg 737
>gb|AY095471.1| Bulbine succulenta 26S ribosomal RNA gene, partial sequence Length = 3316 Score = 127 bits (64), Expect = 4e-27 Identities = 71/72 (98%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1899 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1841 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1840 gatgcggttatg 1829
>gb|AY095451.1| Asimina triloba 26S ribosomal RNA gene, partial sequence Length = 3303 Score = 127 bits (64), Expect = 4e-27 Identities = 71/72 (98%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1886 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1828 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1827 gatgcggttatg 1816
>gb|AY292881.1| Asimina sp. YLQ-2003 26S ribosomal RNA gene, partial sequence Length = 3318 Score = 127 bits (64), Expect = 4e-27 Identities = 71/72 (98%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1886 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1828 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1827 gatgcggttatg 1816
>gb|DQ008653.1| Tofieldia calyculata 26S ribosomal RNA gene, partial sequence Length = 3081 Score = 127 bits (64), Expect = 4e-27 Identities = 71/72 (98%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1880 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1822 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1821 gatgcggttatg 1810
>gb|DQ008649.1| Potamogeton berchtoldii 26S ribosomal RNA gene, partial sequence Length = 3236 Score = 127 bits (64), Expect = 4e-27 Identities = 71/72 (98%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1857 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1799 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1798 gatgcggttatg 1787
>gb|DQ008622.1| Ceratophyllum submersum 26S ribosomal RNA gene, partial sequence Length = 2911 Score = 127 bits (64), Expect = 4e-27 Identities = 71/72 (98%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1771 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1713 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1712 gatgcggttatg 1701
>gb|AF479176.1| Convolvulus arvensis 26S ribosomal RNA gene, partial sequence Length = 1961 Score = 127 bits (64), Expect = 4e-27 Identities = 71/72 (98%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 507 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 449 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 448 gatgcggttatg 437
>gb|AF479125.1| Euphorbia polychroma 26S ribosomal RNA gene, complete sequence Length = 3350 Score = 127 bits (64), Expect = 4e-27 Identities = 71/72 (98%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1895 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1837 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1836 gatgcggttatg 1825
>gb|AF479122.1| Hypericum perforatum 26S ribosomal RNA gene, complete sequence Length = 3346 Score = 127 bits (64), Expect = 4e-27 Identities = 71/72 (98%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1891 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1833 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1832 gatgcggttatg 1821
>gb|AF479095.1| Opilia amentacea 26S ribosomal RNA gene, complete sequence Length = 3351 Score = 127 bits (64), Expect = 4e-27 Identities = 71/72 (98%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1895 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1837 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1836 gatgcggttatg 1825
>gb|AF479084.1| Stellaria media 26S ribosomal RNA gene, complete sequence Length = 3332 Score = 127 bits (64), Expect = 4e-27 Identities = 71/72 (98%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1884 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1826 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1825 gatgcggttatg 1814
>gb|AF181820.1|AF181820 Thesium carinatum 26S ribosomal RNA, partial sequence Length = 401 Score = 127 bits (64), Expect = 4e-27 Identities = 71/72 (98%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 167 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 109 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 108 gatgcggttatg 97
>gb|AF274644.1| Daphniphyllum sp. 205-82 26S ribosomal RNA gene, complete sequence Length = 3367 Score = 125 bits (63), Expect = 2e-26 Identities = 70/71 (98%), Gaps = 1/71 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1913 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1855 Query: 66 gatgcggttat 76 ||||||||||| Sbjct: 1854 gatgcggttat 1844
>gb|AF479215.1| Daphniphyllum sp. 205-82 26S ribosomal RNA gene, complete sequence Length = 3362 Score = 125 bits (63), Expect = 2e-26 Identities = 70/71 (98%), Gaps = 1/71 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1913 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1855 Query: 66 gatgcggttat 76 ||||||||||| Sbjct: 1854 gatgcggttat 1844
>gb|AY095466.1| Peumus boldus 26S ribosomal RNA gene, partial sequence Length = 3320 Score = 121 bits (61), Expect = 3e-25 Identities = 74/77 (96%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| ||||||||||||||||||||||| Sbjct: 1903 cgttttgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttgga 1845 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1844 gacctgatgcggttatg 1828
>gb|AY095453.1| Cabomba sp. MJZ-2002 26S ribosomal RNA gene, partial sequence Length = 3312 Score = 121 bits (61), Expect = 3e-25 Identities = 74/77 (96%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| ||||||| |||||||||||||||||||||||||||||| Sbjct: 1898 cgttttgccgacttcccttgc-ctacatttttccattggccagaggctgttcaccttgga 1840 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1839 gacctgatgcggttatg 1823
>gb|AY292914.1| Alisma sp. YLQ-2003 26S ribosomal RNA gene, partial sequence Length = 3534 Score = 121 bits (61), Expect = 3e-25 Identities = 74/77 (96%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||| ||||||||||||||||||||| Sbjct: 2097 cgttttgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttgga 2039 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 2038 gacctgatgcggttatg 2022
>gb|AY292903.1| Cabomba sp. YLQ-2003 26S ribosomal RNA gene, partial sequence Length = 3327 Score = 121 bits (61), Expect = 3e-25 Identities = 74/77 (96%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| ||||||| |||||||||||||||||||||||||||||| Sbjct: 1898 cgttttgccgacttcccttgc-ctacatttttccattggccagaggctgttcaccttgga 1840 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1839 gacctgatgcggttatg 1823
>gb|AY292892.1| Peumus boldus 26S ribosomal RNA gene, partial sequence Length = 3335 Score = 121 bits (61), Expect = 3e-25 Identities = 74/77 (96%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| ||||||||||||||||||||||| Sbjct: 1903 cgttttgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttgga 1845 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1844 gacctgatgcggttatg 1828
>gb|DQ008651.1| Alisma plantago-aquatica 26S ribosomal RNA gene, partial sequence Length = 3024 Score = 121 bits (61), Expect = 3e-25 Identities = 74/77 (96%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||| ||||||||||||||||||||| Sbjct: 1760 cgttttgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttgga 1702 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1701 gacctgatgcggttatg 1685
>gb|DQ008646.1| Asparagus officinalis 26S ribosomal RNA gene, partial sequence Length = 2071 Score = 121 bits (61), Expect = 3e-25 Identities = 74/77 (96%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 1268 cgttttgccgacttcccttgc-ctacattgctccattggccagaggctgttcaccttgga 1210 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1209 gacctgatgcggttatg 1193
>gb|DQ008639.1| Anemopsis californica 26S ribosomal RNA gene, partial sequence Length = 2037 Score = 121 bits (61), Expect = 3e-25 Identities = 74/77 (96%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| | Sbjct: 1266 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgaa 1208 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1207 gacctgatgcggttatg 1191
>gb|AF479239.1| Cabomba caroliniana 26S ribosomal RNA gene, complete sequence Length = 3327 Score = 121 bits (61), Expect = 3e-25 Identities = 74/77 (96%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| ||||||| |||||||||||||||||||||||||||||| Sbjct: 1898 cgttttgccgacttcccttgc-ctacatttttccattggccagaggctgttcaccttgga 1840 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1839 gacctgatgcggttatg 1823
>gb|AF479091.1| Triphyophyllum peltatum 26S ribosomal RNA gene, complete sequence Length = 3311 Score = 121 bits (61), Expect = 3e-25 Identities = 74/77 (96%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| ||||||||||||||||||||||| Sbjct: 1892 cgttttgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttgga 1834 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1833 gacctgatgcggttatg 1817
>dbj|AK110009.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-159-G06, full insert sequence Length = 2893 Score = 121 bits (61), Expect = 3e-25 Identities = 74/77 (96%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1359 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1301 Query: 61 gacctgatgcggttatg 77 |||||| |||||||||| Sbjct: 1300 gacctggtgcggttatg 1284
>gb|AF389273.1| Eubrachion ambiguum 26S ribosomal RNA gene, partial sequence Length = 3339 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| Sbjct: 1901 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1843 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1842 gatgcggttatg 1831
>gb|AF389261.1| Schoepfia schreberi 26S ribosomal RNA gene, partial sequence Length = 3334 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| Sbjct: 1898 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1840 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1839 gatgcggttatg 1828
>gb|AF389258.1| Tinospora caffra 26S ribosomal RNA gene, partial sequence Length = 3339 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| Sbjct: 1899 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1841 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1840 gatgcggttatg 1829
>gb|AY727968.1| Clethra cf. ferruginea JS-2005 26S ribosomal RNA gene, partial sequence Length = 3330 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| Sbjct: 1894 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1836 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1835 gatgcggttatg 1824
>gb|AY727966.1| Heliamphora minor 26S ribosomal RNA gene, partial sequence Length = 3293 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| Sbjct: 1857 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1799 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1798 gatgcggttatg 1787
>gb|AY727948.1| Pouteria campechiana 26S ribosomal RNA gene, partial sequence Length = 3258 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| Sbjct: 1822 tgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttggagacct 1764 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1763 gatgcggttatg 1752
>gb|AY260030.1| Mentzelia decapetala 26S ribosomal RNA gene, complete sequence Length = 3363 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| Sbjct: 1903 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1845 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1844 gatgcggttatg 1833
>gb|AY957453.1| Santalum album 26S ribosomal RNA gene, partial sequence Length = 3306 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| Sbjct: 1892 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1834 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1833 gatgcggttatg 1822
>gb|AF274669.1| Tetracarpaea tasmanica 26S ribosomal RNA gene, complete sequence Length = 3361 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| Sbjct: 1912 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1854 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1853 gatgcggttatg 1842
>gb|AF274655.1| Myriophyllum exalbescens 26S ribosomal RNA gene, complete sequence Length = 3358 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| Sbjct: 1911 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1853 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1852 gatgcggttatg 1841
>gb|AF297542.1|AF297542 Cornus volkensii 26S ribosomal RNA gene, partial sequence Length = 3361 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| Sbjct: 1922 tgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttggagacct 1864 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1863 gatgcggttatg 1852
>gb|DQ008654.1| Acorus calamus 26S ribosomal RNA gene, partial sequence Length = 2921 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| Sbjct: 1857 tgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttggagacct 1799 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1798 gatgcggttatg 1787
>gb|DQ008648.1| Carludovica palmata 26S ribosomal RNA gene, partial sequence Length = 2401 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 1263 tgccgacttcccttgc-ctacattgttccattggacagaggctgttcaccttggagacct 1205 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1204 gatgcggttatg 1193
>gb|DQ008613.1| Mahonia bealei 26S ribosomal RNA gene, partial sequence Length = 3227 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| Sbjct: 1854 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1796 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1795 gatgcggttatg 1784
>gb|AF479190.1| Codonopsis pilosula 26S ribosomal RNA gene, complete sequence Length = 3327 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| Sbjct: 1876 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1818 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1817 gatgcggttatg 1806
>gb|AF479186.1| Nymphoides geminata 26S ribosomal RNA gene, complete sequence Length = 3200 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| Sbjct: 1742 tgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttggagacct 1684 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1683 gatgcggttatg 1672
>gb|AF479177.1| Hydrolea ovata 26S ribosomal RNA gene, complete sequence Length = 3331 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| Sbjct: 1876 tgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttggagacct 1818 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1817 gatgcggttatg 1806
>gb|AF479173.1| Schizanthus pinnatus 26S ribosomal RNA gene, complete sequence Length = 3307 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| Sbjct: 1892 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1834 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1833 gatgcggttatg 1822
>gb|AF479171.1| Olea europaea 26S ribosomal RNA gene, partial sequence Length = 1603 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| Sbjct: 144 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 86 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 85 gatgcggttatg 74
>gb|AF479150.1| Androsace spinulifera 26S ribosomal RNA gene, complete sequence Length = 3349 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| Sbjct: 1892 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1834 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1833 gatgcggttatg 1822
>gb|AF479113.1| Euonymus alatus 26S ribosomal RNA gene, complete sequence Length = 3357 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AF479106.1| Alnus glutinosa 26S ribosomal RNA gene, complete sequence Length = 3365 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| Sbjct: 1915 tgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttggagacct 1857 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1856 gatgcggttatg 1845
>gb|AF479102.1| Ceanothus sanguineus 26S ribosomal RNA gene, complete sequence Length = 3365 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| Sbjct: 1907 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1849 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1848 gatgcggttatg 1837
>gb|AF479085.1| Polygonum sachalinense 26S ribosomal RNA gene, complete sequence Length = 3347 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AF181819.1|AF181819 Acanthosyris asipapote 26S ribosomal RNA, partial sequence Length = 402 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| Sbjct: 167 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 109 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 108 gatgcggttatg 97
>gb|AF181810.1|AF181810 Phoradendron sulfuratum 26S ribosomal RNA, partial sequence Length = 395 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| Sbjct: 165 tgccgacttcccttgc-ctacattgttccatgggccagaggctgttcaccttggagacct 107 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 106 gatgcggttatg 95
>gb|AF181809.1|AF181809 Phoradendron cf. tonduzii 26S ribosomal RNA, partial sequence Length = 402 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| Sbjct: 167 tgccgacttcccttgc-ctacattgttccatgggccagaggctgttcaccttggagacct 109 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 108 gatgcggttatg 97
>gb|AF181808.1|AF181808 Phoradendron nervosum 26S ribosomal RNA, partial sequence Length = 402 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| Sbjct: 167 tgccgacttcccttgc-ctacattgttccatgggccagaggctgttcaccttggagacct 109 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 108 gatgcggttatg 97
>gb|AF181807.1|AF181807 Phoradendron carneum 26S ribosomal RNA, partial sequence Length = 402 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| Sbjct: 167 tgccgacttcccttgc-ctacattgttccatgggccagaggctgttcaccttggagacct 109 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 108 gatgcggttatg 97
>gb|AF181805.1|AF181805 Phoradendron tamaulipense 26S ribosomal RNA, partial sequence Length = 402 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| Sbjct: 167 tgccgacttcccttgc-ctacattgttccatgggccagaggctgttcaccttggagacct 109 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 108 gatgcggttatg 97
>gb|AF181804.1|AF181804 Phoradendron heydeanum 26S ribosomal RNA, partial sequence Length = 401 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| Sbjct: 167 tgccgacttcccttgc-ctacattgttccatgggccagaggctgttcaccttggagacct 109 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 108 gatgcggttatg 97
>gb|AF036490.1| Acorus gramineus large subunit 26S ribosomal RNA gene, partial sequence Length = 3213 Score = 119 bits (60), Expect = 1e-24 Identities = 70/72 (97%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| Sbjct: 1920 tgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttggagacct 1862 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1861 gatgcggttatg 1850
>emb|AJ309824.2|ZMA309824 Zea mays 25S rRNA gene and transposon-like sequence Length = 10658 Score = 115 bits (58), Expect = 2e-23 Identities = 75/78 (96%), Gaps = 2/78 (2%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagagg-ctgttcaccttgg 59 |||| |||||||||||||||| |||||||||||||||||||||||| ||||||||||||| Sbjct: 9151 cgttttgccgacttcccttgc-ctacattgttccattggccagaggtctgttcaccttgg 9093 Query: 60 agacctgatgcggttatg 77 |||||||||||||||||| Sbjct: 9092 agacctgatgcggttatg 9075
>gb|AF389243.1| Buxus sempervirens 26S ribosomal RNA gene, partial sequence Length = 3319 Score = 113 bits (57), Expect = 7e-23 Identities = 73/77 (94%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| | ||||||||||||||||||||| Sbjct: 1885 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1827 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1826 gacctgatgcggttatg 1810
>gb|AY095470.1| Trimenia moorei 26S ribosomal RNA gene, partial sequence Length = 3308 Score = 113 bits (57), Expect = 7e-23 Identities = 73/77 (94%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| | ||||||||||||||||||||| Sbjct: 1899 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1841 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1840 gacctgatgcggttatg 1824
>gb|AY095454.1| Calycanthus occidentalis 26S ribosomal RNA gene, partial sequence Length = 3202 Score = 113 bits (57), Expect = 7e-23 Identities = 73/77 (94%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| | ||||||||||||||||||||| Sbjct: 1791 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1733 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1732 gacctgatgcggttatg 1716
>gb|AY292911.1| Buxus sp. YLQ-2003 26S ribosomal RNA gene, partial sequence Length = 3216 Score = 113 bits (57), Expect = 7e-23 Identities = 73/77 (94%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| | ||||||||||||||||||||| Sbjct: 1792 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1734 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1733 gacctgatgcggttatg 1717
>gb|AY292895.1| Peperomia sp. YLQ-2003 26S ribosomal RNA gene, partial sequence Length = 3494 Score = 113 bits (57), Expect = 7e-23 Identities = 73/77 (94%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| | ||||||||||||||||||||| Sbjct: 2047 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1989 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1988 gacctgatgcggttatg 1972
>gb|AY292891.1| Hedycarya sp. YLQ-2003 26S ribosomal RNA gene, partial sequence Length = 3408 Score = 113 bits (57), Expect = 7e-23 Identities = 73/77 (94%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| | ||||||||||||||||||||| Sbjct: 2051 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1993 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1992 gacctgatgcggttatg 1976
>gb|AY292890.1| Calycanthus sp. YLQ-2003 26S ribosomal RNA gene, partial sequence Length = 3217 Score = 113 bits (57), Expect = 7e-23 Identities = 73/77 (94%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| | ||||||||||||||||||||| Sbjct: 1791 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1733 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1732 gacctgatgcggttatg 1716
>gb|AF274663.1| Pterostemon rotundifolius 26S ribosomal RNA gene, complete sequence Length = 3365 Score = 113 bits (57), Expect = 7e-23 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1913 tgccgacttcccttgc-ctacattgttccatngaccagaggctgttcaccttggagacct 1855 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1854 gatgcggttatg 1843
>gb|DQ008659.1| Illicium floridanum 26S ribosomal RNA gene, partial sequence Length = 2067 Score = 113 bits (57), Expect = 7e-23 Identities = 73/77 (94%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| | ||||||||||||||||||||| Sbjct: 1270 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1212 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1211 gacctgatgcggttatg 1195
>gb|DQ008658.1| Schisandra sphenanthera 26S ribosomal RNA gene, partial sequence Length = 3115 Score = 113 bits (57), Expect = 7e-23 Identities = 73/77 (94%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| | ||||||||||||||||||||| Sbjct: 1894 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1836 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1835 gacctgatgcggttatg 1819
>gb|DQ008644.1| Saruma henryi 26S ribosomal RNA gene, partial sequence Length = 3260 Score = 113 bits (57), Expect = 7e-23 Identities = 73/77 (94%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| | ||||||||||||||||||||| Sbjct: 1869 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1811 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1810 gacctgatgcggttatg 1794
>gb|DQ008643.1| Asarum canadense 26S ribosomal RNA gene, partial sequence Length = 2247 Score = 113 bits (57), Expect = 7e-23 Identities = 73/77 (94%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| | ||||||||||||||||||||| Sbjct: 1769 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1711 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1710 gacctgatgcggttatg 1694
>gb|DQ008633.1| Idiospermum australiense 26S ribosomal RNA gene, partial sequence Length = 2408 Score = 113 bits (57), Expect = 7e-23 Identities = 73/77 (94%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| | ||||||||||||||||||||| Sbjct: 1270 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1212 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1211 gacctgatgcggttatg 1195
>gb|DQ008631.1| Siparuna decipiens 26S ribosomal RNA gene, partial sequence Length = 2357 Score = 113 bits (57), Expect = 7e-23 Identities = 73/77 (94%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| | ||||||||||||||||||||| Sbjct: 1223 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1165 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1164 gacctgatgcggttatg 1148
>gb|DQ008630.1| Doryphora sassafras 26S ribosomal RNA gene, partial sequence Length = 2064 Score = 113 bits (57), Expect = 7e-23 Identities = 73/77 (94%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| | ||||||||||||||||||||| Sbjct: 1267 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1209 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1208 gacctgatgcggttatg 1192
>gb|DQ008629.1| Daphnandra micrantha 26S ribosomal RNA gene, partial sequence Length = 2376 Score = 113 bits (57), Expect = 7e-23 Identities = 73/77 (94%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| | ||||||||||||||||||||| Sbjct: 1246 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1188 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1187 gacctgatgcggttatg 1171
>gb|DQ008627.1| Cryptocarya meissneriana 26S ribosomal RNA gene, partial sequence Length = 2065 Score = 113 bits (57), Expect = 7e-23 Identities = 73/77 (94%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| | ||||||||||||||||||||| Sbjct: 1268 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1210 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1209 gacctgatgcggttatg 1193
>gb|DQ008626.1| Laurus nobilis 26S ribosomal RNA gene, partial sequence Length = 2064 Score = 113 bits (57), Expect = 7e-23 Identities = 73/77 (94%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| | ||||||||||||||||||||| Sbjct: 1267 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1209 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1208 gacctgatgcggttatg 1192
>gb|DQ008624.1| Gyrocarpus americanus 26S ribosomal RNA gene, partial sequence Length = 2939 Score = 113 bits (57), Expect = 7e-23 Identities = 73/77 (94%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| | ||||||||||||||||||||| Sbjct: 1490 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1432 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1431 gacctgatgcggttatg 1415
>gb|AF479223.1| Myrothamnus flabellifolius 26S ribosomal RNA gene, partial sequence Length = 2775 Score = 113 bits (57), Expect = 7e-23 Identities = 73/77 (94%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| | ||||||||||||||||||||| Sbjct: 1913 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1855 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1854 gacctgatgcggttatg 1838
>gb|AF479097.1| Tetracera asiatica 26S ribosomal RNA gene, complete sequence Length = 3052 Score = 113 bits (57), Expect = 7e-23 Identities = 73/77 (94%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||| | ||||||||||||||||||||| Sbjct: 1910 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1852 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 1851 gacctgatgcggttatg 1835
>dbj|AK107285.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-126-B05, full insert sequence Length = 1586 Score = 113 bits (57), Expect = 7e-23 Identities = 64/65 (98%), Gaps = 1/65 (1%) Strand = Plus / Minus Query: 13 ttcccttgcactacattgttccattggccagaggctgttcaccttggagacctgatgcgg 72 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 520 ttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacctgatgcgg 462 Query: 73 ttatg 77 ||||| Sbjct: 461 ttatg 457
>gb|M35386.1|RICRGC4 Rice 25S rRNA gene Length = 161 Score = 113 bits (57), Expect = 7e-23 Identities = 73/77 (94%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 1 cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60 |||| |||||||||||||||| |||||||||||||||||||||||| |||||||||||| Sbjct: 156 cgttttgccgacttcccttgc-ctacattgttccattggccagaggtcgttcaccttgga 98 Query: 61 gacctgatgcggttatg 77 ||||||||||||||||| Sbjct: 97 gacctgatgcggttatg 81
>gb|DQ287987.1| Abutilon theophrasti 26S ribosomal RNA gene, partial sequence Length = 672 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 213 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 155 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 154 gatgcggttatg 143
>gb|AY530924.1| Cornus capitata 26S ribosomal RNA gene, complete sequence Length = 3329 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1818 gatgcggttatg 1807
>gb|AY555065.1| Corchorus olitorius 26S ribosomal RNA gene, partial sequence Length = 1010 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 127 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 69 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 68 gatgcggttatg 57
>gb|AF389276.1| Sarracenia purpurea 26S ribosomal RNA gene, partial sequence Length = 3333 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1898 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1840 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1839 gatgcggttatg 1828
>gb|AF389272.1| Sabia swinhoei 26S ribosomal RNA gene, partial sequence Length = 3340 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1905 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1847 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1846 gatgcggttatg 1835
>gb|AF389271.1| Meliosma veitchiorum 26S ribosomal RNA gene, partial sequence Length = 3338 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1905 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1847 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1846 gatgcggttatg 1835
>gb|AF389270.1| Xanthorhiza simplicissima 26S ribosomal RNA gene, partial sequence Length = 3338 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AF389268.1| Hydrastis canadensis 26S ribosomal RNA gene, partial sequence Length = 3340 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1899 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1841 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1840 gatgcggttatg 1829
>gb|AF389267.1| Glaucidium palmatum 26S ribosomal RNA gene, partial sequence Length = 3337 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AF389266.1| Coptis trifolia 26S ribosomal RNA gene, partial sequence Length = 3338 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AF389265.1| Roupala macrophylla 26S ribosomal RNA gene, partial sequence Length = 3344 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1905 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1847 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1846 gatgcggttatg 1835
>gb|AF389264.1| Pteridophyllum racemosum 26S ribosomal RNA gene, partial sequence Length = 3342 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1900 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1842 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1841 gatgcggttatg 1830
>gb|AF389262.1| Dicentra eximia 26S ribosomal RNA gene, partial sequence Length = 3341 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1900 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1842 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1841 gatgcggttatg 1830
>gb|AF389260.1| Nepenthes sp. Nickrent 3056 26S ribosomal RNA gene, partial sequence Length = 3325 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1895 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1837 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1836 gatgcggttatg 1825
>gb|AF389256.1| Magnolia denudata 26S ribosomal RNA gene, partial sequence Length = 3340 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1899 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1841 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1840 gatgcggttatg 1829
>gb|AF389255.1| Sinofranchetia chinensis 26S ribosomal RNA gene, partial sequence Length = 3342 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1899 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1841 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1840 gatgcggttatg 1829
>gb|AF389252.1| Philadelphus lewisii 26S ribosomal RNA gene, partial sequence Length = 3332 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AF389251.1| Galbulimima belgraveana 26S ribosomal RNA gene, partial sequence Length = 3349 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1905 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1847 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1846 gatgcggttatg 1835
>gb|AF389250.1| Gunnera manicata 26S ribosomal RNA gene, partial sequence Length = 3335 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AF389249.1| Euptelea polyandra 26S ribosomal RNA gene, partial sequence Length = 3343 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1903 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1845 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1844 gatgcggttatg 1833
>gb|AF389248.1| Drosera capensis 26S ribosomal RNA gene, partial sequence Length = 3334 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1902 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1844 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1843 gatgcggttatg 1832
>gb|AF389247.1| Didymeles perrieri 26S ribosomal RNA gene, partial sequence Length = 3326 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1892 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1834 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1833 gatgcggttatg 1822
>gb|AF389244.1| Pachysandra procumbens 26S ribosomal RNA gene, partial sequence Length = 3334 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1896 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1838 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1837 gatgcggttatg 1826
>gb|AF389242.1| Berberidopsis corallina 26S ribosomal RNA gene, partial sequence Length = 3335 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1899 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1841 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1840 gatgcggttatg 1829
>gb|AF389239.1| Aextoxicon punctatum 26S ribosomal RNA gene, partial sequence Length = 3335 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1899 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1841 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1840 gatgcggttatg 1829
>gb|AY189151.1| Pittosporum tobira 26S large subunit ribosomal RNA gene, partial sequence Length = 3307 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1819 gatgcggttatg 1808
>gb|AY189116.1| Tupidanthus calyptratus 26S large subunit ribosomal RNA gene, partial sequence Length = 3288 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1873 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1815 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1814 gatgcggttatg 1803
>gb|AY189115.1| Trevesia palmata 26S large subunit ribosomal RNA gene, partial sequence Length = 3287 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1818 gatgcggttatg 1807
>gb|AY189114.1| Trachymene coerulea 26S large subunit ribosomal RNA gene, partial sequence Length = 3311 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1819 gatgcggttatg 1808
>gb|AY189112.1| Tetraplasandra hawaiensis 26S large subunit ribosomal RNA gene, partial sequence Length = 3292 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1876 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1818 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1817 gatgcggttatg 1806
>gb|AY189109.1| Sollya heterophylla 26S large subunit ribosomal RNA gene, partial sequence Length = 3286 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1879 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1821 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1820 gatgcggttatg 1809
>gb|AY189108.1| Schefflera arboricola 26S large subunit ribosomal RNA gene, partial sequence Length = 3290 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1873 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1815 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1814 gatgcggttatg 1803
>gb|AY189107.1| Sanicula gregari 26S large subunit ribosomal RNA gene, partial sequence Length = 3295 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1879 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1821 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1820 gatgcggttatg 1809
>gb|AY189106.1| Rhytidosporum alpinum 26S large subunit ribosomal RNA gene, partial sequence Length = 3302 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1870 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1812 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1811 gatgcggttatg 1800
>gb|AY189105.1| Reynoldsia sandwicensis 26S large subunit ribosomal RNA gene, partial sequence Length = 3310 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1818 gatgcggttatg 1807
>gb|AY189104.1| Pseudosciadium balansae 26S large subunit ribosomal RNA gene, partial sequence Length = 3310 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1819 gatgcggttatg 1808
>gb|AY189103.1| Pseudopanax arboreus 26S large subunit ribosomal RNA gene, partial sequence Length = 3286 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1818 gatgcggttatg 1807
>gb|AY189102.1| Polyscias guilfoylei 26S large subunit ribosomal RNA gene, partial sequence Length = 3295 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1818 gatgcggttatg 1807
>gb|AY189100.1| Pimpinella saxifraga 26S large subunit ribosomal RNA gene, partial sequence Length = 3310 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1818 gatgcggttatg 1807
>gb|AY189097.1| Osmoxylon novoguineense 26S large subunit ribosomal RNA gene, partial sequence Length = 3300 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1819 gatgcggttatg 1808
>gb|AY189096.1| Neogoezia minor 26S large subunit ribosomal RNA gene, partial sequence Length = 3288 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1819 gatgcggttatg 1808
>gb|AY189092.1| Mulinum ulicinum 26S large subunit ribosomal RNA gene, partial sequence Length = 3255 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1855 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1797 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1796 gatgcggttatg 1785
>gb|AY189091.1| Mulinum spinosum 26S large subunit ribosomal RNA gene, partial sequence Length = 3301 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1853 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1795 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1794 gatgcggttatg 1783
>gb|AY189090.1| Mulinum chillanense 26S large subunit ribosomal RNA gene, partial sequence Length = 3269 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1848 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1790 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1789 gatgcggttatg 1778
>gb|AY189088.1| Motherwellia haplosciadea 26S large subunit ribosomal RNA gene, partial sequence Length = 3311 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1818 gatgcggttatg 1807
>gb|AY189085.1| Melanophylla alnifolia 26S large subunit ribosomal RNA gene, partial sequence Length = 3260 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1818 gatgcggttatg 1807
>gb|AY189081.1| Lagoecia cuminoides 26S large subunit ribosomal RNA gene, partial sequence Length = 3310 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1818 gatgcggttatg 1807
>gb|AY189080.1| Kalopanax pictus 26S large subunit ribosomal RNA gene, partial sequence Length = 3288 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1819 gatgcggttatg 1808
>gb|AY189079.1| Hymenosporum flavum 26S large subunit ribosomal RNA gene, partial sequence Length = 3305 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1875 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1817 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1816 gatgcggttatg 1805
>gb|AY189077.1| Hydrocotyle modesta 26S large subunit ribosomal RNA gene, partial sequence Length = 3223 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1846 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1788 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1787 gatgcggttatg 1776
>gb|AY189076.1| Hydrocotyle bowlesioides 26S large subunit ribosomal RNA gene, partial sequence Length = 3295 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1819 gatgcggttatg 1808
>gb|AY189075.1| Huanaca acaulis 26S large subunit ribosomal RNA gene, partial sequence Length = 3292 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1872 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1814 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1813 gatgcggttatg 1802
>gb|AY189074.1| Heteromorpha trifoliata 26S large subunit ribosomal RNA gene, partial sequence Length = 3295 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1819 gatgcggttatg 1808
>gb|AY189073.1| Hedera helix 26S large subunit ribosomal RNA gene, partial sequence Length = 3277 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1818 gatgcggttatg 1807
>gb|AY189072.1| Gymnophyton polycephalum 26S large subunit ribosomal RNA gene, partial sequence Length = 3277 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1870 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1812 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1811 gatgcggttatg 1800
>gb|AY189071.1| Griselinia lucida 26S large subunit ribosomal RNA gene, partial sequence Length = 3312 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1819 gatgcggttatg 1808
>gb|AY189070.1| Gastonia rodriguesiana 26S large subunit ribosomal RNA gene, partial sequence Length = 3229 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1822 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1764 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1763 gatgcggttatg 1752
>gb|AY189068.1| Eryngium bourgattii 26S large subunit ribosomal RNA gene, partial sequence Length = 3285 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1875 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1817 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1816 gatgcggttatg 1805
>gb|AY189067.1| Eremocharis fruticosa 26S large subunit ribosomal RNA gene, partial sequence Length = 3285 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1819 gatgcggttatg 1808
>gb|AY189066.1| Endressia castellana 26S large subunit ribosomal RNA gene, partial sequence Length = 3309 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1876 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1818 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1817 gatgcggttatg 1806
>gb|AY189065.1| Eleutherococcus trifoliatus 26S large subunit ribosomal RNA gene, partial sequence Length = 3293 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1819 gatgcggttatg 1808
>gb|AY189064.1| Donnellsmithia cordata 26S large subunit ribosomal RNA gene, partial sequence Length = 3310 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1818 gatgcggttatg 1807
>gb|AY189063.1| Diplaspis hydrocotyle 26S large subunit ribosomal RNA gene, partial sequence Length = 3310 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1819 gatgcggttatg 1808
>gb|AY189062.1| Dickinsia hydrocotyloides 26S large subunit ribosomal RNA gene, partial sequence Length = 3282 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1875 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1817 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1816 gatgcggttatg 1805
>gb|AY189060.1| Dendropanax arboreus 26S large subunit ribosomal RNA gene, partial sequence Length = 3283 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1874 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1816 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1815 gatgcggttatg 1804
>gb|AY189059.1| Delarbrea collina 26S large subunit ribosomal RNA gene, partial sequence Length = 3313 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1818 gatgcggttatg 1807
>gb|AY189057.1| Cussonia spicata 26S large subunit ribosomal RNA gene, partial sequence Length = 3304 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1819 gatgcggttatg 1808
>gb|AY189056.1| Coriandrum sativum 26S large subunit ribosomal RNA gene, partial sequence Length = 3310 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1818 gatgcggttatg 1807
>gb|AY189055.1| Cheirodendron trigynum 26S large subunit ribosomal RNA gene, partial sequence Length = 3291 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1818 gatgcggttatg 1807
>gb|AY189053.1| Bupleurum falcatum 26S large subunit ribosomal RNA gene, partial sequence Length = 3309 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1818 gatgcggttatg 1807
>gb|AY189048.1| Azorella trifurcata 26S large subunit ribosomal RNA gene, partial sequence Length = 3260 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1846 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1788 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1787 gatgcggttatg 1776
>gb|AY189046.1| Azorella selago 26S large subunit ribosomal RNA gene, partial sequence Length = 3309 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1818 gatgcggttatg 1807
>gb|AY189044.1| Azorella macquariensis 26S large subunit ribosomal RNA gene, partial sequence Length = 3260 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1870 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1812 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1811 gatgcggttatg 1800
>gb|AY189042.1| Azorella fuegiana 26S large subunit ribosomal RNA gene, partial sequence Length = 2730 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1848 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1790 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1789 gatgcggttatg 1778
>gb|AY189040.1| Astrantia major 26S large subunit ribosomal RNA gene, partial sequence Length = 3312 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1819 gatgcggttatg 1808
>gb|AY189038.1| Arracacia aegopodioides 26S large subunit ribosomal RNA gene, partial sequence Length = 3291 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1818 gatgcggttatg 1807
>gb|AY189035.1| Aralia spinosa 26S large subunit ribosomal RNA gene, partial sequence Length = 3295 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1818 gatgcggttatg 1807
>gb|AY189034.1| Apium graveolens 26S large subunit ribosomal RNA gene, partial sequence Length = 3310 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1818 gatgcggttatg 1807
>gb|AY189031.1| Angelica lucida 26S large subunit ribosomal RNA gene, partial sequence Length = 3275 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1876 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1818 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1817 gatgcggttatg 1806
>gb|AY189030.1| Aegopodium podagraria 26S large subunit ribosomal RNA gene, partial sequence Length = 3288 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1819 gatgcggttatg 1808
>gb|AY189029.1| Actinotus helianthi 26S large subunit ribosomal RNA gene, partial sequence Length = 3310 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1876 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1818 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1817 gatgcggttatg 1806
>gb|AY189028.1| Aciphylla aurea 26S large subunit ribosomal RNA gene, partial sequence Length = 3308 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1818 gatgcggttatg 1807
>gb|AY727986.1| Diapensia lapponica 26S ribosomal RNA gene, partial sequence Length = 3329 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1895 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1837 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1836 gatgcggttatg 1825
>gb|AY727985.1| Shortia uniflora 26S ribosomal RNA gene, partial sequence Length = 3327 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1893 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1835 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1834 gatgcggttatg 1823
>gb|AY727984.1| Shortia soldanelloides 26S ribosomal RNA gene, partial sequence Length = 3329 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1895 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1837 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1836 gatgcggttatg 1825
>gb|AY727983.1| Galax urceolata 26S ribosomal RNA gene, partial sequence Length = 3329 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AY727982.1| Bruinsmia styracoides 26S ribosomal RNA gene, partial sequence Length = 3335 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1899 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1841 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1840 gatgcggttatg 1829
>gb|AY727981.1| Halesia carolina 26S ribosomal RNA gene, partial sequence Length = 3333 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AY727980.1| Styrax japonicus 26S ribosomal RNA gene, partial sequence Length = 3335 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AY727979.1| Symplocos pendula 26S ribosomal RNA gene, partial sequence Length = 3331 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AY727978.1| Symplocos zizyphoides 26S ribosomal RNA gene, partial sequence Length = 3304 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1870 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1812 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1811 gatgcggttatg 1800
>gb|AY727977.1| Gordonia lasianthus 26S ribosomal RNA gene, partial sequence Length = 3335 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AY727976.1| Schima sp. JS-2005 26S ribosomal RNA gene, partial sequence Length = 3335 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AY727975.1| Camellia sinensis 26S ribosomal RNA gene, partial sequence Length = 3336 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1898 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1840 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1839 gatgcggttatg 1828
>gb|AY727974.1| Vaccinium myrtillus 26S ribosomal RNA gene, partial sequence Length = 3320 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1886 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1828 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1827 gatgcggttatg 1816
>gb|AY727973.1| Rhododendron impeditum 26S ribosomal RNA gene, partial sequence Length = 3334 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1898 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1840 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1839 gatgcggttatg 1828
>gb|AY727972.1| Empetrum hermaphroditum 26S ribosomal RNA gene, partial sequence Length = 3334 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1898 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1840 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1839 gatgcggttatg 1828
>gb|AY727971.1| Chimaphila umbellata 26S ribosomal RNA gene, partial sequence Length = 3331 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AY727970.1| Enkianthus campanulatus 26S ribosomal RNA gene, partial sequence Length = 3333 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AY727969.1| Cyrilla racemiflora 26S ribosomal RNA gene, partial sequence Length = 3331 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AY727967.1| Sarracenia psittacina 26S ribosomal RNA gene, partial sequence Length = 3336 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1899 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1841 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1840 gatgcggttatg 1829
>gb|AY727965.1| Roridula gorgonias 26S ribosomal RNA gene, partial sequence Length = 3264 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1830 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1772 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1771 gatgcggttatg 1760
>gb|AY727964.1| Actinidia arguta 26S ribosomal RNA gene, partial sequence Length = 3325 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1888 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1830 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1829 gatgcggttatg 1818
>gb|AY727963.1| Lysimachia vulgaris 26S ribosomal RNA gene, partial sequence Length = 3333 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AY727962.1| Clavija lancifolia 26S ribosomal RNA gene, partial sequence Length = 3336 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1898 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1840 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1839 gatgcggttatg 1828
>gb|AY727961.1| Myrsine africana 26S ribosomal RNA gene, partial sequence Length = 3333 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AY727960.1| Primula elatior 26S ribosomal RNA gene, partial sequence Length = 3333 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AY727959.1| Maesa japonica 26S ribosomal RNA gene, partial sequence Length = 3333 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AY727958.1| Samolus valerandi 26S ribosomal RNA gene, partial sequence Length = 3333 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1895 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1837 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1836 gatgcggttatg 1825
>gb|AY727956.1| Lissocarpa benthamii 26S ribosomal RNA gene, partial sequence Length = 3330 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1894 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1836 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1835 gatgcggttatg 1824
>gb|AY727955.1| Ternstroemia stahlii 26S ribosomal RNA gene, partial sequence Length = 3334 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1898 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1840 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1839 gatgcggttatg 1828
>gb|AY727954.1| Pentaphylax euryoides 26S ribosomal RNA gene, partial sequence Length = 3256 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1820 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1762 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1761 gatgcggttatg 1750
>gb|AY727953.1| Eurya japonica 26S ribosomal RNA gene, partial sequence Length = 3262 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1826 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1768 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1767 gatgcggttatg 1756
>gb|AY727952.1| Cleyera japonica 26S ribosomal RNA gene, partial sequence Length = 3333 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgcccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AY727951.1| Napoleona sp. JS-2005 26S ribosomal RNA gene, partial sequence Length = 3333 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AY727950.1| Couroupita guianensis 26S ribosomal RNA gene, partial sequence Length = 3332 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1898 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1840 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1839 gatgcggttatg 1828
>gb|AY727949.1| Barringtonia asiatica 26S ribosomal RNA gene, partial sequence Length = 3331 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AY727947.1| Madhuca microphylla 26S ribosomal RNA gene, partial sequence Length = 3333 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AY727946.1| Manilkara zapota 26S ribosomal RNA gene, partial sequence Length = 3332 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1896 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1838 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1837 gatgcggttatg 1826
>gb|AY727945.1| Palaquium ferox 26S ribosomal RNA gene, partial sequence Length = 3337 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1900 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1842 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1841 gatgcggttatg 1830
>gb|AY727940.1| Fouquieria fasciculata 26S ribosomal RNA gene, partial sequence Length = 3329 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AY727939.1| Fouquieria columnaris 26S ribosomal RNA gene, partial sequence Length = 3329 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AY727938.1| Norantea guianensis 26S ribosomal RNA gene, partial sequence Length = 3330 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1838 gatgcggttatg 1827
>gb|AY727937.1| Marcgravia rectiflora 26S ribosomal RNA gene, partial sequence Length = 3332 Score = 111 bits (56), Expect = 3e-22 Identities = 69/72 (95%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 6 tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65 |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| Sbjct: 1898 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1840 Query: 66 gatgcggttatg 77 |||||||||||| Sbjct: 1839 gatgcggttatg 1828 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 490,005 Number of Sequences: 3902068 Number of extensions: 490005 Number of successful extensions: 39182 Number of sequences better than 10.0: 3204 Number of HSP's better than 10.0 without gapping: 3078 Number of HSP's successfully gapped in prelim test: 126 Number of HSP's that attempted gapping in prelim test: 33251 Number of HSP's gapped (non-prelim): 4271 length of query: 77 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 56 effective length of database: 17,151,101,840 effective search space: 960461703040 effective search space used: 960461703040 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)