ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast37e03
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 123 4e-25
2dbj|AP003523.3| Oryza sativa (japonica cultivar-group) genomic D... 123 4e-25
3dbj|AK103715.1| Oryza sativa (japonica cultivar-group) cDNA clon... 123 4e-25
4gb|AY105889.1| Zea mays PCO106909 mRNA sequence 64 3e-07
5gb|AC161052.2| Mus musculus BAC clone RP23-393J15 from chromosom... 50 0.005
6gb|AC024329.9| Homo sapiens, clone RP11-30P9, complete sequence 48 0.018
7ref|XM_795529.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 44 0.28
8gb|AC147628.4| Mus musculus BAC clone RP24-476D20 from chromosom... 42 1.1
9gb|AC132322.3| Mus musculus BAC clone RP24-262F3 from chromosome... 42 1.1
10emb|Z68132.1|CEF09C8 Caenorhabditis elegans Cosmid F09C8, comple... 42 1.1
11gb|AC147641.3| Mus musculus BAC clone RP23-43L22 from 14, comple... 42 1.1
12dbj|AP004468.1| Lotus japonicus genomic DNA, chromosome 4, clone... 42 1.1
13ref|XM_529043.1| PREDICTED: Pan troglodytes similar to zinc fing... 40 4.4
14ref|XM_419244.1| PREDICTED: Gallus gallus similar to steerin1 pr... 40 4.4
15gb|AC136976.5| Mus musculus BAC clone RP23-362K12 from chromosom... 40 4.4
16gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete... 40 4.4
17emb|CR769776.8| Human DNA sequence from clone RP11-793G16 on chr... 40 4.4
18emb|BX664718.7| Human DNA sequence from clone RP11-175I6 on chro... 40 4.4
19emb|CR848007.6| Human DNA sequence from clone RP11-115C9 on chro... 40 4.4
20emb|AL773545.13| Human DNA sequence from clone RP11-216M21 on ch... 40 4.4
21emb|BX649567.3| Human DNA sequence from clone RP11-195B21 on chr... 40 4.4
22emb|AL513478.10| Human DNA sequence from clone RP11-327I22 on ch... 40 4.4
23gb|AC073553.5| Mus musculus strain C57BL/6J chromosome 12 clone ... 40 4.4
24gb|BC021176.2| Homo sapiens zinc finger, CCHC domain containing ... 40 4.4
25emb|BX649563.5| Human DNA sequence from clone RP11-213O5 on chro... 40 4.4
26gb|AC008661.6| Homo sapiens chromosome 5 clone CTB-28J9, complet... 40 4.4
27gb|AC090887.3| Mus musculus strain C57BL/6J clone RP23-404D8, co... 40 4.4
28gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete g... 40 4.4
29dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.4
30dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.4
31dbj|AP006878.1| Thermococcus kodakarensis KOD1 DNA, complete genome 40 4.4
32gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 4.4
33emb|BX276117.5| Zebrafish DNA sequence from clone CH211-112K18 i... 40 4.4
34dbj|AP005419.3| Oryza sativa (japonica cultivar-group) genomic D... 40 4.4
35emb|AL355000.11| Human DNA sequence from clone RP11-78N10 on chr... 40 4.4
36dbj|AP004879.3| Oryza sativa (japonica cultivar-group) genomic D... 40 4.4
37dbj|AP004777.3| Oryza sativa (japonica cultivar-group) genomic D... 40 4.4
38gb|AE001439.1| Helicobacter pylori J99, complete genome 40 4.4
39emb|AL132990.4|CNS01DTY Human chromosome 14 DNA sequence BAC R-2... 40 4.4
40gb|AC004386.1|AC004386 Homo Sapiens Chromosome X clone bWXD691, ... 40 4.4
41gb|AC002418.1|AC002418 Human Chromosome X, complete sequence 40 4.4
42emb|AJ851868.2| Mus musculus immunoglobulin heavy chain locus co... 40 4.4
43ref|NM_203303.1| Homo sapiens zinc finger, CCHC domain containin... 40 4.4
44emb|AL662925.12| Mouse DNA sequence from clone RP23-226M12 on ch... 40 4.4 
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  123 bits (62), Expect = 4e-25
 Identities = 71/74 (95%)
 Strand = Plus / Minus

                                                                            
Query: 249      actagatggagcaggtgtagctggggggaggggtcttgccgcaggtgaggaggagctgga 308
                ||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||
Sbjct: 25844315 actagatggagcaggtgtagccggggggagggttcttgccgcaggtgaggaggagctgga 25844256

                              
Query: 309      gggcgaggggcagg 322
                | ||||||||||||
Sbjct: 25844255 gcgcgaggggcagg 25844242
to top
>dbj|AP003523.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0416A11
          Length = 171519

 Score =  123 bits (62), Expect = 4e-25
 Identities = 71/74 (95%)
 Strand = Plus / Minus

                                                                          
Query: 249    actagatggagcaggtgtagctggggggaggggtcttgccgcaggtgaggaggagctgga 308
              ||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||
Sbjct: 126519 actagatggagcaggtgtagccggggggagggttcttgccgcaggtgaggaggagctgga 126460

                            
Query: 309    gggcgaggggcagg 322
              | ||||||||||||
Sbjct: 126459 gcgcgaggggcagg 126446
to top
>dbj|AK103715.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033137N14, full
           insert sequence
          Length = 1338

 Score =  123 bits (62), Expect = 4e-25
 Identities = 71/74 (95%)
 Strand = Plus / Minus

                                                                       
Query: 249 actagatggagcaggtgtagctggggggaggggtcttgccgcaggtgaggaggagctgga 308
           ||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||
Sbjct: 860 actagatggagcaggtgtagccggggggagggttcttgccgcaggtgaggaggagctgga 801

                         
Query: 309 gggcgaggggcagg 322
           | ||||||||||||
Sbjct: 800 gcgcgaggggcagg 787
to top
>gb|AY105889.1| Zea mays PCO106909 mRNA sequence
          Length = 1420

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 56/64 (87%)
 Strand = Plus / Minus

                                                                       
Query: 259 gcaggtgtagctggggggaggggtcttgccgcaggtgaggaggagctggagggcgagggg 318
           |||||||||||  || || || ||||||||||||||||||||||||||||| || || ||
Sbjct: 953 gcaggtgtagcccggcggcggcgtcttgccgcaggtgaggaggagctggagcgccagtgg 894

               
Query: 319 cagg 322
           ||||
Sbjct: 893 cagg 890
to top
>gb|AC161052.2| Mus musculus BAC clone RP23-393J15 from chromosome 12, complete
            sequence
          Length = 201284

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 295  gaggaggagctggagggcgaggggcagga 323
            ||||||||||||||||| |||||||||||
Sbjct: 7974 gaggaggagctggagggggaggggcagga 8002
to top
>gb|AC024329.9| Homo sapiens, clone RP11-30P9, complete sequence
          Length = 158921

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 56    accaaacacaaaaaggaaaccacaagaaatga 87
             |||| ||||||||||||||||||| |||||||
Sbjct: 72280 accacacacaaaaaggaaaccacatgaaatga 72249
to top
>ref|XM_795529.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC590804 (LOC590804), mRNA
          Length = 675

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 307 gagggcgaggggcaggacaaggttga 332
           |||||||||||||||||| |||||||
Sbjct: 268 gagggcgaggggcaggacgaggttga 293
to top
>gb|AC147628.4| Mus musculus BAC clone RP24-476D20 from chromosome 14, complete sequence
          Length = 170642

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     taatataaccaaacacaaaaa 69
              |||||||||||||||||||||
Sbjct: 140589 taatataaccaaacacaaaaa 140569
to top
>gb|AC132322.3| Mus musculus BAC clone RP24-262F3 from chromosome 13, complete sequence
          Length = 155179

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 292    ggtgaggaggagctggagggc 312
              |||||||||||||||||||||
Sbjct: 126436 ggtgaggaggagctggagggc 126456
to top
>emb|Z68132.1|CEF09C8 Caenorhabditis elegans Cosmid F09C8, complete sequence
          Length = 30140

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 71    gaaaccacaagaaatgacgaa 91
             |||||||||||||||||||||
Sbjct: 28321 gaaaccacaagaaatgacgaa 28301
to top
>gb|AC147641.3| Mus musculus BAC clone RP23-43L22 from 14, complete sequence
          Length = 247999

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    taatataaccaaacacaaaaa 69
             |||||||||||||||||||||
Sbjct: 22797 taatataaccaaacacaaaaa 22777
to top
>dbj|AP004468.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT09A24, TM0003,
             complete sequence
          Length = 88828

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 179   ttgacatcctctcatgtcgat 199
             |||||||||||||||||||||
Sbjct: 55096 ttgacatcctctcatgtcgat 55076
to top
>ref|XM_529043.1| PREDICTED: Pan troglodytes similar to zinc finger, CCHC domain
           containing 13; cellular nucleic acid binding
           protein-like; 4930513O09RIK (LOC473670), mRNA
          Length = 1041

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 295 gaggaggagctggagggcga 314
           ||||||||||||||||||||
Sbjct: 62  gaggaggagctggagggcga 81
to top
>ref|XM_419244.1| PREDICTED: Gallus gallus similar to steerin1 protein (LOC421164),
            mRNA
          Length = 4986

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 297  ggaggagctggagggcgagg 316
            ||||||||||||||||||||
Sbjct: 1605 ggaggagctggagggcgagg 1624
to top
>gb|AC136976.5| Mus musculus BAC clone RP23-362K12 from chromosome 13, complete sequence
          Length = 147695

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 128    tctctttcttcttcttgctc 147
              ||||||||||||||||||||
Sbjct: 115188 tctctttcttcttcttgctc 115207
to top
>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome
          Length = 6093698

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 314     aggggcaggacaaggttgat 333
               ||||||||||||||||||||
Sbjct: 2539957 aggggcaggacaaggttgat 2539976
to top
>emb|CR769776.8| Human DNA sequence from clone RP11-793G16 on chromosome 9 Contains three
              novel pseudogenes, the gene for a novel protein similar to
              ankyrin repeat domain 20A (ANKRD20A), the gene for a  novel
              protein similar to Ankyrin repeat domain protein 18A
              (LOC441424), a pseudogene similar to part of cytochrome
              P450 family protein, a novel zinc finger pseudogene and a
              CpG island, complete sequence
          Length = 161157

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 60     aacacaaaaaggaaaccaca 79
              ||||||||||||||||||||
Sbjct: 130960 aacacaaaaaggaaaccaca 130979
to top
>emb|BX664718.7| Human DNA sequence from clone RP11-175I6 on chromosome 9 Conatins a
              pseudogene similar to part of fibroblast growth factor 7
              (keratinocyte growth factor) (FGF7), two novel pseudogenes,
              a pseudogene similar to part of G protein-coupled receptor
              116 (GPR116), a novel gene and a pseudogene similar to part
              of meprin A, alpha (PABA peptide hydrolase) (MEP1A),
              complete sequence
          Length = 167646

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 60     aacacaaaaaggaaaccaca 79
              ||||||||||||||||||||
Sbjct: 166770 aacacaaaaaggaaaccaca 166751
to top
>emb|CR848007.6| Human DNA sequence from clone RP11-115C9 on chromosome 9 Contains a
              calponin 2 (CNN2) pseudogene, a novel zinc finger
              pseudogene, a pseudogene similar to part of cytochrome
              P450, subfamily IVF, a chromosome 2 open reading frame 14
              (C2orf14) pseudogene, a pseudogene similar to part of
              sorting nexin associated golgi protein 1 (SNAG1), a
              melanoma antigen (LOC51152) pseudogene, four novel
              pseudogenes and an ankyrin repeat domain 20A (ANKRD20A)
              pseudogene, complete sequence
          Length = 149891

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 60     aacacaaaaaggaaaccaca 79
              ||||||||||||||||||||
Sbjct: 145418 aacacaaaaaggaaaccaca 145437
to top
>emb|AL773545.13| Human DNA sequence from clone RP11-216M21 on chromosome 9 Contains three
              novel pseudogenes, a pseudogene similar to part of meprin
              A, alpha (PABA peptide hydrolase) (MEP1A), a pseudogene
              similar to part of G protein-coupled receptor 116 (GPR116),
              two novel genes, the 5' end of a novel gene similar to
              ankyrin repeat domain 20A (ANKRD20A) and three CpG islands,
              complete sequence
          Length = 165886

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 60     aacacaaaaaggaaaccaca 79
              ||||||||||||||||||||
Sbjct: 130697 aacacaaaaaggaaaccaca 130678
to top
>emb|BX649567.3| Human DNA sequence from clone RP11-195B21 on chromosome 9 Contains a
             novel pseudogene, the gene for a novel protein similar to
             ankyrin repeat domain 20A (ANKRD20A), a novel gene and a
             CpG island, complete sequence
          Length = 99502

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 60    aacacaaaaaggaaaccaca 79
             ||||||||||||||||||||
Sbjct: 14856 aacacaaaaaggaaaccaca 14837
to top
>emb|AL513478.10| Human DNA sequence from clone RP11-327I22 on chromosome 9 Contains a
              pseudogene similar to part of sorting nexin associated
              golgi protein 1 (SNAG1), the ANKRD20A gene for ankyrin
              repeat domain 20A, five novel genes, a pseudogene similar
              to part of eprin A, alpha (PABA peptide hydrolase) (MEP1A)
              and a CpG island, complete sequence
          Length = 180498

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 60     aacacaaaaaggaaaccaca 79
              ||||||||||||||||||||
Sbjct: 123782 aacacaaaaaggaaaccaca 123801
to top
>gb|AC073553.5| Mus musculus strain C57BL/6J chromosome 12 clone RP23-270B12, complete
             sequence
          Length = 187523

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 128   tctctttcttcttcttgctc 147
             ||||||||||||||||||||
Sbjct: 15846 tctctttcttcttcttgctc 15827
to top
>gb|BC021176.2| Homo sapiens zinc finger, CCHC domain containing 13, mRNA (cDNA
           clone MGC:33185 IMAGE:5269882), complete cds
          Length = 856

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 295 gaggaggagctggagggcga 314
           ||||||||||||||||||||
Sbjct: 139 gaggaggagctggagggcga 158
to top
>emb|BX649563.5| Human DNA sequence from clone RP11-213O5 on chromosome 9 Contains a
             pseudogene similar to part of a novel protein
             (DKFZp434A171), a pseudogene similar to part of meprin A,
             alpha (PABA peptide hydrolase) (MEP1A), a pseudogene
             similar to part of a novel transmembrane receptor protein
             and two novel pseudogenes, complete sequence
          Length = 189495

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 60    aacacaaaaaggaaaccaca 79
             ||||||||||||||||||||
Sbjct: 29390 aacacaaaaaggaaaccaca 29409
to top
>gb|AC008661.6| Homo sapiens chromosome 5 clone CTB-28J9, complete sequence
          Length = 188548

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 264   tgtagctggggggaggggtc 283
             ||||||||||||||||||||
Sbjct: 52199 tgtagctggggggaggggtc 52218
to top
>gb|AC090887.3| Mus musculus strain C57BL/6J clone RP23-404D8, complete sequence
          Length = 161153

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 128  tctctttcttcttcttgctc 147
            ||||||||||||||||||||
Sbjct: 3693 tctctttcttcttcttgctc 3712
to top
>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome
          Length = 6260361

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 123    atcgatctctttcttcttct 142
              ||||||||||||||||||||
Sbjct: 734098 atcgatctctttcttcttct 734117
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 128      tctctttcttcttcttgctc 147
                ||||||||||||||||||||
Sbjct: 16371003 tctctttcttcttcttgctc 16370984
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 131      ctttcttcttcttgctcgct 150
                ||||||||||||||||||||
Sbjct: 19339264 ctttcttcttcttgctcgct 19339283
to top
>dbj|AP006878.1| Thermococcus kodakarensis KOD1 DNA, complete genome
          Length = 2088737

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 296    aggaggagctggagggcgag 315
              ||||||||||||||||||||
Sbjct: 294574 aggaggagctggagggcgag 294593
to top
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 297     ggaggagctggagggcgagg 316
               ||||||||||||||||||||
Sbjct: 4913509 ggaggagctggagggcgagg 4913490
to top
>emb|BX276117.5| Zebrafish DNA sequence from clone CH211-112K18 in linkage group 17,
              complete sequence
          Length = 181677

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 50     aatataaccaaacacaaaaa 69
              ||||||||||||||||||||
Sbjct: 170122 aatataaccaaacacaaaaa 170103
to top
>dbj|AP005419.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0046G12
          Length = 189391

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 128   tctctttcttcttcttgctc 147
             ||||||||||||||||||||
Sbjct: 59550 tctctttcttcttcttgctc 59531
to top
>emb|AL355000.11| Human DNA sequence from clone RP11-78N10 on chromosome 22, complete
              sequence
          Length = 219376

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 60     aacacaaaaaggaaaccaca 79
              ||||||||||||||||||||
Sbjct: 137216 aacacaaaaaggaaaccaca 137197
to top
>dbj|AP004879.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0475F05
          Length = 147522

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 131   ctttcttcttcttgctcgct 150
             ||||||||||||||||||||
Sbjct: 24755 ctttcttcttcttgctcgct 24774
to top
>dbj|AP004777.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0458B05
          Length = 144917

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 131    ctttcttcttcttgctcgct 150
              ||||||||||||||||||||
Sbjct: 107062 ctttcttcttcttgctcgct 107081
to top
>gb|AE001439.1| Helicobacter pylori J99, complete genome
          Length = 1643831

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 128    tctctttcttcttcttgctc 147
              ||||||||||||||||||||
Sbjct: 987088 tctctttcttcttcttgctc 987107
to top
>emb|AL132990.4|CNS01DTY Human chromosome 14 DNA sequence BAC R-262P9 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 181004

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 259    gcaggtgtagctggggggag 278
              ||||||||||||||||||||
Sbjct: 110639 gcaggtgtagctggggggag 110658
to top
>gb|AC004386.1|AC004386 Homo Sapiens Chromosome X clone bWXD691, complete sequence
          Length = 172657

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 295   gaggaggagctggagggcga 314
             ||||||||||||||||||||
Sbjct: 90928 gaggaggagctggagggcga 90947
to top
>gb|AC002418.1|AC002418 Human Chromosome X, complete sequence
          Length = 128915

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 295   gaggaggagctggagggcga 314
             ||||||||||||||||||||
Sbjct: 79731 gaggaggagctggagggcga 79712
to top
>emb|AJ851868.2| Mus musculus immunoglobulin heavy chain locus constant region and partial
               variable region, strain 129/Sv
          Length = 1382053

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 128     tctctttcttcttcttgctc 147
               ||||||||||||||||||||
Sbjct: 1074405 tctctttcttcttcttgctc 1074386
to top
>ref|NM_203303.1| Homo sapiens zinc finger, CCHC domain containing 13 (ZCCHC13), mRNA
          Length = 856

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 295 gaggaggagctggagggcga 314
           ||||||||||||||||||||
Sbjct: 139 gaggaggagctggagggcga 158
to top
>emb|AL662925.12| Mouse DNA sequence from clone RP23-226M12 on chromosome X, complete
              sequence
          Length = 199774

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 263    gtgtagctggggggaggggtcttg 286
              |||||||||||||| |||||||||
Sbjct: 170725 gtgtagctgggggggggggtcttg 170702


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,132,912
Number of Sequences: 3902068
Number of extensions: 4132912
Number of successful extensions: 95268
Number of sequences better than 10.0: 44
Number of HSP's better than 10.0 without gapping: 44
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 95022
Number of HSP's gapped (non-prelim): 246
length of query: 333
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 311
effective length of database: 17,147,199,772
effective search space: 5332779129092
effective search space used: 5332779129092
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top