>gb|AF243905.1| Tylosurus punctulatus cytochrome b (cytb) gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 541

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 84  accttttattattgcagccg 103
           ||||||||||||||||||||
Sbjct: 432 accttttattattgcagccg 451

>gb|AF243904.1| Tylosurus gavialoides isolate N33b cytochrome b (cytb) gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 541

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 84  accttttattattgcagccg 103
           ||||||||||||||||||||
Sbjct: 432 accttttattattgcagccg 451

>gb|AF243903.1| Tylosurus gavialoides isolate N33a cytochrome b (cytb) gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 541

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 84  accttttattattgcagccg 103
           ||||||||||||||||||||
Sbjct: 432 accttttattattgcagccg 451

>dbj|AB021237.1| Eleotris melanosoma mitochondrial cyt-b gene for cytochrome b,
           complete cds
          Length = 1272

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 85  ccttttattattgcagccgt 104
           ||||||||||||||||||||
Sbjct: 584 ccttttattattgcagccgt 603

>gb|AY722198.1| Leptophilypnus fluviatilis isolate B cytochrome b (cytb) gene,
           partial cds; mitochondrial
          Length = 1108

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 85  ccttttattattgcagccgt 104
           ||||||||||||||||||||
Sbjct: 523 ccttttattattgcagccgt 542

>gb|AY722197.1| Leptophilypnus fluviatilis isolate C cytochrome b (cytb) gene,
           partial cds; mitochondrial
          Length = 1108

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 85  ccttttattattgcagccgt 104
           ||||||||||||||||||||
Sbjct: 523 ccttttattattgcagccgt 542


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,123,943
Number of Sequences: 3902068
Number of extensions: 2123943
Number of successful extensions: 41357
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41351
Number of HSP's gapped (non-prelim): 6
length of query: 252
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 230
effective length of database: 17,147,199,772
effective search space: 3943855947560
effective search space used: 3943855947560
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)