ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast37h05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT018529.1| Zea mays clone EL01N0433D12.d mRNA sequence 129 1e-27
2gb|AY095465.1| Nymphaea sp. MJZ-2002 26S ribosomal RNA gene, par... 129 1e-27
3gb|AY292901.1| Nuphar sp. YLQ-2003 26S ribosomal RNA gene, parti... 129 1e-27
4gb|AY292900.1| Nymphaea sp. YLQ-2003 26S ribosomal RNA gene, par... 129 1e-27
5dbj|AP008225.1| Oryza sativa (japonica cultivar-group) genomic D... 129 1e-27
6gb|AY049041.1| Triticum aestivum 28S ribosomal RNA gene, partial... 129 1e-27
7gb|DQ008647.1| Croomia pauciflora 26S ribosomal RNA gene, partia... 129 1e-27
8dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 129 1e-27
9dbj|AP008245.2| Oryza sativa (japonica cultivar-group) genomic D... 129 1e-27
10dbj|AP004778.3| Oryza sativa (japonica cultivar-group) genomic D... 129 1e-27
11dbj|AK119812.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
12dbj|AK119809.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
13dbj|AK119884.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
14dbj|AK119873.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
15dbj|AK119746.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
16dbj|AK119652.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
17dbj|AK111221.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
18dbj|AK111213.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
19dbj|AK111208.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
20dbj|AK111153.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
21dbj|AK110456.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
22dbj|AK110438.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
23dbj|AK110422.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
24dbj|AK110417.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
25dbj|AK110408.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
26dbj|AK110378.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
27dbj|AK110338.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
28dbj|AK110317.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
29dbj|AK110295.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
30dbj|AK110187.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
31dbj|AK110074.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
32dbj|AK110007.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
33dbj|AK109985.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
34dbj|AK109969.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
35dbj|AK109482.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
36dbj|AK108869.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
37dbj|AK106985.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
38dbj|AK106912.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
39dbj|AK106431.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
40dbj|AK105407.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
41dbj|AK105300.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
42dbj|AK062150.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
43dbj|AK063163.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
44dbj|AK063268.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
45dbj|AK058406.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-27
46gb|AY095471.1| Bulbine succulenta 26S ribosomal RNA gene, partia... 127 4e-27
47gb|AY095451.1| Asimina triloba 26S ribosomal RNA gene, partial s... 127 4e-27
48gb|AY292881.1| Asimina sp. YLQ-2003 26S ribosomal RNA gene, part... 127 4e-27
49gb|DQ008653.1| Tofieldia calyculata 26S ribosomal RNA gene, part... 127 4e-27
50gb|DQ008649.1| Potamogeton berchtoldii 26S ribosomal RNA gene, p... 127 4e-27
51gb|DQ008622.1| Ceratophyllum submersum 26S ribosomal RNA gene, p... 127 4e-27
52gb|AF479176.1| Convolvulus arvensis 26S ribosomal RNA gene, part... 127 4e-27
53gb|AF479125.1| Euphorbia polychroma 26S ribosomal RNA gene, comp... 127 4e-27
54gb|AF479122.1| Hypericum perforatum 26S ribosomal RNA gene, comp... 127 4e-27
55gb|AF479095.1| Opilia amentacea 26S ribosomal RNA gene, complete... 127 4e-27
56gb|AF479084.1| Stellaria media 26S ribosomal RNA gene, complete ... 127 4e-27
57gb|AF181820.1|AF181820 Thesium carinatum 26S ribosomal RNA, part... 127 4e-27
58gb|AF274644.1| Daphniphyllum sp. 205-82 26S ribosomal RNA gene, ... 125 2e-26
59gb|AF479215.1| Daphniphyllum sp. 205-82 26S ribosomal RNA gene, ... 125 2e-26
60gb|AY095466.1| Peumus boldus 26S ribosomal RNA gene, partial seq... 121 3e-25
61gb|AY095453.1| Cabomba sp. MJZ-2002 26S ribosomal RNA gene, part... 121 3e-25
62gb|AY292914.1| Alisma sp. YLQ-2003 26S ribosomal RNA gene, parti... 121 3e-25
63gb|AY292903.1| Cabomba sp. YLQ-2003 26S ribosomal RNA gene, part... 121 3e-25
64gb|AY292892.1| Peumus boldus 26S ribosomal RNA gene, partial seq... 121 3e-25
65gb|DQ008651.1| Alisma plantago-aquatica 26S ribosomal RNA gene, ... 121 3e-25
66gb|DQ008646.1| Asparagus officinalis 26S ribosomal RNA gene, par... 121 3e-25
67gb|DQ008639.1| Anemopsis californica 26S ribosomal RNA gene, par... 121 3e-25
68gb|AF479239.1| Cabomba caroliniana 26S ribosomal RNA gene, compl... 121 3e-25
69gb|AF479091.1| Triphyophyllum peltatum 26S ribosomal RNA gene, c... 121 3e-25
70dbj|AK110009.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 3e-25
71gb|AF389273.1| Eubrachion ambiguum 26S ribosomal RNA gene, parti... 119 1e-24
72gb|AF389261.1| Schoepfia schreberi 26S ribosomal RNA gene, parti... 119 1e-24
73gb|AF389258.1| Tinospora caffra 26S ribosomal RNA gene, partial ... 119 1e-24
74gb|AY727968.1| Clethra cf. ferruginea JS-2005 26S ribosomal RNA ... 119 1e-24
75gb|AY727966.1| Heliamphora minor 26S ribosomal RNA gene, partial... 119 1e-24
76gb|AY727948.1| Pouteria campechiana 26S ribosomal RNA gene, part... 119 1e-24
77gb|AY260030.1| Mentzelia decapetala 26S ribosomal RNA gene, comp... 119 1e-24
78gb|AY957453.1| Santalum album 26S ribosomal RNA gene, partial se... 119 1e-24
79gb|AF274669.1| Tetracarpaea tasmanica 26S ribosomal RNA gene, co... 119 1e-24
80gb|AF274655.1| Myriophyllum exalbescens 26S ribosomal RNA gene, ... 119 1e-24
81gb|AF297542.1|AF297542 Cornus volkensii 26S ribosomal RNA gene, ... 119 1e-24
82gb|DQ008654.1| Acorus calamus 26S ribosomal RNA gene, partial se... 119 1e-24
83gb|DQ008648.1| Carludovica palmata 26S ribosomal RNA gene, parti... 119 1e-24
84gb|DQ008613.1| Mahonia bealei 26S ribosomal RNA gene, partial se... 119 1e-24
85gb|AF479190.1| Codonopsis pilosula 26S ribosomal RNA gene, compl... 119 1e-24
86gb|AF479186.1| Nymphoides geminata 26S ribosomal RNA gene, compl... 119 1e-24
87gb|AF479177.1| Hydrolea ovata 26S ribosomal RNA gene, complete s... 119 1e-24
88gb|AF479173.1| Schizanthus pinnatus 26S ribosomal RNA gene, comp... 119 1e-24
89gb|AF479171.1| Olea europaea 26S ribosomal RNA gene, partial seq... 119 1e-24
90gb|AF479150.1| Androsace spinulifera 26S ribosomal RNA gene, com... 119 1e-24
91gb|AF479113.1| Euonymus alatus 26S ribosomal RNA gene, complete ... 119 1e-24
92gb|AF479106.1| Alnus glutinosa 26S ribosomal RNA gene, complete ... 119 1e-24
93gb|AF479102.1| Ceanothus sanguineus 26S ribosomal RNA gene, comp... 119 1e-24
94gb|AF479085.1| Polygonum sachalinense 26S ribosomal RNA gene, co... 119 1e-24
95gb|AF181819.1|AF181819 Acanthosyris asipapote 26S ribosomal RNA,... 119 1e-24
96gb|AF181810.1|AF181810 Phoradendron sulfuratum 26S ribosomal RNA... 119 1e-24
97gb|AF181809.1|AF181809 Phoradendron cf. tonduzii 26S ribosomal R... 119 1e-24
98gb|AF181808.1|AF181808 Phoradendron nervosum 26S ribosomal RNA, ... 119 1e-24
99gb|AF181807.1|AF181807 Phoradendron carneum 26S ribosomal RNA, p... 119 1e-24
100gb|AF181805.1|AF181805 Phoradendron tamaulipense 26S ribosomal R... 119 1e-24
101gb|AF181804.1|AF181804 Phoradendron heydeanum 26S ribosomal RNA,... 119 1e-24
102gb|AF036490.1| Acorus gramineus large subunit 26S ribosomal RNA ... 119 1e-24
103emb|AJ309824.2|ZMA309824 Zea mays 25S rRNA gene and transposon-l... 115 2e-23
104gb|AF389243.1| Buxus sempervirens 26S ribosomal RNA gene, partia... 113 7e-23
105gb|AY095470.1| Trimenia moorei 26S ribosomal RNA gene, partial s... 113 7e-23
106gb|AY095454.1| Calycanthus occidentalis 26S ribosomal RNA gene, ... 113 7e-23
107gb|AY292911.1| Buxus sp. YLQ-2003 26S ribosomal RNA gene, partia... 113 7e-23
108gb|AY292895.1| Peperomia sp. YLQ-2003 26S ribosomal RNA gene, pa... 113 7e-23
109gb|AY292891.1| Hedycarya sp. YLQ-2003 26S ribosomal RNA gene, pa... 113 7e-23
110gb|AY292890.1| Calycanthus sp. YLQ-2003 26S ribosomal RNA gene, ... 113 7e-23
111gb|AF274663.1| Pterostemon rotundifolius 26S ribosomal RNA gene,... 113 7e-23
112gb|DQ008659.1| Illicium floridanum 26S ribosomal RNA gene, parti... 113 7e-23
113gb|DQ008658.1| Schisandra sphenanthera 26S ribosomal RNA gene, p... 113 7e-23
114gb|DQ008644.1| Saruma henryi 26S ribosomal RNA gene, partial seq... 113 7e-23
115gb|DQ008643.1| Asarum canadense 26S ribosomal RNA gene, partial ... 113 7e-23
116gb|DQ008633.1| Idiospermum australiense 26S ribosomal RNA gene, ... 113 7e-23
117gb|DQ008631.1| Siparuna decipiens 26S ribosomal RNA gene, partia... 113 7e-23
118gb|DQ008630.1| Doryphora sassafras 26S ribosomal RNA gene, parti... 113 7e-23
119gb|DQ008629.1| Daphnandra micrantha 26S ribosomal RNA gene, part... 113 7e-23
120gb|DQ008627.1| Cryptocarya meissneriana 26S ribosomal RNA gene, ... 113 7e-23
121gb|DQ008626.1| Laurus nobilis 26S ribosomal RNA gene, partial se... 113 7e-23
122gb|DQ008624.1| Gyrocarpus americanus 26S ribosomal RNA gene, par... 113 7e-23
123gb|AF479223.1| Myrothamnus flabellifolius 26S ribosomal RNA gene... 113 7e-23
124gb|AF479097.1| Tetracera asiatica 26S ribosomal RNA gene, comple... 113 7e-23
125dbj|AK107285.1| Oryza sativa (japonica cultivar-group) cDNA clon... 113 7e-23
126gb|M35386.1|RICRGC4 Rice 25S rRNA gene 113 7e-23
127gb|DQ287987.1| Abutilon theophrasti 26S ribosomal RNA gene, part... 111 3e-22
128gb|AY530924.1| Cornus capitata 26S ribosomal RNA gene, complete ... 111 3e-22
129gb|AY555065.1| Corchorus olitorius 26S ribosomal RNA gene, parti... 111 3e-22
130gb|AF389276.1| Sarracenia purpurea 26S ribosomal RNA gene, parti... 111 3e-22
131gb|AF389272.1| Sabia swinhoei 26S ribosomal RNA gene, partial se... 111 3e-22
132gb|AF389271.1| Meliosma veitchiorum 26S ribosomal RNA gene, part... 111 3e-22
133gb|AF389270.1| Xanthorhiza simplicissima 26S ribosomal RNA gene,... 111 3e-22
134gb|AF389268.1| Hydrastis canadensis 26S ribosomal RNA gene, part... 111 3e-22
135gb|AF389267.1| Glaucidium palmatum 26S ribosomal RNA gene, parti... 111 3e-22
136gb|AF389266.1| Coptis trifolia 26S ribosomal RNA gene, partial s... 111 3e-22
137gb|AF389265.1| Roupala macrophylla 26S ribosomal RNA gene, parti... 111 3e-22
138gb|AF389264.1| Pteridophyllum racemosum 26S ribosomal RNA gene, ... 111 3e-22
139gb|AF389262.1| Dicentra eximia 26S ribosomal RNA gene, partial s... 111 3e-22
140gb|AF389260.1| Nepenthes sp. Nickrent 3056 26S ribosomal RNA gen... 111 3e-22
141gb|AF389256.1| Magnolia denudata 26S ribosomal RNA gene, partial... 111 3e-22
142gb|AF389255.1| Sinofranchetia chinensis 26S ribosomal RNA gene, ... 111 3e-22
143gb|AF389252.1| Philadelphus lewisii 26S ribosomal RNA gene, part... 111 3e-22
144gb|AF389251.1| Galbulimima belgraveana 26S ribosomal RNA gene, p... 111 3e-22
145gb|AF389250.1| Gunnera manicata 26S ribosomal RNA gene, partial ... 111 3e-22
146gb|AF389249.1| Euptelea polyandra 26S ribosomal RNA gene, partia... 111 3e-22
147gb|AF389248.1| Drosera capensis 26S ribosomal RNA gene, partial ... 111 3e-22
148gb|AF389247.1| Didymeles perrieri 26S ribosomal RNA gene, partia... 111 3e-22
149gb|AF389244.1| Pachysandra procumbens 26S ribosomal RNA gene, pa... 111 3e-22
150gb|AF389242.1| Berberidopsis corallina 26S ribosomal RNA gene, p... 111 3e-22
151gb|AF389239.1| Aextoxicon punctatum 26S ribosomal RNA gene, part... 111 3e-22
152gb|AY189151.1| Pittosporum tobira 26S large subunit ribosomal RN... 111 3e-22
153gb|AY189116.1| Tupidanthus calyptratus 26S large subunit ribosom... 111 3e-22
154gb|AY189115.1| Trevesia palmata 26S large subunit ribosomal RNA ... 111 3e-22
155gb|AY189114.1| Trachymene coerulea 26S large subunit ribosomal R... 111 3e-22
156gb|AY189112.1| Tetraplasandra hawaiensis 26S large subunit ribos... 111 3e-22
157gb|AY189109.1| Sollya heterophylla 26S large subunit ribosomal R... 111 3e-22
158gb|AY189108.1| Schefflera arboricola 26S large subunit ribosomal... 111 3e-22
159gb|AY189107.1| Sanicula gregari 26S large subunit ribosomal RNA ... 111 3e-22
160gb|AY189106.1| Rhytidosporum alpinum 26S large subunit ribosomal... 111 3e-22
161gb|AY189105.1| Reynoldsia sandwicensis 26S large subunit ribosom... 111 3e-22
162gb|AY189104.1| Pseudosciadium balansae 26S large subunit ribosom... 111 3e-22
163gb|AY189103.1| Pseudopanax arboreus 26S large subunit ribosomal ... 111 3e-22
164gb|AY189102.1| Polyscias guilfoylei 26S large subunit ribosomal ... 111 3e-22
165gb|AY189100.1| Pimpinella saxifraga 26S large subunit ribosomal ... 111 3e-22
166gb|AY189097.1| Osmoxylon novoguineense 26S large subunit ribosom... 111 3e-22
167gb|AY189096.1| Neogoezia minor 26S large subunit ribosomal RNA g... 111 3e-22
168gb|AY189092.1| Mulinum ulicinum 26S large subunit ribosomal RNA ... 111 3e-22
169gb|AY189091.1| Mulinum spinosum 26S large subunit ribosomal RNA ... 111 3e-22
170gb|AY189090.1| Mulinum chillanense 26S large subunit ribosomal R... 111 3e-22
171gb|AY189088.1| Motherwellia haplosciadea 26S large subunit ribos... 111 3e-22
172gb|AY189085.1| Melanophylla alnifolia 26S large subunit ribosoma... 111 3e-22
173gb|AY189081.1| Lagoecia cuminoides 26S large subunit ribosomal R... 111 3e-22
174gb|AY189080.1| Kalopanax pictus 26S large subunit ribosomal RNA ... 111 3e-22
175gb|AY189079.1| Hymenosporum flavum 26S large subunit ribosomal R... 111 3e-22
176gb|AY189077.1| Hydrocotyle modesta 26S large subunit ribosomal R... 111 3e-22
177gb|AY189076.1| Hydrocotyle bowlesioides 26S large subunit riboso... 111 3e-22
178gb|AY189075.1| Huanaca acaulis 26S large subunit ribosomal RNA g... 111 3e-22
179gb|AY189074.1| Heteromorpha trifoliata 26S large subunit ribosom... 111 3e-22
180gb|AY189073.1| Hedera helix 26S large subunit ribosomal RNA gene... 111 3e-22
181gb|AY189072.1| Gymnophyton polycephalum 26S large subunit riboso... 111 3e-22
182gb|AY189071.1| Griselinia lucida 26S large subunit ribosomal RNA... 111 3e-22
183gb|AY189070.1| Gastonia rodriguesiana 26S large subunit ribosoma... 111 3e-22
184gb|AY189068.1| Eryngium bourgattii 26S large subunit ribosomal R... 111 3e-22
185gb|AY189067.1| Eremocharis fruticosa 26S large subunit ribosomal... 111 3e-22
186gb|AY189066.1| Endressia castellana 26S large subunit ribosomal ... 111 3e-22
187gb|AY189065.1| Eleutherococcus trifoliatus 26S large subunit rib... 111 3e-22
188gb|AY189064.1| Donnellsmithia cordata 26S large subunit ribosoma... 111 3e-22
189gb|AY189063.1| Diplaspis hydrocotyle 26S large subunit ribosomal... 111 3e-22
190gb|AY189062.1| Dickinsia hydrocotyloides 26S large subunit ribos... 111 3e-22
191gb|AY189060.1| Dendropanax arboreus 26S large subunit ribosomal ... 111 3e-22
192gb|AY189059.1| Delarbrea collina 26S large subunit ribosomal RNA... 111 3e-22
193gb|AY189057.1| Cussonia spicata 26S large subunit ribosomal RNA ... 111 3e-22
194gb|AY189056.1| Coriandrum sativum 26S large subunit ribosomal RN... 111 3e-22
195gb|AY189055.1| Cheirodendron trigynum 26S large subunit ribosoma... 111 3e-22
196gb|AY189053.1| Bupleurum falcatum 26S large subunit ribosomal RN... 111 3e-22
197gb|AY189048.1| Azorella trifurcata 26S large subunit ribosomal R... 111 3e-22
198gb|AY189046.1| Azorella selago 26S large subunit ribosomal RNA g... 111 3e-22
199gb|AY189044.1| Azorella macquariensis 26S large subunit ribosoma... 111 3e-22
200gb|AY189042.1| Azorella fuegiana 26S large subunit ribosomal RNA... 111 3e-22
201gb|AY189040.1| Astrantia major 26S large subunit ribosomal RNA g... 111 3e-22
202gb|AY189038.1| Arracacia aegopodioides 26S large subunit ribosom... 111 3e-22
203gb|AY189035.1| Aralia spinosa 26S large subunit ribosomal RNA ge... 111 3e-22
204gb|AY189034.1| Apium graveolens 26S large subunit ribosomal RNA ... 111 3e-22
205gb|AY189031.1| Angelica lucida 26S large subunit ribosomal RNA g... 111 3e-22
206gb|AY189030.1| Aegopodium podagraria 26S large subunit ribosomal... 111 3e-22
207gb|AY189029.1| Actinotus helianthi 26S large subunit ribosomal R... 111 3e-22
208gb|AY189028.1| Aciphylla aurea 26S large subunit ribosomal RNA g... 111 3e-22
209gb|AY727986.1| Diapensia lapponica 26S ribosomal RNA gene, parti... 111 3e-22
210gb|AY727985.1| Shortia uniflora 26S ribosomal RNA gene, partial ... 111 3e-22
211gb|AY727984.1| Shortia soldanelloides 26S ribosomal RNA gene, pa... 111 3e-22
212gb|AY727983.1| Galax urceolata 26S ribosomal RNA gene, partial s... 111 3e-22
213gb|AY727982.1| Bruinsmia styracoides 26S ribosomal RNA gene, par... 111 3e-22
214gb|AY727981.1| Halesia carolina 26S ribosomal RNA gene, partial ... 111 3e-22
215gb|AY727980.1| Styrax japonicus 26S ribosomal RNA gene, partial ... 111 3e-22
216gb|AY727979.1| Symplocos pendula 26S ribosomal RNA gene, partial... 111 3e-22
217gb|AY727978.1| Symplocos zizyphoides 26S ribosomal RNA gene, par... 111 3e-22
218gb|AY727977.1| Gordonia lasianthus 26S ribosomal RNA gene, parti... 111 3e-22
219gb|AY727976.1| Schima sp. JS-2005 26S ribosomal RNA gene, partia... 111 3e-22
220gb|AY727975.1| Camellia sinensis 26S ribosomal RNA gene, partial... 111 3e-22
221gb|AY727974.1| Vaccinium myrtillus 26S ribosomal RNA gene, parti... 111 3e-22
222gb|AY727973.1| Rhododendron impeditum 26S ribosomal RNA gene, pa... 111 3e-22
223gb|AY727972.1| Empetrum hermaphroditum 26S ribosomal RNA gene, p... 111 3e-22
224gb|AY727971.1| Chimaphila umbellata 26S ribosomal RNA gene, part... 111 3e-22
225gb|AY727970.1| Enkianthus campanulatus 26S ribosomal RNA gene, p... 111 3e-22
226gb|AY727969.1| Cyrilla racemiflora 26S ribosomal RNA gene, parti... 111 3e-22
227gb|AY727967.1| Sarracenia psittacina 26S ribosomal RNA gene, par... 111 3e-22
228gb|AY727965.1| Roridula gorgonias 26S ribosomal RNA gene, partia... 111 3e-22
229gb|AY727964.1| Actinidia arguta 26S ribosomal RNA gene, partial ... 111 3e-22
230gb|AY727963.1| Lysimachia vulgaris 26S ribosomal RNA gene, parti... 111 3e-22
231gb|AY727962.1| Clavija lancifolia 26S ribosomal RNA gene, partia... 111 3e-22
232gb|AY727961.1| Myrsine africana 26S ribosomal RNA gene, partial ... 111 3e-22
233gb|AY727960.1| Primula elatior 26S ribosomal RNA gene, partial s... 111 3e-22
234gb|AY727959.1| Maesa japonica 26S ribosomal RNA gene, partial se... 111 3e-22
235gb|AY727958.1| Samolus valerandi 26S ribosomal RNA gene, partial... 111 3e-22
236gb|AY727956.1| Lissocarpa benthamii 26S ribosomal RNA gene, part... 111 3e-22
237gb|AY727955.1| Ternstroemia stahlii 26S ribosomal RNA gene, part... 111 3e-22
238gb|AY727954.1| Pentaphylax euryoides 26S ribosomal RNA gene, par... 111 3e-22
239gb|AY727953.1| Eurya japonica 26S ribosomal RNA gene, partial se... 111 3e-22
240gb|AY727952.1| Cleyera japonica 26S ribosomal RNA gene, partial ... 111 3e-22
241gb|AY727951.1| Napoleona sp. JS-2005 26S ribosomal RNA gene, par... 111 3e-22
242gb|AY727950.1| Couroupita guianensis 26S ribosomal RNA gene, par... 111 3e-22
243gb|AY727949.1| Barringtonia asiatica 26S ribosomal RNA gene, par... 111 3e-22
244gb|AY727947.1| Madhuca microphylla 26S ribosomal RNA gene, parti... 111 3e-22
245gb|AY727946.1| Manilkara zapota 26S ribosomal RNA gene, partial ... 111 3e-22
246gb|AY727945.1| Palaquium ferox 26S ribosomal RNA gene, partial s... 111 3e-22
247gb|AY727940.1| Fouquieria fasciculata 26S ribosomal RNA gene, pa... 111 3e-22
248gb|AY727939.1| Fouquieria columnaris 26S ribosomal RNA gene, par... 111 3e-22
249gb|AY727938.1| Norantea guianensis 26S ribosomal RNA gene, parti... 111 3e-22
250gb|AY727937.1| Marcgravia rectiflora 26S ribosomal RNA gene, par... 111 3e-22
251gb|AY727936.1| Impatiens auricoma 26S ribosomal RNA gene, partia... 111 3e-22
252gb|AY727935.1| Pentamerista neotropica 26S ribosomal RNA gene, p... 111 3e-22
253gb|AY727934.1| Tetramerista sp. JS-2005 26S ribosomal RNA gene, ... 111 3e-22
254gb|AY727933.1| Pelliciera rhizophorae 26S ribosomal RNA gene, pa... 111 3e-22
255gb|AY727932.1| Ilex repanda 26S ribosomal RNA gene, partial sequ... 111 3e-22
256gb|AY727931.1| Aucuba japonica 26S ribosomal RNA gene, partial s... 111 3e-22
257gb|AY727930.1| Cornus sericea 26S ribosomal RNA gene, partial se... 111 3e-22
258gb|AY727929.1| Hydrangea sp. JS-2005 26S ribosomal RNA gene, par... 111 3e-22
259gb|AY436774.1| Pyrus communis cytochrome P450 monooxygenase mRNA... 111 3e-22
260gb|AY337262.1| Orobanche cernua var. cumana 26S ribosomal RNA, p... 111 3e-22
261gb|AY095473.1| Spathiphyllum wallisii 26S ribosomal RNA gene, pa... 111 3e-22
262gb|AY095469.1| Tasmannia insipida 26S ribosomal RNA gene, partia... 111 3e-22
263gb|AY095463.1| Lactoris fernandeziana 26S ribosomal RNA gene, pa... 111 3e-22
264gb|AY095461.1| Hedyosmum bonplandianum 26S ribosomal RNA gene, p... 111 3e-22
265gb|AY095459.1| Galbulimima belgraveana 26S ribosomal RNA gene, p... 111 3e-22
266gb|AY095457.1| Chloranthus multistachys 26S ribosomal RNA gene, ... 111 3e-22
267gb|AY095450.1| Aristolochia macrophylla 26S ribosomal RNA gene, ... 111 3e-22
268gb|AY095449.1| Amborella trichopoda 26S ribosomal RNA gene, part... 111 3e-22
269gb|AY260045.1| Shortia galacifolia 26S ribosomal RNA gene, compl... 111 3e-22
270gb|AY260044.1| Sarracenia purpurea 26S ribosomal RNA gene, compl... 111 3e-22
271gb|AY260042.1| Jamesia americana 26S ribosomal RNA gene, complet... 111 3e-22
272gb|AY260041.1| Fendlera rupicola 26S ribosomal RNA gene, complet... 111 3e-22
273gb|AY260040.1| Cardiandra alternifolia 26S ribosomal RNA gene, c... 111 3e-22
274gb|AY260039.1| Broussaisia arguta 26S ribosomal RNA gene, comple... 111 3e-22
275gb|AY260038.1| Pileostegia sp. Qiu 1992 26S ribosomal RNA gene, ... 111 3e-22
276gb|AY260037.1| Philadelphus caucasicus 26S ribosomal RNA gene, c... 111 3e-22
277gb|AY260036.1| Philadelphus hirsutus 26S ribosomal RNA gene, com... 111 3e-22
278gb|AY260035.1| Fendlerella utahensis 26S ribosomal RNA gene, com... 111 3e-22
279gb|AY260034.1| Deutzia rubens 26S ribosomal RNA gene, complete s... 111 3e-22
280gb|AY260033.1| Platycrater arguta 26S ribosomal RNA gene, comple... 111 3e-22
281gb|AY260032.1| Hydrangea arborescens 26S ribosomal RNA gene, com... 111 3e-22
282gb|AY260031.1| Eucnide urens 26S ribosomal RNA gene, complete se... 111 3e-22
283gb|AY260029.1| Petalonyx parryi 26S ribosomal RNA gene, complete... 111 3e-22
284gb|AY260028.1| Petalonyx nitidus 26S ribosomal RNA gene, complet... 111 3e-22
285gb|AY260026.1| Hydrostachys angustisecta 26S ribosomal RNA gene,... 111 3e-22
286gb|AY260025.1| Hydrostachys sp. Hansen 1993 26S ribosomal RNA ge... 111 3e-22
287gb|AY260024.1| Hydrostachys polymorpha 26S ribosomal RNA gene, c... 111 3e-22
288gb|AY260023.1| Hydrostachys imbricata 26S ribosomal RNA gene, pa... 111 3e-22
289gb|AY260022.1| Hydrostachys angustisecta 26S ribosomal RNA gene,... 111 3e-22
290gb|AY260021.1| Hydrostachys multifida 26S ribosomal RNA gene, co... 111 3e-22
291gb|AY260020.1| Grubbia tomentosa 26S ribosomal RNA gene, complet... 111 3e-22
292gb|AY260018.1| Nyssa sylvatica 26S ribosomal RNA gene, complete ... 111 3e-22
293gb|AY260016.1| Mastixia pentandra 26S ribosomal RNA gene, comple... 111 3e-22
294gb|AY260015.1| Mastixia caudatilimba 26S ribosomal RNA gene, com... 111 3e-22
295gb|AY260014.1| Diplopanax stachyanthus 26S ribosomal RNA gene, c... 111 3e-22
296gb|AY260013.1| Davidia involucrata 26S ribosomal RNA gene, compl... 111 3e-22
297gb|AY260012.1| Curtisia dentata 26S ribosomal RNA gene, complete... 111 3e-22
298gb|AY260011.1| Cornus disciflora 26S ribosomal RNA gene, complet... 111 3e-22
299gb|AY260010.1| Camptotheca acuminata 26S ribosomal RNA gene, com... 111 3e-22
300gb|AY260009.1| Alangium chinense 26S ribosomal RNA gene, complet... 111 3e-22
301gb|AY260007.1| Alangium kurzii 26S ribosomal RNA gene, complete ... 111 3e-22
302gb|AY292915.1| Triglochin sp. YLQ-2003 26S ribosomal RNA gene, p... 111 3e-22
303gb|AY292913.1| Spathiphyllum sp. YLQ-2003 26S ribosomal RNA gene... 111 3e-22
304gb|AY292910.1| Sabia sp. YLQ-2003 26S ribosomal RNA gene, partia... 111 3e-22
305gb|AY292909.1| Platanus sp. YLQ-2003 26S ribosomal RNA gene, par... 111 3e-22
306gb|AY292907.1| Ranunculus sp. YLQ-2003 26S ribosomal RNA gene, p... 111 3e-22
307gb|AY292906.1| Dicentra sp. YLQ-2003 26S ribosomal RNA gene, par... 111 3e-22
308gb|AY292905.1| Euptelea sp. YLQ-2003 26S ribosomal RNA gene, par... 111 3e-22
309gb|AY292899.1| Aristolochia sp. YLQ-2003 26S ribosomal RNA gene,... 111 3e-22
310gb|AY292898.1| Lactoris fernandeziana 26S ribosomal RNA gene, pa... 111 3e-22
311gb|AY292889.1| Hedyosmum sp. YLQ-2003 26S ribosomal RNA gene, pa... 111 3e-22
312gb|AY292888.1| Chloranthus sp. YLQ-2003 26S ribosomal RNA gene, ... 111 3e-22
313gb|AY292887.1| Amborella trichopoda 26S ribosomal RNA gene, part... 111 3e-22
314gb|AY292883.1| Tasmannia sp. YLQ-2003 26S ribosomal RNA gene, pa... 111 3e-22
315gb|AY292882.1| Drimys sp. YLQ-2003 26S ribosomal RNA gene, parti... 111 3e-22
316gb|AY292880.1| Galbulimima sp. YLQ-2003 26S ribosomal RNA gene, ... 111 3e-22
317gb|AY292878.1| Magnolia sp. YLQ-2003 26S ribosomal RNA gene, par... 111 3e-22
318gb|AF503353.1|AF503353S1 Hydnora africana 26S ribosomal RNA gene... 111 3e-22
319gb|DQ108480.1| Corchorus olitorius SSR marker J-77-M13F genomic ... 111 3e-22
320gb|AY090986.1| Arabidopsis thaliana At3g41950 mRNA sequence 111 3e-22
321emb|X13557.1|LE25SRIB Tomato 25S ribosomal RNA gene 111 3e-22
322gb|AC006837.16| Arabidopsis thaliana chromosome 2 BAC F23H14 gen... 111 3e-22
323gb|AF274672.1| Vitis aestivalis 26S ribosomal RNA gene, complete... 111 3e-22
324gb|AF274671.1| Trochodendron aralioides 26S ribosomal RNA gene, ... 111 3e-22
325gb|AF274670.1| Tetracentron sinense 26S ribosomal RNA gene, comp... 111 3e-22
326gb|AF274668.1| Sullivantia oregana 26S ribosomal RNA gene, compl... 111 3e-22
327gb|AF274664.1| Rhodoleia championii 26S ribosomal RNA gene, comp... 111 3e-22
328gb|AF274662.1| Platanus occidentalis 26S ribosomal RNA gene, com... 111 3e-22
329gb|AF274661.1| Penthorum sedoides 26S ribosomal RNA gene, comple... 111 3e-22
330gb|AF274658.1| Paeonia californica 26S ribosomal RNA gene, compl... 111 3e-22
331gb|AF274656.1| Mytilaria laosensis 26S ribosomal RNA gene, compl... 111 3e-22
332gb|AF274652.1| Lambertia inermis 26S ribosomal RNA gene, complet... 111 3e-22
333gb|AF274651.1| Kalanchoe daigremontiana 26S ribosomal RNA gene, ... 111 3e-22
334gb|AF274649.1| Heuchera micrantha 26S ribosomal RNA gene, comple... 111 3e-22
335gb|AF274648.1| Haloragis erecta 26S ribosomal RNA gene, complete... 111 3e-22
336gb|AF274647.1| Exbucklandia populnea 26S ribosomal RNA gene, com... 111 3e-22
337gb|AF274646.1| Dudleya viscida 26S ribosomal RNA gene, complete ... 111 3e-22
338gb|AF274645.1| Disanthus cercidifolius 26S ribosomal RNA gene, c... 111 3e-22
339gb|AF274642.1| Corylopsis sinensis var. calvescens 26S ribosomal... 111 3e-22
340gb|AF274639.1| Cercidiphyllum japonicum 26S ribosomal RNA gene, ... 111 3e-22
341gb|AF274638.1| Boykinia rotundifolia 26S ribosomal RNA gene, com... 111 3e-22
342gb|AF274636.1| Altingia excelsa 26S ribosomal RNA gene, complete... 111 3e-22
343gb|AF297544.1|AF297544 Alangium platanifolium 26S ribosomal RNA ... 111 3e-22
344gb|AF297543.1|AF297543 Schizophragma hydrangeoides 26S ribosomal... 111 3e-22
345gb|AF297540.1|AF297540 Cornus walteri 26S ribosomal RNA gene, pa... 111 3e-22
346gb|AF297539.1|AF297539 Cornus oblonga 26S ribosomal RNA gene, pa... 111 3e-22
347gb|AF297538.1|AF297538 Cornus racemosa 26S ribosomal RNA gene, p... 111 3e-22
348gb|AF297537.1|AF297537 Cornus sessilis 26S ribosomal RNA gene, p... 111 3e-22
349gb|AF297536.1|AF297536 Cornus officinalis 26S ribosomal RNA gene... 111 3e-22
350gb|AF297535.1|AF297535 Cornus mas 26S ribosomal RNA gene, partia... 111 3e-22
351gb|AF297534.1|AF297534 Cornus unalaschkensis 26S ribosomal RNA g... 111 3e-22
352gb|AF297533.1|AF297533 Cornus kousa 26S ribosomal RNA gene, part... 111 3e-22
353gb|AF297532.1|AF297532 Cornus florida 26S ribosomal RNA gene, pa... 111 3e-22
354gb|AF297531.1|AF297531 Cornus suecica 26S ribosomal RNA gene, pa... 111 3e-22
355gb|AF297530.1|AF297530 Cornus canadensis 26S ribosomal RNA gene,... 111 3e-22
356gb|DQ008657.1| Kadsura japonica 26S ribosomal RNA gene, partial ... 111 3e-22
357gb|DQ008645.1| Takhtajania perrieri 26S ribosomal RNA gene, part... 111 3e-22
358gb|DQ008620.1| Sargentodoxa cuneata 26S ribosomal RNA gene, part... 111 3e-22
359gb|DQ008619.1| Akebia quinata 26S ribosomal RNA gene, partial se... 111 3e-22
360gb|DQ008618.1| Lardizabala biternata 26S ribosomal RNA gene, par... 111 3e-22
361gb|DQ008617.1| Cocculus trilobus 26S ribosomal RNA gene, partial... 111 3e-22
362gb|DQ008616.1| Cissampelos pareira 26S ribosomal RNA gene, parti... 111 3e-22
363gb|DQ008614.1| Podophyllum peltatum 26S ribosomal RNA gene, part... 111 3e-22
364gb|DQ008612.1| Grevillea banksii 26S ribosomal RNA gene, partial... 111 3e-22
365gb|DQ008611.1| Persoonia katerae 26S ribosomal RNA gene, partial... 111 3e-22
366gb|DQ008610.1| Petrophile canescens 26S ribosomal RNA gene, part... 111 3e-22
367gb|DQ008609.1| Meliosma squamulata 26S ribosomal RNA gene, parti... 111 3e-22
368gb|DQ008607.1| Pachysandra procumbens 26S ribosomal RNA gene, pa... 111 3e-22
369emb|BX820499.1|CNS0A8OI Arabidopsis thaliana Full-length cDNA Co... 111 3e-22
370emb|BX819090.1|CNS0A8TB Arabidopsis thaliana Full-length cDNA Co... 111 3e-22
371gb|AF479247.1| Morella cerifera 26S ribosomal RNA gene, complete... 111 3e-22
372gb|AF479246.1| Barnadesia caryophylla 26S ribosomal RNA gene, co... 111 3e-22
373gb|AF479245.1| Chloranthus japonicus 26S ribosomal RNA gene, com... 111 3e-22
374gb|AF479244.1| Magnolia denudata 26S ribosomal RNA gene, complet... 111 3e-22
375gb|AF479243.1| Roussea simplex 26S ribosomal RNA gene, complete ... 111 3e-22
376gb|AF479242.1| Symphoricarpos albus 26S ribosomal RNA gene, comp... 111 3e-22
377gb|AF479241.1| Swietenia macrophylla 26S ribosomal RNA gene, com... 111 3e-22
378gb|AF479240.1| Lythrum salicaria 26S ribosomal RNA gene, complet... 111 3e-22
379gb|AF479238.1| Amborella trichopoda 26S ribosomal RNA gene, comp... 111 3e-22
380gb|AF479236.1| Rhodoleia sp. DES-2002 26S ribosomal RNA gene, co... 111 3e-22
381gb|AF479235.1| Elaeagnus sp. Chase 2414 26S ribosomal RNA gene, ... 111 3e-22
382gb|AF479234.1| Thymelaea hirsuta 26S ribosomal RNA gene, complet... 111 3e-22
383gb|AF479233.1| Polygala cruciata 26S ribosomal RNA gene, complet... 111 3e-22
384gb|AF479231.1| Dipsacus sativus 26S ribosomal RNA gene, complete... 111 3e-22
385gb|AF479230.1| Oxalis dillenii 26S ribosomal RNA gene, complete ... 111 3e-22
386gb|AF479227.1| Greyia radlkoferi 26S ribosomal RNA gene, complet... 111 3e-22
387gb|AF479226.1| Hedyosmum arborescens 26S ribosomal RNA gene, com... 111 3e-22
388gb|AF479225.1| Neurada procumbens 26S ribosomal RNA gene, comple... 111 3e-22
389gb|AF479224.1| Saxifraga mertensiana 26S ribosomal RNA gene, com... 111 3e-22
390gb|AF479220.1| Pteridophyllum racemosum 26S ribosomal RNA gene, ... 111 3e-22
391gb|AF479219.1| Exbucklandia populnea 26S ribosomal RNA gene, com... 111 3e-22
392gb|AF479218.1| Disanthus cercidifolia 26S ribosomal RNA gene, co... 111 3e-22
393gb|AF479213.1| Corylopsis pauciflora 26S ribosomal RNA gene, com... 111 3e-22
394gb|AF479212.1| Sullivantia oregana 26S ribosomal RNA gene, compl... 111 3e-22
395gb|AF479211.1| Heuchera micrantha 26S ribosomal RNA gene, comple... 111 3e-22
396gb|AF479209.1| Haloragis aspera 26S ribosomal RNA gene, complete... 111 3e-22
397gb|AF479208.1| Altingia excelsa 26S ribosomal RNA gene, complete... 111 3e-22
398gb|AF479207.1| Vitis aestivalis 26S ribosomal RNA gene, complete... 111 3e-22
399gb|AF479206.1| Lambertia inermis 26S ribosomal RNA gene, complet... 111 3e-22
400gb|AF479205.1| Trochodendron aralioides 26S ribosomal RNA gene, ... 111 3e-22
401gb|AF479204.1| Gunnera hamiltonii 26S ribosomal RNA gene, comple... 111 3e-22
402gb|AF479203.1| Ilex opaca 26S ribosomal RNA gene, complete sequence 111 3e-22
403gb|AF479202.1| Irvingbaileya sp. Plunkett 1510 26S ribosomal RNA... 111 3e-22
404gb|AF479201.1| Gonocaryum litorale 26S ribosomal RNA gene, compl... 111 3e-22
405gb|AF479200.1| Abelia triflora 26S ribosomal RNA gene, complete ... 111 3e-22
406gb|AF479199.1| Valeriana officinalis 26S ribosomal RNA gene, com... 111 3e-22
407gb|AF479198.1| Scabiosa sp. Albach 39 26S ribosomal RNA gene, co... 111 3e-22
408gb|AF479197.1| Griselinia lucida 26S ribosomal RNA gene, complet... 111 3e-22
409gb|AF479196.1| Delarbrea michieana 26S ribosomal RNA gene, compl... 111 3e-22
410gb|AF479195.1| Apium graveolens 26S ribosomal RNA gene, complete... 111 3e-22
411gb|AF479194.1| Hedera helix 26S ribosomal RNA gene, complete seq... 111 3e-22
412gb|AF479193.1| Panax quinquefolius 26S ribosomal RNA gene, compl... 111 3e-22
413gb|AF479192.1| Pittosporum fairchildii 26S ribosomal RNA gene, c... 111 3e-22
414gb|AF479191.1| Campanula trachelium 26S ribosomal RNA gene, comp... 111 3e-22
415gb|AF479189.1| Donatia sp. Morgan 2142 26S ribosomal RNA gene, c... 111 3e-22
416gb|AF479187.1| Corokia cotoneaster 26S ribosomal RNA gene, compl... 111 3e-22
417gb|AF479185.1| Menyanthes trifoliata 26S ribosomal RNA gene, com... 111 3e-22
418gb|AF479184.1| Boopis graminea 26S ribosomal RNA gene, complete ... 111 3e-22
419gb|AF479183.1| Helianthus annuus 26S ribosomal RNA gene, complet... 111 3e-22
420gb|AF479182.1| Vahlia capensis 26S ribosomal RNA gene, complete ... 111 3e-22
421gb|AF479181.1| Garrya elliptica 26S ribosomal RNA gene, complete... 111 3e-22
422gb|AF479179.1| Borago officinalis 26S ribosomal RNA gene, partia... 111 3e-22
423gb|AF479178.1| Nerium oleander 26S ribosomal RNA gene, partial s... 111 3e-22
424gb|AF479175.1| Montinia caryophyllacea 26S ribosomal RNA gene, c... 111 3e-22
425gb|AF479174.1| Petunia axillaris 26S ribosomal RNA gene, complet... 111 3e-22
426gb|AF479172.1| Nicotiana tabacum 26S ribosomal RNA gene, complet... 111 3e-22
427gb|AF479170.1| Myoporum mauritianum 26S ribosomal RNA gene, comp... 111 3e-22
428gb|AF479169.1| Veronica anagallis-aquatica 26S ribosomal RNA gen... 111 3e-22
429gb|AF479164.1| Rhynchoglossum notonianum 26S ribosomal RNA gene,... 111 3e-22
430gb|AF479163.1| Cornus officinalis 26S ribosomal RNA gene, comple... 111 3e-22
431gb|AF479162.1| Alangium sp. Chase 2541 26S ribosomal RNA gene, c... 111 3e-22
432gb|AF479161.1| Petalonyx nitidus 26S ribosomal RNA gene, complet... 111 3e-22
433gb|AF479153.1| Tetramerista sp. Coode 7925 26S ribosomal RNA gen... 111 3e-22
434gb|AF479152.1| Maesa myrsinoides 26S ribosomal RNA gene, partial... 111 3e-22
435gb|AF479149.1| Anagallis tenella 26S ribosomal RNA gene, complet... 111 3e-22
436gb|AF479147.1| Terminalia boivinii 26S ribosomal RNA gene, compl... 111 3e-22
437gb|AF479144.1| Tropaeolum tricolor 26S ribosomal RNA gene, compl... 111 3e-22
438gb|AF479142.1| Sinapis alba 26S ribosomal RNA gene, complete seq... 111 3e-22
439gb|AF479138.1| Aesculus pavia 26S ribosomal RNA gene, complete s... 111 3e-22
440gb|AF479137.1| Sterculia apetala 26S ribosomal RNA gene, complet... 111 3e-22
441gb|AF479136.1| Durio zibethinus 26S ribosomal RNA gene, complete... 111 3e-22
442gb|AF479135.1| Ochroma pyramidale 26S ribosomal RNA gene, comple... 111 3e-22
443gb|AF479133.1| Staphylea trifolia 26S ribosomal RNA gene, comple... 111 3e-22
444gb|AF479132.1| Aphloia theiformis 26S ribosomal RNA gene, comple... 111 3e-22
445gb|AF479131.1| Crossosoma californicum 26S ribosomal RNA gene, p... 111 3e-22
446gb|AF479130.1| Viviania marifolia 26S ribosomal RNA gene, comple... 111 3e-22
447gb|AF479127.1| Averrhoa carambola 26S ribosomal RNA gene, comple... 111 3e-22
448gb|AF479126.1| Sloanea berteriana 26S ribosomal RNA gene, comple... 111 3e-22
449gb|AF479124.1| Reinwardtia indica 26S ribosomal RNA gene, partia... 111 3e-22
450gb|AF479118.1| Populus tremuloides 26S ribosomal RNA gene, compl... 111 3e-22
451gb|AF479117.1| Idesia polycarpa 26S ribosomal RNA gene, complete... 111 3e-22
452gb|AF479116.1| Krameria ixine 26S ribosomal RNA gene, complete s... 111 3e-22
453gb|AF479115.1| Afrostyrax sp. Cheek 5007 26S ribosomal RNA gene,... 111 3e-22
454gb|AF479112.1| Brexia madagascariensis 26S ribosomal RNA gene, c... 111 3e-22
455gb|AF479111.1| Hippocratea barbata 26S ribosomal RNA gene, compl... 111 3e-22
456gb|AF479109.1| Begonia metallica x Begonia sanguinea 26S ribosom... 111 3e-22
457gb|AF479107.1| Chrysolepis sempervirens 26S ribosomal RNA gene, ... 111 3e-22
458gb|AF479105.1| Juglans nigra 26S ribosomal RNA gene, complete se... 111 3e-22
459gb|AF479103.1| Spiraea betulifolia 26S ribosomal RNA gene, compl... 111 3e-22
460gb|AF479101.1| Photinia fraseri 26S ribosomal RNA gene, complete... 111 3e-22
461gb|AF479099.1| Zelkova serrata 26S ribosomal RNA gene, complete ... 111 3e-22
462gb|AF479098.1| Celtis yunnanensis 26S ribosomal RNA gene, comple... 111 3e-22
463gb|AF479093.1| Portulaca grandiflora 26S ribosomal RNA gene, com... 111 3e-22
464gb|AF479092.1| Pereskia aculeata 26S ribosomal RNA gene, complet... 111 3e-22
465gb|AF479090.1| Asteropeia micraster 26S ribosomal RNA gene, comp... 111 3e-22
466gb|AF479089.1| Phytolacca dioica 26S ribosomal RNA gene, partial... 111 3e-22
467gb|AF479088.1| Mollugo verticillata 26S ribosomal RNA gene, comp... 111 3e-22
468gb|AF479083.1| Tamarix pentandra 26S ribosomal RNA gene, complet... 111 3e-22
469gb|AF181785.1|AF181785 Phoradendron tomentosum subsp. macrophyll... 111 3e-22
470gb|AF181784.1|AF181784 Phoradendron minutifolium 26S ribosomal R... 111 3e-22
471gb|AF181783.1|AF181783 Phoradendron bolleanum subsp. pauciflorum... 111 3e-22
472gb|AF181782.1|AF181782 Phoradendron bolleanum subsp. densum 26S ... 111 3e-22
473gb|AF181781.1|AF181781 Phoradendron juniperinum subsp. libocedri... 111 3e-22
474gb|AF181780.1|AF181780 Phoradendron juniperinum 26S ribosomal RN... 111 3e-22
475gb|AF181779.1|AF181779 Phoradendron capitellatum 26S ribosomal R... 111 3e-22
476gb|AF181798.1|AF181798 Phoradendron forestierae 26S ribosomal RN... 111 3e-22
477gb|AF181797.1|AF181797 Phoradendron velutinum specimen voucher A... 111 3e-22
478gb|AF181796.1|AF181796 Phoradendron velutinum specimen voucher A... 111 3e-22
479gb|AF181794.1|AF181794 Phoradendron rhipsalinum 26S ribosomal RN... 111 3e-22
480gb|AF181793.1|AF181793 Phoradendron robinsonii 26S ribosomal RNA... 111 3e-22
481gb|AF181792.1|AF181792 Phoradendron galeottii 26S ribosomal RNA,... 111 3e-22
482gb|AF181791.1|AF181791 Phoradendron scaberrimum 26S ribosomal RN... 111 3e-22
483gb|AF181790.1|AF181790 Phoradendron villosum subsp. coryae 26S r... 111 3e-22
484gb|AF181789.1|AF181789 Phoradendron villosum 26S ribosomal RNA, ... 111 3e-22
485gb|AF181788.1|AF181788 Phoradendron tomentosum specimen voucher ... 111 3e-22
486gb|AF181787.1|AF181787 Phoradendron serotinum 26S ribosomal RNA,... 111 3e-22
487gb|AF181786.1|AF181786 Phoradendron tomentosum specimen voucher ... 111 3e-22
488gb|AF181818.1|AF181818 Korthalsella latissima 26S ribosomal RNA,... 111 3e-22
489gb|AF181817.1|AF181817 Phoradendron piperoides 26S ribosomal RNA... 111 3e-22
490gb|AF181816.1|AF181816 Phoradendron crassifolium 26S ribosomal R... 111 3e-22
491gb|AF181815.1|AF181815 Dendrophthora squamigera 26S ribosomal RN... 111 3e-22
492gb|AF181814.1|AF181814 Dendrophthora costaricensis 26S ribosomal... 111 3e-22
493gb|AF181813.1|AF181813 Dendrophthora clavata 26S ribosomal RNA, ... 111 3e-22
494gb|AF181812.1|AF181812 Dendrophthora domingensis 26S ribosomal R... 111 3e-22
495gb|AF181811.1|AF181811 Dendrophthora opuntioides 26S ribosomal R... 111 3e-22
496gb|AF181806.1|AF181806 Phoradendron trinervium 26S ribosomal RNA... 111 3e-22
497gb|AF181802.1|AF181802 Phoradendron vernicosum 26S ribosomal RNA... 111 3e-22
498gb|AF181801.1|AF181801 Dendrophthora guatemalensis 26S ribosomal... 111 3e-22
499gb|AF181799.1|AF181799 Phoradendron brevifolium 26S ribosomal RN... 111 3e-22
500gb|AF181795.1|AF181795 Phoradendron brachystachyum 26S ribosomal... 111 3e-22

>gb|BT018529.1| Zea mays clone EL01N0433D12.d mRNA sequence
          Length = 1172

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 295 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 237

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 236 gacctgatgcggttatg 220



to top

>gb|AY095465.1| Nymphaea sp. MJZ-2002 26S ribosomal RNA gene, partial sequence
          Length = 3314

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1900 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1842

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1841 gacctgatgcggttatg 1825



to top

>gb|AY292901.1| Nuphar sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3568

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 2109 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 2051

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 2050 gacctgatgcggttatg 2034



to top

>gb|AY292900.1| Nymphaea sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3329

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1900 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1842

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1841 gacctgatgcggttatg 1825



to top

>dbj|AP008225.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9,
             fosmid clone:OSJNOa109J19
          Length = 30481

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                         
Query: 1     cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
             |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 23063 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 23005

                              
Query: 61    gacctgatgcggttatg 77
             |||||||||||||||||
Sbjct: 23004 gacctgatgcggttatg 22988



 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                         
Query: 1     cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
             |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 15135 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 15077

                              
Query: 61    gacctgatgcggttatg 77
             |||||||||||||||||
Sbjct: 15076 gacctgatgcggttatg 15060



 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 7207 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 7149

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 7148 gacctgatgcggttatg 7132



to top

>gb|AY049041.1| Triticum aestivum 28S ribosomal RNA gene, partial sequence
          Length = 3341

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1905 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1847

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1846 gacctgatgcggttatg 1830



to top

>gb|DQ008647.1| Croomia pauciflora 26S ribosomal RNA gene, partial sequence
          Length = 2067

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1268 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1210

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1209 gacctgatgcggttatg 1193



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                            
Query: 1        cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
                |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 28734012 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 28733954

                                 
Query: 61       gacctgatgcggttatg 77
                |||||||||||||||||
Sbjct: 28733953 gacctgatgcggttatg 28733937



to top

>dbj|AP008245.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OSJNBb0013K10
          Length = 129118

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                         
Query: 1     cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
             |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 30719 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 30661

                              
Query: 61    gacctgatgcggttatg 77
             |||||||||||||||||
Sbjct: 30660 gacctgatgcggttatg 30644



 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                         
Query: 1     cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
             |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 22791 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 22733

                              
Query: 61    gacctgatgcggttatg 77
             |||||||||||||||||
Sbjct: 22732 gacctgatgcggttatg 22716



 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                         
Query: 1     cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
             |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 14863 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 14805

                              
Query: 61    gacctgatgcggttatg 77
             |||||||||||||||||
Sbjct: 14804 gacctgatgcggttatg 14788



 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 6935 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 6877

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 6876 gacctgatgcggttatg 6860



to top

>dbj|AP004778.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0459B01
          Length = 163087

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                         
Query: 1     cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
             |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 50585 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 50527

                              
Query: 61    gacctgatgcggttatg 77
             |||||||||||||||||
Sbjct: 50526 gacctgatgcggttatg 50510



to top

>dbj|AK119812.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-177-A02, full
            insert sequence
          Length = 2780

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1032 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 974

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 973  gacctgatgcggttatg 957



to top

>dbj|AK119809.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-176-H02, full
            insert sequence
          Length = 3078

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1145 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1087

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1086 gacctgatgcggttatg 1070



to top

>dbj|AK119884.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-179-G12, full
            insert sequence
          Length = 2472

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1145 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1087

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1086 gacctgatgcggttatg 1070



to top

>dbj|AK119873.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-179-D07,
          full insert sequence
          Length = 2841

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                      
Query: 1  cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
          |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 76 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 18

                           
Query: 61 gacctgatgcggttatg 77
          |||||||||||||||||
Sbjct: 17 gacctgatgcggttatg 1



to top

>dbj|AK119746.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-165-D08, full
           insert sequence
          Length = 3917

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 779 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 721

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 720 gacctgatgcggttatg 704



to top

>dbj|AK119652.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-G12, full
           insert sequence
          Length = 1890

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 277 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 219

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 218 gacctgatgcggttatg 202



to top

>dbj|AK111221.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-179-C03, full
           insert sequence
          Length = 1815

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 448 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 390

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 389 gacctgatgcggttatg 373



to top

>dbj|AK111213.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-179-A12, full
           insert sequence
          Length = 2495

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 474 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 416

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 415 gacctgatgcggttatg 399



to top

>dbj|AK111208.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-178-G09, full
           insert sequence
          Length = 2395

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 463 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 405

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 404 gacctgatgcggttatg 388



to top

>dbj|AK111153.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-176-F12, full
            insert sequence
          Length = 2816

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1147 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1089

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1088 gacctgatgcggttatg 1072



to top

>dbj|AK110456.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-166-F02, full
           insert sequence
          Length = 2806

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 762 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 704

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 703 gacctgatgcggttatg 687



to top

>dbj|AK110438.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-166-D01, full
           insert sequence
          Length = 2305

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 549 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 491

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 490 gacctgatgcggttatg 474



to top

>dbj|AK110422.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-166-A07, full
           insert sequence
          Length = 3130

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 906 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 848

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 847 gacctgatgcggttatg 831



to top

>dbj|AK110417.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-165-H07, full
            insert sequence
          Length = 2845

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1139 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1081

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1080 gacctgatgcggttatg 1064



to top

>dbj|AK110408.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-165-G09, full
           insert sequence
          Length = 3620

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 534 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 476

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 475 gacctgatgcggttatg 459



to top

>dbj|AK110378.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-165-C09, full
           insert sequence
          Length = 2695

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 788 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 730

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 729 gacctgatgcggttatg 713



to top

>dbj|AK110338.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-164-F03, full
            insert sequence
          Length = 2885

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1011 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 953

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 952  gacctgatgcggttatg 936



to top

>dbj|AK110317.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-164-C07, full
            insert sequence
          Length = 2440

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1127 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1069

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1068 gacctgatgcggttatg 1052



to top

>dbj|AK110295.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-163-H01, full
           insert sequence
          Length = 2802

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 455 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 397

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 396 gacctgatgcggttatg 380



to top

>dbj|AK110187.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-162-A01, full
            insert sequence
          Length = 3553

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1026 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 968

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 967  gacctgatgcggttatg 951



to top

>dbj|AK110074.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-160-F02, full
           insert sequence
          Length = 3099

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 779 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 721

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 720 gacctgatgcggttatg 704



to top

>dbj|AK110007.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-159-G04, full
            insert sequence
          Length = 3066

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1761 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1703

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1702 gacctgatgcggttatg 1686



to top

>dbj|AK109985.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-159-E01, full
           insert sequence
          Length = 1802

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 448 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 390

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 389 gacctgatgcggttatg 373



to top

>dbj|AK109969.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-159-C04, full
           insert sequence
          Length = 3464

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 759 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 701

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 700 gacctgatgcggttatg 684



to top

>dbj|AK109482.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-202-E11, full
            insert sequence
          Length = 1835

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1819 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1761

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1760 gacctgatgcggttatg 1744



to top

>dbj|AK108869.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-152-C06, full
           insert sequence
          Length = 2179

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 568 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 510

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 509 gacctgatgcggttatg 493



to top

>dbj|AK106985.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-119-H12, full
           insert sequence
          Length = 1541

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 440 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 382

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 381 gacctgatgcggttatg 365



to top

>dbj|AK106912.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-119-A08, full
           insert sequence
          Length = 1640

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 858 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 800

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 799 gacctgatgcggttatg 783



to top

>dbj|AK106431.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-103-C05, full
           insert sequence
          Length = 1801

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 761 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 703

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 702 gacctgatgcggttatg 686



to top

>dbj|AK105407.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-123-F01, full
            insert sequence
          Length = 2644

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1092 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1034

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1033 gacctgatgcggttatg 1017



to top

>dbj|AK105300.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-116-H11, full
            insert sequence
          Length = 1765

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1030 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 972

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 971  gacctgatgcggttatg 955



to top

>dbj|AK062150.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-H04, full
           insert sequence
          Length = 1584

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 762 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 704

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 703 gacctgatgcggttatg 687



to top

>dbj|AK063163.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-100-B01, full
           insert sequence
          Length = 2669

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 542 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 484

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 483 gacctgatgcggttatg 467



to top

>dbj|AK063268.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-113-B06, full
           insert sequence
          Length = 1742

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 858 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 800

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 799 gacctgatgcggttatg 783



to top

>dbj|AK058406.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-015-B11, full
           insert sequence
          Length = 1207

 Score =  129 bits (65), Expect = 1e-27
 Identities = 75/77 (97%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 812 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 754

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 753 gacctgatgcggttatg 737



to top

>gb|AY095471.1| Bulbine succulenta 26S ribosomal RNA gene, partial sequence
          Length = 3316

 Score =  127 bits (64), Expect = 4e-27
 Identities = 71/72 (98%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1899 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1841

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1840 gatgcggttatg 1829



to top

>gb|AY095451.1| Asimina triloba 26S ribosomal RNA gene, partial sequence
          Length = 3303

 Score =  127 bits (64), Expect = 4e-27
 Identities = 71/72 (98%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1886 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1828

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1827 gatgcggttatg 1816



to top

>gb|AY292881.1| Asimina sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3318

 Score =  127 bits (64), Expect = 4e-27
 Identities = 71/72 (98%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1886 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1828

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1827 gatgcggttatg 1816



to top

>gb|DQ008653.1| Tofieldia calyculata 26S ribosomal RNA gene, partial sequence
          Length = 3081

 Score =  127 bits (64), Expect = 4e-27
 Identities = 71/72 (98%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1880 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1822

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1821 gatgcggttatg 1810



to top

>gb|DQ008649.1| Potamogeton berchtoldii 26S ribosomal RNA gene, partial sequence
          Length = 3236

 Score =  127 bits (64), Expect = 4e-27
 Identities = 71/72 (98%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1857 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1799

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1798 gatgcggttatg 1787



to top

>gb|DQ008622.1| Ceratophyllum submersum 26S ribosomal RNA gene, partial sequence
          Length = 2911

 Score =  127 bits (64), Expect = 4e-27
 Identities = 71/72 (98%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1771 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1713

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1712 gatgcggttatg 1701



to top

>gb|AF479176.1| Convolvulus arvensis 26S ribosomal RNA gene, partial sequence
          Length = 1961

 Score =  127 bits (64), Expect = 4e-27
 Identities = 71/72 (98%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                       
Query: 6   tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 507 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 449

                       
Query: 66  gatgcggttatg 77
           ||||||||||||
Sbjct: 448 gatgcggttatg 437



to top

>gb|AF479125.1| Euphorbia polychroma 26S ribosomal RNA gene, complete sequence
          Length = 3350

 Score =  127 bits (64), Expect = 4e-27
 Identities = 71/72 (98%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1895 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1837

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1836 gatgcggttatg 1825



to top

>gb|AF479122.1| Hypericum perforatum 26S ribosomal RNA gene, complete sequence
          Length = 3346

 Score =  127 bits (64), Expect = 4e-27
 Identities = 71/72 (98%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1891 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1833

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1832 gatgcggttatg 1821



to top

>gb|AF479095.1| Opilia amentacea 26S ribosomal RNA gene, complete sequence
          Length = 3351

 Score =  127 bits (64), Expect = 4e-27
 Identities = 71/72 (98%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1895 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1837

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1836 gatgcggttatg 1825



to top

>gb|AF479084.1| Stellaria media 26S ribosomal RNA gene, complete sequence
          Length = 3332

 Score =  127 bits (64), Expect = 4e-27
 Identities = 71/72 (98%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1884 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1826

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1825 gatgcggttatg 1814



to top

>gb|AF181820.1|AF181820 Thesium carinatum 26S ribosomal RNA, partial sequence
          Length = 401

 Score =  127 bits (64), Expect = 4e-27
 Identities = 71/72 (98%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                       
Query: 6   tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 167 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 109

                       
Query: 66  gatgcggttatg 77
           ||||||||||||
Sbjct: 108 gatgcggttatg 97



to top

>gb|AF274644.1| Daphniphyllum sp. 205-82 26S ribosomal RNA gene, complete sequence
          Length = 3367

 Score =  125 bits (63), Expect = 2e-26
 Identities = 70/71 (98%), Gaps = 1/71 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1913 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1855

                       
Query: 66   gatgcggttat 76
            |||||||||||
Sbjct: 1854 gatgcggttat 1844



to top

>gb|AF479215.1| Daphniphyllum sp. 205-82 26S ribosomal RNA gene, complete sequence
          Length = 3362

 Score =  125 bits (63), Expect = 2e-26
 Identities = 70/71 (98%), Gaps = 1/71 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1913 tgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacct 1855

                       
Query: 66   gatgcggttat 76
            |||||||||||
Sbjct: 1854 gatgcggttat 1844



to top

>gb|AY095466.1| Peumus boldus 26S ribosomal RNA gene, partial sequence
          Length = 3320

 Score =  121 bits (61), Expect = 3e-25
 Identities = 74/77 (96%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| |||||||||||||||||||||||
Sbjct: 1903 cgttttgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttgga 1845

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1844 gacctgatgcggttatg 1828



to top

>gb|AY095453.1| Cabomba sp. MJZ-2002 26S ribosomal RNA gene, partial sequence
          Length = 3312

 Score =  121 bits (61), Expect = 3e-25
 Identities = 74/77 (96%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||| ||||||||||||||||||||||||||||||
Sbjct: 1898 cgttttgccgacttcccttgc-ctacatttttccattggccagaggctgttcaccttgga 1840

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1839 gacctgatgcggttatg 1823



to top

>gb|AY292914.1| Alisma sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3534

 Score =  121 bits (61), Expect = 3e-25
 Identities = 74/77 (96%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||||| |||||||||||||||||||||
Sbjct: 2097 cgttttgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttgga 2039

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 2038 gacctgatgcggttatg 2022



to top

>gb|AY292903.1| Cabomba sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3327

 Score =  121 bits (61), Expect = 3e-25
 Identities = 74/77 (96%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||| ||||||||||||||||||||||||||||||
Sbjct: 1898 cgttttgccgacttcccttgc-ctacatttttccattggccagaggctgttcaccttgga 1840

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1839 gacctgatgcggttatg 1823



to top

>gb|AY292892.1| Peumus boldus 26S ribosomal RNA gene, partial sequence
          Length = 3335

 Score =  121 bits (61), Expect = 3e-25
 Identities = 74/77 (96%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| |||||||||||||||||||||||
Sbjct: 1903 cgttttgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttgga 1845

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1844 gacctgatgcggttatg 1828



to top

>gb|DQ008651.1| Alisma plantago-aquatica 26S ribosomal RNA gene, partial sequence
          Length = 3024

 Score =  121 bits (61), Expect = 3e-25
 Identities = 74/77 (96%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||||| |||||||||||||||||||||
Sbjct: 1760 cgttttgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttgga 1702

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1701 gacctgatgcggttatg 1685



to top

>gb|DQ008646.1| Asparagus officinalis 26S ribosomal RNA gene, partial sequence
          Length = 2071

 Score =  121 bits (61), Expect = 3e-25
 Identities = 74/77 (96%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||| |||||||||||||||||||||||||||||
Sbjct: 1268 cgttttgccgacttcccttgc-ctacattgctccattggccagaggctgttcaccttgga 1210

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1209 gacctgatgcggttatg 1193



to top

>gb|DQ008639.1| Anemopsis californica 26S ribosomal RNA gene, partial sequence
          Length = 2037

 Score =  121 bits (61), Expect = 3e-25
 Identities = 74/77 (96%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
Sbjct: 1266 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgaa 1208

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1207 gacctgatgcggttatg 1191



to top

>gb|AF479239.1| Cabomba caroliniana 26S ribosomal RNA gene, complete sequence
          Length = 3327

 Score =  121 bits (61), Expect = 3e-25
 Identities = 74/77 (96%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||| ||||||||||||||||||||||||||||||
Sbjct: 1898 cgttttgccgacttcccttgc-ctacatttttccattggccagaggctgttcaccttgga 1840

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1839 gacctgatgcggttatg 1823



to top

>gb|AF479091.1| Triphyophyllum peltatum 26S ribosomal RNA gene, complete sequence
          Length = 3311

 Score =  121 bits (61), Expect = 3e-25
 Identities = 74/77 (96%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| |||||||||||||||||||||||
Sbjct: 1892 cgttttgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttgga 1834

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1833 gacctgatgcggttatg 1817



to top

>dbj|AK110009.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-159-G06, full
            insert sequence
          Length = 2893

 Score =  121 bits (61), Expect = 3e-25
 Identities = 74/77 (96%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1359 cgttttgccgacttcccttgc-ctacattgttccattggccagaggctgttcaccttgga 1301

                             
Query: 61   gacctgatgcggttatg 77
            |||||| ||||||||||
Sbjct: 1300 gacctggtgcggttatg 1284



to top

>gb|AF389273.1| Eubrachion ambiguum 26S ribosomal RNA gene, partial sequence
          Length = 3339

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1901 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1843

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1842 gatgcggttatg 1831



to top

>gb|AF389261.1| Schoepfia schreberi 26S ribosomal RNA gene, partial sequence
          Length = 3334

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1898 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1840

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1839 gatgcggttatg 1828



to top

>gb|AF389258.1| Tinospora caffra 26S ribosomal RNA gene, partial sequence
          Length = 3339

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1899 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1841

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1840 gatgcggttatg 1829



to top

>gb|AY727968.1| Clethra cf. ferruginea JS-2005 26S ribosomal RNA gene, partial
            sequence
          Length = 3330

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1894 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1836

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1835 gatgcggttatg 1824



to top

>gb|AY727966.1| Heliamphora minor 26S ribosomal RNA gene, partial sequence
          Length = 3293

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1857 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1799

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1798 gatgcggttatg 1787



to top

>gb|AY727948.1| Pouteria campechiana 26S ribosomal RNA gene, partial sequence
          Length = 3258

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 1822 tgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttggagacct 1764

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1763 gatgcggttatg 1752



to top

>gb|AY260030.1| Mentzelia decapetala 26S ribosomal RNA gene, complete sequence
          Length = 3363

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1903 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1845

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1844 gatgcggttatg 1833



to top

>gb|AY957453.1| Santalum album 26S ribosomal RNA gene, partial sequence
          Length = 3306

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1892 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1834

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1833 gatgcggttatg 1822



to top

>gb|AF274669.1| Tetracarpaea tasmanica 26S ribosomal RNA gene, complete sequence
          Length = 3361

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1912 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1854

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1853 gatgcggttatg 1842



to top

>gb|AF274655.1| Myriophyllum exalbescens 26S ribosomal RNA gene, complete sequence
          Length = 3358

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1911 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1853

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1852 gatgcggttatg 1841



to top

>gb|AF297542.1|AF297542 Cornus volkensii 26S ribosomal RNA gene, partial sequence
          Length = 3361

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 1922 tgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttggagacct 1864

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1863 gatgcggttatg 1852



to top

>gb|DQ008654.1| Acorus calamus 26S ribosomal RNA gene, partial sequence
          Length = 2921

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 1857 tgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttggagacct 1799

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1798 gatgcggttatg 1787



to top

>gb|DQ008648.1| Carludovica palmata 26S ribosomal RNA gene, partial sequence
          Length = 2401

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 1263 tgccgacttcccttgc-ctacattgttccattggacagaggctgttcaccttggagacct 1205

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1204 gatgcggttatg 1193



to top

>gb|DQ008613.1| Mahonia bealei 26S ribosomal RNA gene, partial sequence
          Length = 3227

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1854 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1796

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1795 gatgcggttatg 1784



to top

>gb|AF479190.1| Codonopsis pilosula 26S ribosomal RNA gene, complete sequence
          Length = 3327

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1876 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1818

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1817 gatgcggttatg 1806



to top

>gb|AF479186.1| Nymphoides geminata 26S ribosomal RNA gene, complete sequence
          Length = 3200

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 1742 tgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttggagacct 1684

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1683 gatgcggttatg 1672



to top

>gb|AF479177.1| Hydrolea ovata 26S ribosomal RNA gene, complete sequence
          Length = 3331

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 1876 tgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttggagacct 1818

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1817 gatgcggttatg 1806



to top

>gb|AF479173.1| Schizanthus pinnatus 26S ribosomal RNA gene, complete sequence
          Length = 3307

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1892 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1834

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1833 gatgcggttatg 1822



to top

>gb|AF479171.1| Olea europaea 26S ribosomal RNA gene, partial sequence
          Length = 1603

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                       
Query: 6   tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
           |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 144 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 86

                       
Query: 66  gatgcggttatg 77
           ||||||||||||
Sbjct: 85  gatgcggttatg 74



to top

>gb|AF479150.1| Androsace spinulifera 26S ribosomal RNA gene, complete sequence
          Length = 3349

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1892 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1834

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1833 gatgcggttatg 1822



to top

>gb|AF479113.1| Euonymus alatus 26S ribosomal RNA gene, complete sequence
          Length = 3357

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AF479106.1| Alnus glutinosa 26S ribosomal RNA gene, complete sequence
          Length = 3365

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 1915 tgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttggagacct 1857

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1856 gatgcggttatg 1845



to top

>gb|AF479102.1| Ceanothus sanguineus 26S ribosomal RNA gene, complete sequence
          Length = 3365

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1907 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 1849

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1848 gatgcggttatg 1837



to top

>gb|AF479085.1| Polygonum sachalinense 26S ribosomal RNA gene, complete sequence
          Length = 3347

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AF181819.1|AF181819 Acanthosyris asipapote 26S ribosomal RNA, partial sequence
          Length = 402

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                       
Query: 6   tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
           |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 167 tgccgacttcccttgc-ctacattgttccattgaccagaggctgttcaccttggagacct 109

                       
Query: 66  gatgcggttatg 77
           ||||||||||||
Sbjct: 108 gatgcggttatg 97



to top

>gb|AF181810.1|AF181810 Phoradendron sulfuratum 26S ribosomal RNA, partial sequence
          Length = 395

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                       
Query: 6   tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
           |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 165 tgccgacttcccttgc-ctacattgttccatgggccagaggctgttcaccttggagacct 107

                       
Query: 66  gatgcggttatg 77
           ||||||||||||
Sbjct: 106 gatgcggttatg 95



to top

>gb|AF181809.1|AF181809 Phoradendron cf. tonduzii 26S ribosomal RNA, partial sequence
          Length = 402

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                       
Query: 6   tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
           |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 167 tgccgacttcccttgc-ctacattgttccatgggccagaggctgttcaccttggagacct 109

                       
Query: 66  gatgcggttatg 77
           ||||||||||||
Sbjct: 108 gatgcggttatg 97



to top

>gb|AF181808.1|AF181808 Phoradendron nervosum 26S ribosomal RNA, partial sequence
          Length = 402

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                       
Query: 6   tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
           |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 167 tgccgacttcccttgc-ctacattgttccatgggccagaggctgttcaccttggagacct 109

                       
Query: 66  gatgcggttatg 77
           ||||||||||||
Sbjct: 108 gatgcggttatg 97



to top

>gb|AF181807.1|AF181807 Phoradendron carneum 26S ribosomal RNA, partial sequence
          Length = 402

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                       
Query: 6   tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
           |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 167 tgccgacttcccttgc-ctacattgttccatgggccagaggctgttcaccttggagacct 109

                       
Query: 66  gatgcggttatg 77
           ||||||||||||
Sbjct: 108 gatgcggttatg 97



to top

>gb|AF181805.1|AF181805 Phoradendron tamaulipense 26S ribosomal RNA, partial sequence
          Length = 402

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                       
Query: 6   tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
           |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 167 tgccgacttcccttgc-ctacattgttccatgggccagaggctgttcaccttggagacct 109

                       
Query: 66  gatgcggttatg 77
           ||||||||||||
Sbjct: 108 gatgcggttatg 97



to top

>gb|AF181804.1|AF181804 Phoradendron heydeanum 26S ribosomal RNA, partial sequence
          Length = 401

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                       
Query: 6   tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
           |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 167 tgccgacttcccttgc-ctacattgttccatgggccagaggctgttcaccttggagacct 109

                       
Query: 66  gatgcggttatg 77
           ||||||||||||
Sbjct: 108 gatgcggttatg 97



to top

>gb|AF036490.1| Acorus gramineus large subunit 26S ribosomal RNA gene, partial
            sequence
          Length = 3213

 Score =  119 bits (60), Expect = 1e-24
 Identities = 70/72 (97%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 1920 tgccgacttcccttgc-ctacattgttccatcggccagaggctgttcaccttggagacct 1862

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1861 gatgcggttatg 1850



to top

>emb|AJ309824.2|ZMA309824 Zea mays 25S rRNA gene and transposon-like sequence
          Length = 10658

 Score =  115 bits (58), Expect = 2e-23
 Identities = 75/78 (96%), Gaps = 2/78 (2%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagagg-ctgttcaccttgg 59
            |||| |||||||||||||||| |||||||||||||||||||||||| |||||||||||||
Sbjct: 9151 cgttttgccgacttcccttgc-ctacattgttccattggccagaggtctgttcaccttgg 9093

                              
Query: 60   agacctgatgcggttatg 77
            ||||||||||||||||||
Sbjct: 9092 agacctgatgcggttatg 9075



to top

>gb|AF389243.1| Buxus sempervirens 26S ribosomal RNA gene, partial sequence
          Length = 3319

 Score =  113 bits (57), Expect = 7e-23
 Identities = 73/77 (94%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| | |||||||||||||||||||||
Sbjct: 1885 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1827

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1826 gacctgatgcggttatg 1810



to top

>gb|AY095470.1| Trimenia moorei 26S ribosomal RNA gene, partial sequence
          Length = 3308

 Score =  113 bits (57), Expect = 7e-23
 Identities = 73/77 (94%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| | |||||||||||||||||||||
Sbjct: 1899 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1841

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1840 gacctgatgcggttatg 1824



to top

>gb|AY095454.1| Calycanthus occidentalis 26S ribosomal RNA gene, partial sequence
          Length = 3202

 Score =  113 bits (57), Expect = 7e-23
 Identities = 73/77 (94%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| | |||||||||||||||||||||
Sbjct: 1791 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1733

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1732 gacctgatgcggttatg 1716



to top

>gb|AY292911.1| Buxus sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3216

 Score =  113 bits (57), Expect = 7e-23
 Identities = 73/77 (94%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| | |||||||||||||||||||||
Sbjct: 1792 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1734

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1733 gacctgatgcggttatg 1717



to top

>gb|AY292895.1| Peperomia sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3494

 Score =  113 bits (57), Expect = 7e-23
 Identities = 73/77 (94%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| | |||||||||||||||||||||
Sbjct: 2047 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1989

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1988 gacctgatgcggttatg 1972



to top

>gb|AY292891.1| Hedycarya sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3408

 Score =  113 bits (57), Expect = 7e-23
 Identities = 73/77 (94%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| | |||||||||||||||||||||
Sbjct: 2051 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1993

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1992 gacctgatgcggttatg 1976



to top

>gb|AY292890.1| Calycanthus sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3217

 Score =  113 bits (57), Expect = 7e-23
 Identities = 73/77 (94%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| | |||||||||||||||||||||
Sbjct: 1791 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1733

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1732 gacctgatgcggttatg 1716



to top

>gb|AF274663.1| Pterostemon rotundifolius 26S ribosomal RNA gene, complete sequence
          Length = 3365

 Score =  113 bits (57), Expect = 7e-23
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1913 tgccgacttcccttgc-ctacattgttccatngaccagaggctgttcaccttggagacct 1855

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1854 gatgcggttatg 1843



to top

>gb|DQ008659.1| Illicium floridanum 26S ribosomal RNA gene, partial sequence
          Length = 2067

 Score =  113 bits (57), Expect = 7e-23
 Identities = 73/77 (94%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| | |||||||||||||||||||||
Sbjct: 1270 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1212

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1211 gacctgatgcggttatg 1195



to top

>gb|DQ008658.1| Schisandra sphenanthera 26S ribosomal RNA gene, partial sequence
          Length = 3115

 Score =  113 bits (57), Expect = 7e-23
 Identities = 73/77 (94%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| | |||||||||||||||||||||
Sbjct: 1894 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1836

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1835 gacctgatgcggttatg 1819



to top

>gb|DQ008644.1| Saruma henryi 26S ribosomal RNA gene, partial sequence
          Length = 3260

 Score =  113 bits (57), Expect = 7e-23
 Identities = 73/77 (94%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| | |||||||||||||||||||||
Sbjct: 1869 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1811

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1810 gacctgatgcggttatg 1794



to top

>gb|DQ008643.1| Asarum canadense 26S ribosomal RNA gene, partial sequence
          Length = 2247

 Score =  113 bits (57), Expect = 7e-23
 Identities = 73/77 (94%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| | |||||||||||||||||||||
Sbjct: 1769 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1711

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1710 gacctgatgcggttatg 1694



to top

>gb|DQ008633.1| Idiospermum australiense 26S ribosomal RNA gene, partial sequence
          Length = 2408

 Score =  113 bits (57), Expect = 7e-23
 Identities = 73/77 (94%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| | |||||||||||||||||||||
Sbjct: 1270 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1212

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1211 gacctgatgcggttatg 1195



to top

>gb|DQ008631.1| Siparuna decipiens 26S ribosomal RNA gene, partial sequence
          Length = 2357

 Score =  113 bits (57), Expect = 7e-23
 Identities = 73/77 (94%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| | |||||||||||||||||||||
Sbjct: 1223 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1165

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1164 gacctgatgcggttatg 1148



to top

>gb|DQ008630.1| Doryphora sassafras 26S ribosomal RNA gene, partial sequence
          Length = 2064

 Score =  113 bits (57), Expect = 7e-23
 Identities = 73/77 (94%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| | |||||||||||||||||||||
Sbjct: 1267 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1209

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1208 gacctgatgcggttatg 1192



to top

>gb|DQ008629.1| Daphnandra micrantha 26S ribosomal RNA gene, partial sequence
          Length = 2376

 Score =  113 bits (57), Expect = 7e-23
 Identities = 73/77 (94%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| | |||||||||||||||||||||
Sbjct: 1246 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1188

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1187 gacctgatgcggttatg 1171



to top

>gb|DQ008627.1| Cryptocarya meissneriana 26S ribosomal RNA gene, partial sequence
          Length = 2065

 Score =  113 bits (57), Expect = 7e-23
 Identities = 73/77 (94%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| | |||||||||||||||||||||
Sbjct: 1268 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1210

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1209 gacctgatgcggttatg 1193



to top

>gb|DQ008626.1| Laurus nobilis 26S ribosomal RNA gene, partial sequence
          Length = 2064

 Score =  113 bits (57), Expect = 7e-23
 Identities = 73/77 (94%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| | |||||||||||||||||||||
Sbjct: 1267 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1209

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1208 gacctgatgcggttatg 1192



to top

>gb|DQ008624.1| Gyrocarpus americanus 26S ribosomal RNA gene, partial sequence
          Length = 2939

 Score =  113 bits (57), Expect = 7e-23
 Identities = 73/77 (94%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| | |||||||||||||||||||||
Sbjct: 1490 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1432

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1431 gacctgatgcggttatg 1415



to top

>gb|AF479223.1| Myrothamnus flabellifolius 26S ribosomal RNA gene, partial sequence
          Length = 2775

 Score =  113 bits (57), Expect = 7e-23
 Identities = 73/77 (94%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| | |||||||||||||||||||||
Sbjct: 1913 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1855

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1854 gacctgatgcggttatg 1838



to top

>gb|AF479097.1| Tetracera asiatica 26S ribosomal RNA gene, complete sequence
          Length = 3052

 Score =  113 bits (57), Expect = 7e-23
 Identities = 73/77 (94%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
            |||| |||||||||||||||| |||||||||||||| | |||||||||||||||||||||
Sbjct: 1910 cgttttgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttgga 1852

                             
Query: 61   gacctgatgcggttatg 77
            |||||||||||||||||
Sbjct: 1851 gacctgatgcggttatg 1835



to top

>dbj|AK107285.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-126-B05, full
           insert sequence
          Length = 1586

 Score =  113 bits (57), Expect = 7e-23
 Identities = 64/65 (98%), Gaps = 1/65 (1%)
 Strand = Plus / Minus

                                                                       
Query: 13  ttcccttgcactacattgttccattggccagaggctgttcaccttggagacctgatgcgg 72
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 520 ttcccttgc-ctacattgttccattggccagaggctgttcaccttggagacctgatgcgg 462

                
Query: 73  ttatg 77
           |||||
Sbjct: 461 ttatg 457



to top

>gb|M35386.1|RICRGC4 Rice 25S rRNA gene
          Length = 161

 Score =  113 bits (57), Expect = 7e-23
 Identities = 73/77 (94%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgttatgccgacttcccttgcactacattgttccattggccagaggctgttcaccttgga 60
           |||| |||||||||||||||| ||||||||||||||||||||||||  ||||||||||||
Sbjct: 156 cgttttgccgacttcccttgc-ctacattgttccattggccagaggtcgttcaccttgga 98

                            
Query: 61  gacctgatgcggttatg 77
           |||||||||||||||||
Sbjct: 97  gacctgatgcggttatg 81



to top

>gb|DQ287987.1| Abutilon theophrasti 26S ribosomal RNA gene, partial sequence
          Length = 672

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                       
Query: 6   tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
           |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 213 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 155

                       
Query: 66  gatgcggttatg 77
           ||||||||||||
Sbjct: 154 gatgcggttatg 143



to top

>gb|AY530924.1| Cornus capitata 26S ribosomal RNA gene, complete sequence
          Length = 3329

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1818 gatgcggttatg 1807



to top

>gb|AY555065.1| Corchorus olitorius 26S ribosomal RNA gene, partial sequence
          Length = 1010

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                       
Query: 6   tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
           |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 127 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 69

                       
Query: 66  gatgcggttatg 77
           ||||||||||||
Sbjct: 68  gatgcggttatg 57



to top

>gb|AF389276.1| Sarracenia purpurea 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1898 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1840

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1839 gatgcggttatg 1828



to top

>gb|AF389272.1| Sabia swinhoei 26S ribosomal RNA gene, partial sequence
          Length = 3340

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1905 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1847

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1846 gatgcggttatg 1835



to top

>gb|AF389271.1| Meliosma veitchiorum 26S ribosomal RNA gene, partial sequence
          Length = 3338

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1905 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1847

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1846 gatgcggttatg 1835



to top

>gb|AF389270.1| Xanthorhiza simplicissima 26S ribosomal RNA gene, partial sequence
          Length = 3338

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AF389268.1| Hydrastis canadensis 26S ribosomal RNA gene, partial sequence
          Length = 3340

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1899 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1841

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1840 gatgcggttatg 1829



to top

>gb|AF389267.1| Glaucidium palmatum 26S ribosomal RNA gene, partial sequence
          Length = 3337

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AF389266.1| Coptis trifolia 26S ribosomal RNA gene, partial sequence
          Length = 3338

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AF389265.1| Roupala macrophylla 26S ribosomal RNA gene, partial sequence
          Length = 3344

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1905 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1847

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1846 gatgcggttatg 1835



to top

>gb|AF389264.1| Pteridophyllum racemosum 26S ribosomal RNA gene, partial sequence
          Length = 3342

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1900 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1842

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1841 gatgcggttatg 1830



to top

>gb|AF389262.1| Dicentra eximia 26S ribosomal RNA gene, partial sequence
          Length = 3341

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1900 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1842

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1841 gatgcggttatg 1830



to top

>gb|AF389260.1| Nepenthes sp. Nickrent 3056 26S ribosomal RNA gene, partial sequence
          Length = 3325

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1895 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1837

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1836 gatgcggttatg 1825



to top

>gb|AF389256.1| Magnolia denudata 26S ribosomal RNA gene, partial sequence
          Length = 3340

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1899 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1841

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1840 gatgcggttatg 1829



to top

>gb|AF389255.1| Sinofranchetia chinensis 26S ribosomal RNA gene, partial sequence
          Length = 3342

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1899 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1841

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1840 gatgcggttatg 1829



to top

>gb|AF389252.1| Philadelphus lewisii 26S ribosomal RNA gene, partial sequence
          Length = 3332

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AF389251.1| Galbulimima belgraveana 26S ribosomal RNA gene, partial sequence
          Length = 3349

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1905 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1847

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1846 gatgcggttatg 1835



to top

>gb|AF389250.1| Gunnera manicata 26S ribosomal RNA gene, partial sequence
          Length = 3335

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AF389249.1| Euptelea polyandra 26S ribosomal RNA gene, partial sequence
          Length = 3343

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1903 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1845

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1844 gatgcggttatg 1833



to top

>gb|AF389248.1| Drosera capensis 26S ribosomal RNA gene, partial sequence
          Length = 3334

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1902 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1844

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1843 gatgcggttatg 1832



to top

>gb|AF389247.1| Didymeles perrieri 26S ribosomal RNA gene, partial sequence
          Length = 3326

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1892 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1834

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1833 gatgcggttatg 1822



to top

>gb|AF389244.1| Pachysandra procumbens 26S ribosomal RNA gene, partial sequence
          Length = 3334

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1896 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1838

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1837 gatgcggttatg 1826



to top

>gb|AF389242.1| Berberidopsis corallina 26S ribosomal RNA gene, partial sequence
          Length = 3335

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1899 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1841

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1840 gatgcggttatg 1829



to top

>gb|AF389239.1| Aextoxicon punctatum 26S ribosomal RNA gene, partial sequence
          Length = 3335

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1899 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1841

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1840 gatgcggttatg 1829



to top

>gb|AY189151.1| Pittosporum tobira 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3307

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1819 gatgcggttatg 1808



to top

>gb|AY189116.1| Tupidanthus calyptratus 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3288

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1873 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1815

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1814 gatgcggttatg 1803



to top

>gb|AY189115.1| Trevesia palmata 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3287

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1818 gatgcggttatg 1807



to top

>gb|AY189114.1| Trachymene coerulea 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3311

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1819 gatgcggttatg 1808



to top

>gb|AY189112.1| Tetraplasandra hawaiensis 26S large subunit ribosomal RNA gene,
            partial sequence
          Length = 3292

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1876 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1818

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1817 gatgcggttatg 1806



to top

>gb|AY189109.1| Sollya heterophylla 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3286

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1879 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1821

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1820 gatgcggttatg 1809



to top

>gb|AY189108.1| Schefflera arboricola 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3290

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1873 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1815

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1814 gatgcggttatg 1803



to top

>gb|AY189107.1| Sanicula gregari 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3295

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1879 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1821

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1820 gatgcggttatg 1809



to top

>gb|AY189106.1| Rhytidosporum alpinum 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3302

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1870 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1812

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1811 gatgcggttatg 1800



to top

>gb|AY189105.1| Reynoldsia sandwicensis 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1818 gatgcggttatg 1807



to top

>gb|AY189104.1| Pseudosciadium balansae 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1819 gatgcggttatg 1808



to top

>gb|AY189103.1| Pseudopanax arboreus 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3286

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1818 gatgcggttatg 1807



to top

>gb|AY189102.1| Polyscias guilfoylei 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3295

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1818 gatgcggttatg 1807



to top

>gb|AY189100.1| Pimpinella saxifraga 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1818 gatgcggttatg 1807



to top

>gb|AY189097.1| Osmoxylon novoguineense 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3300

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1819 gatgcggttatg 1808



to top

>gb|AY189096.1| Neogoezia minor 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3288

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1819 gatgcggttatg 1808



to top

>gb|AY189092.1| Mulinum ulicinum 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3255

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1855 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1797

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1796 gatgcggttatg 1785



to top

>gb|AY189091.1| Mulinum spinosum 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3301

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1853 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1795

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1794 gatgcggttatg 1783



to top

>gb|AY189090.1| Mulinum chillanense 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3269

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1848 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1790

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1789 gatgcggttatg 1778



to top

>gb|AY189088.1| Motherwellia haplosciadea 26S large subunit ribosomal RNA gene,
            partial sequence
          Length = 3311

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1818 gatgcggttatg 1807



to top

>gb|AY189085.1| Melanophylla alnifolia 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3260

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1818 gatgcggttatg 1807



to top

>gb|AY189081.1| Lagoecia cuminoides 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1818 gatgcggttatg 1807



to top

>gb|AY189080.1| Kalopanax pictus 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3288

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1819 gatgcggttatg 1808



to top

>gb|AY189079.1| Hymenosporum flavum 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3305

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1875 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1817

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1816 gatgcggttatg 1805



to top

>gb|AY189077.1| Hydrocotyle modesta 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3223

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1846 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1788

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1787 gatgcggttatg 1776



to top

>gb|AY189076.1| Hydrocotyle bowlesioides 26S large subunit ribosomal RNA gene,
            partial sequence
          Length = 3295

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1819 gatgcggttatg 1808



to top

>gb|AY189075.1| Huanaca acaulis 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3292

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1872 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1814

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1813 gatgcggttatg 1802



to top

>gb|AY189074.1| Heteromorpha trifoliata 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3295

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1819 gatgcggttatg 1808



to top

>gb|AY189073.1| Hedera helix 26S large subunit ribosomal RNA gene, partial sequence
          Length = 3277

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1818 gatgcggttatg 1807



to top

>gb|AY189072.1| Gymnophyton polycephalum 26S large subunit ribosomal RNA gene,
            partial sequence
          Length = 3277

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1870 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1812

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1811 gatgcggttatg 1800



to top

>gb|AY189071.1| Griselinia lucida 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3312

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1819 gatgcggttatg 1808



to top

>gb|AY189070.1| Gastonia rodriguesiana 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3229

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1822 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1764

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1763 gatgcggttatg 1752



to top

>gb|AY189068.1| Eryngium bourgattii 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3285

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1875 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1817

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1816 gatgcggttatg 1805



to top

>gb|AY189067.1| Eremocharis fruticosa 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3285

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1819 gatgcggttatg 1808



to top

>gb|AY189066.1| Endressia castellana 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3309

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1876 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1818

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1817 gatgcggttatg 1806



to top

>gb|AY189065.1| Eleutherococcus trifoliatus 26S large subunit ribosomal RNA gene,
            partial sequence
          Length = 3293

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1819 gatgcggttatg 1808



to top

>gb|AY189064.1| Donnellsmithia cordata 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1818 gatgcggttatg 1807



to top

>gb|AY189063.1| Diplaspis hydrocotyle 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1819 gatgcggttatg 1808



to top

>gb|AY189062.1| Dickinsia hydrocotyloides 26S large subunit ribosomal RNA gene,
            partial sequence
          Length = 3282

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1875 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1817

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1816 gatgcggttatg 1805



to top

>gb|AY189060.1| Dendropanax arboreus 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3283

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1874 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1816

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1815 gatgcggttatg 1804



to top

>gb|AY189059.1| Delarbrea collina 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3313

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1818 gatgcggttatg 1807



to top

>gb|AY189057.1| Cussonia spicata 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3304

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1819 gatgcggttatg 1808



to top

>gb|AY189056.1| Coriandrum sativum 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1818 gatgcggttatg 1807



to top

>gb|AY189055.1| Cheirodendron trigynum 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3291

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1818 gatgcggttatg 1807



to top

>gb|AY189053.1| Bupleurum falcatum 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3309

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1818 gatgcggttatg 1807



to top

>gb|AY189048.1| Azorella trifurcata 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3260

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1846 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1788

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1787 gatgcggttatg 1776



to top

>gb|AY189046.1| Azorella selago 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3309

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1818 gatgcggttatg 1807



to top

>gb|AY189044.1| Azorella macquariensis 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3260

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1870 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1812

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1811 gatgcggttatg 1800



to top

>gb|AY189042.1| Azorella fuegiana 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 2730

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1848 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1790

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1789 gatgcggttatg 1778



to top

>gb|AY189040.1| Astrantia major 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3312

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1819 gatgcggttatg 1808



to top

>gb|AY189038.1| Arracacia aegopodioides 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3291

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1818 gatgcggttatg 1807



to top

>gb|AY189035.1| Aralia spinosa 26S large subunit ribosomal RNA gene, partial sequence
          Length = 3295

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1818 gatgcggttatg 1807



to top

>gb|AY189034.1| Apium graveolens 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1818 gatgcggttatg 1807



to top

>gb|AY189031.1| Angelica lucida 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3275

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1876 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1818

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1817 gatgcggttatg 1806



to top

>gb|AY189030.1| Aegopodium podagraria 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3288

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1878 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1820

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1819 gatgcggttatg 1808



to top

>gb|AY189029.1| Actinotus helianthi 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1876 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1818

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1817 gatgcggttatg 1806



to top

>gb|AY189028.1| Aciphylla aurea 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3308

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1877 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1819

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1818 gatgcggttatg 1807



to top

>gb|AY727986.1| Diapensia lapponica 26S ribosomal RNA gene, partial sequence
          Length = 3329

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1895 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1837

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1836 gatgcggttatg 1825



to top

>gb|AY727985.1| Shortia uniflora 26S ribosomal RNA gene, partial sequence
          Length = 3327

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1893 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1835

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1834 gatgcggttatg 1823



to top

>gb|AY727984.1| Shortia soldanelloides 26S ribosomal RNA gene, partial sequence
          Length = 3329

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1895 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1837

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1836 gatgcggttatg 1825



to top

>gb|AY727983.1| Galax urceolata 26S ribosomal RNA gene, partial sequence
          Length = 3329

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AY727982.1| Bruinsmia styracoides 26S ribosomal RNA gene, partial sequence
          Length = 3335

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1899 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1841

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1840 gatgcggttatg 1829



to top

>gb|AY727981.1| Halesia carolina 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AY727980.1| Styrax japonicus 26S ribosomal RNA gene, partial sequence
          Length = 3335

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AY727979.1| Symplocos pendula 26S ribosomal RNA gene, partial sequence
          Length = 3331

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AY727978.1| Symplocos zizyphoides 26S ribosomal RNA gene, partial sequence
          Length = 3304

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1870 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1812

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1811 gatgcggttatg 1800



to top

>gb|AY727977.1| Gordonia lasianthus 26S ribosomal RNA gene, partial sequence
          Length = 3335

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AY727976.1| Schima sp. JS-2005 26S ribosomal RNA gene, partial sequence
          Length = 3335

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AY727975.1| Camellia sinensis 26S ribosomal RNA gene, partial sequence
          Length = 3336

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1898 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1840

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1839 gatgcggttatg 1828



to top

>gb|AY727974.1| Vaccinium myrtillus 26S ribosomal RNA gene, partial sequence
          Length = 3320

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1886 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1828

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1827 gatgcggttatg 1816



to top

>gb|AY727973.1| Rhododendron impeditum 26S ribosomal RNA gene, partial sequence
          Length = 3334

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1898 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1840

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1839 gatgcggttatg 1828



to top

>gb|AY727972.1| Empetrum hermaphroditum 26S ribosomal RNA gene, partial sequence
          Length = 3334

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1898 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1840

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1839 gatgcggttatg 1828



to top

>gb|AY727971.1| Chimaphila umbellata 26S ribosomal RNA gene, partial sequence
          Length = 3331

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AY727970.1| Enkianthus campanulatus 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AY727969.1| Cyrilla racemiflora 26S ribosomal RNA gene, partial sequence
          Length = 3331

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AY727967.1| Sarracenia psittacina 26S ribosomal RNA gene, partial sequence
          Length = 3336

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1899 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1841

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1840 gatgcggttatg 1829



to top

>gb|AY727965.1| Roridula gorgonias 26S ribosomal RNA gene, partial sequence
          Length = 3264

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1830 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1772

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1771 gatgcggttatg 1760



to top

>gb|AY727964.1| Actinidia arguta 26S ribosomal RNA gene, partial sequence
          Length = 3325

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1888 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1830

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1829 gatgcggttatg 1818



to top

>gb|AY727963.1| Lysimachia vulgaris 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AY727962.1| Clavija lancifolia 26S ribosomal RNA gene, partial sequence
          Length = 3336

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1898 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1840

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1839 gatgcggttatg 1828



to top

>gb|AY727961.1| Myrsine africana 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AY727960.1| Primula elatior 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AY727959.1| Maesa japonica 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AY727958.1| Samolus valerandi 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1895 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1837

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1836 gatgcggttatg 1825



to top

>gb|AY727956.1| Lissocarpa benthamii 26S ribosomal RNA gene, partial sequence
          Length = 3330

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1894 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1836

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1835 gatgcggttatg 1824



to top

>gb|AY727955.1| Ternstroemia stahlii 26S ribosomal RNA gene, partial sequence
          Length = 3334

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1898 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1840

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1839 gatgcggttatg 1828



to top

>gb|AY727954.1| Pentaphylax euryoides 26S ribosomal RNA gene, partial sequence
          Length = 3256

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1820 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1762

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1761 gatgcggttatg 1750



to top

>gb|AY727953.1| Eurya japonica 26S ribosomal RNA gene, partial sequence
          Length = 3262

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1826 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1768

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1767 gatgcggttatg 1756



to top

>gb|AY727952.1| Cleyera japonica 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgcccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AY727951.1| Napoleona sp. JS-2005 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AY727950.1| Couroupita guianensis 26S ribosomal RNA gene, partial sequence
          Length = 3332

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1898 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1840

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1839 gatgcggttatg 1828



to top

>gb|AY727949.1| Barringtonia asiatica 26S ribosomal RNA gene, partial sequence
          Length = 3331

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AY727947.1| Madhuca microphylla 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AY727946.1| Manilkara zapota 26S ribosomal RNA gene, partial sequence
          Length = 3332

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1896 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1838

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1837 gatgcggttatg 1826



to top

>gb|AY727945.1| Palaquium ferox 26S ribosomal RNA gene, partial sequence
          Length = 3337

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1900 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1842

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1841 gatgcggttatg 1830



to top

>gb|AY727940.1| Fouquieria fasciculata 26S ribosomal RNA gene, partial sequence
          Length = 3329

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AY727939.1| Fouquieria columnaris 26S ribosomal RNA gene, partial sequence
          Length = 3329

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AY727938.1| Norantea guianensis 26S ribosomal RNA gene, partial sequence
          Length = 3330

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1897 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1839

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1838 gatgcggttatg 1827



to top

>gb|AY727937.1| Marcgravia rectiflora 26S ribosomal RNA gene, partial sequence
          Length = 3332

 Score =  111 bits (56), Expect = 3e-22
 Identities = 69/72 (95%), Gaps = 1/72 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgccgacttcccttgcactacattgttccattggccagaggctgttcaccttggagacct 65
            |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 1898 tgccgacttcccttgc-ctacattgttccatcgaccagaggctgttcaccttggagacct 1840

                        
Query: 66   gatgcggttatg 77
            ||||||||||||
Sbjct: 1839 gatgcggttatg 1828


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 490,005
Number of Sequences: 3902068
Number of extensions: 490005
Number of successful extensions: 39182
Number of sequences better than 10.0: 3204
Number of HSP's better than 10.0 without gapping: 3078
Number of HSP's successfully gapped in prelim test: 126
Number of HSP's that attempted gapping in prelim test: 33251
Number of HSP's gapped (non-prelim): 4271
length of query: 77
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 56
effective length of database: 17,151,101,840
effective search space: 960461703040
effective search space used: 960461703040
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top