ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast36d06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_648008.1| Entamoeba histolytica HM-1:IMSS hypothetical pr... 46 0.017
2emb|AL589846.5| Human DNA sequence from clone RP11-199O16 on chr... 40 1.1
3gb|AC000107.2|AC000107 Genomic sequence for Arabidopsis thaliana... 40 1.1
4gb|CP000300.1| Methanococcoides burtonii DSM 6242, complete genome 38 4.3
5emb|Z99109.2|BSUB0006 Bacillus subtilis complete genome (section... 38 4.3
6emb|CR759811.8| Zebrafish DNA sequence from clone CH211-190M18 i... 38 4.3
7emb|CR628392.7| Zebrafish DNA sequence from clone CH211-209N13 i... 38 4.3
8emb|BX629343.11| Zebrafish DNA sequence from clone DKEY-66M17 in... 38 4.3
9gb|AC125469.3| Homo sapiens BAC clone RP11-761E16 from 4, comple... 38 4.3
10gb|AC113424.2| Homo sapiens chromosome 5 clone RP11-624C4, compl... 38 4.3
11gb|AC079789.7| Homo sapiens BAC clone RP11-475B2 from 4, complet... 38 4.3
12gb|AF004781.1| Xeroderris stuhlmannii phytochrome A1 (PHYA1) gen... 38 4.3
13gb|AC000070.2| Homo sapiens Chromosome 22q11.2 Cosmid Clone 105a... 38 4.3
14gb|AC114734.4| Homo sapiens BAC clone CTD-2018D8 from 4, complet... 38 4.3
15dbj|AB015472.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 38 4.3
16emb|AL512308.19| Human DNA sequence from clone RP11-164H16 on ch... 38 4.3
17gb|U83271.1|DEU83271 Derris elliptica phytochrome A-like (PHYA-l... 38 4.3
18gb|U83267.1|PPU83267 Pongamia pinnata phytochrome A-like (PHYA-l... 38 4.3
19gb|AF004803.1|AF004803 Pongamiopsis amygdalina phytochrome A2 (P... 38 4.3
20gb|AF004801.1|AF004801 Pongamiopsis amygdalina phytochrome A1 (P... 38 4.3
21gb|AF004800.1|AF004800 Lonchocarpus phaseolifolius phytochrome A... 38 4.3
22gb|AF004799.1|AF004799 Lonchocarpus eriocarinalis phytochrome A1... 38 4.3
23gb|AF004788.1|AF004788 Millettia richardiana phytochrome A1 (PHY... 38 4.3
24gb|AF004784.1|AF004784 Millettia dura phytochrome A1 (PHYA1) gen... 38 4.3
25gb|AF004778.1|AF004778 Chadsia versicolor phytochrome A1 (PHYA1)... 38 4.3
26dbj|D86376.1| Bacillus subtilis ArgF and med genes, partial and ... 38 4.3

>ref|XM_648008.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (94.t00028)
            partial mRNA
          Length = 1644

 Score = 46.1 bits (23), Expect = 0.017
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 58   caatatatggatcaatcattatttatg 84
            ||||||||| |||||||||||||||||
Sbjct: 1264 caatatatgaatcaatcattatttatg 1290



to top

>emb|AL589846.5| Human DNA sequence from clone RP11-199O16 on chromosome 9, complete
             sequence
          Length = 44495

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    ttttcacatggcaatatatg 66
             ||||||||||||||||||||
Sbjct: 17566 ttttcacatggcaatatatg 17547



to top

>gb|AC000107.2|AC000107 Genomic sequence for Arabidopsis thaliana BAC F17F8 from chromosome I,
             complete sequence
          Length = 102393

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 61    tatatggatcaatcattatttatg 84
             ||||||||| ||||||||||||||
Sbjct: 27805 tatatggatgaatcattatttatg 27828



to top

>gb|CP000300.1| Methanococcoides burtonii DSM 6242, complete genome
          Length = 2575032

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 37     ttccatttgattttcacat 55
              |||||||||||||||||||
Sbjct: 133070 ttccatttgattttcacat 133088



to top

>emb|Z99109.2|BSUB0006 Bacillus subtilis complete genome (section 6 of 21): from 1011039 to
              1209781
          Length = 198743

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 47     ttttcacatggcaatatat 65
              |||||||||||||||||||
Sbjct: 196403 ttttcacatggcaatatat 196385



to top

>emb|CR759811.8| Zebrafish DNA sequence from clone CH211-190M18 in linkage group 13,
             complete sequence
          Length = 132853

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 50    tcacatggcaatatatgga 68
             |||||||||||||||||||
Sbjct: 82220 tcacatggcaatatatgga 82202



to top

>emb|CR628392.7| Zebrafish DNA sequence from clone CH211-209N13 in linkage group 5,
             complete sequence
          Length = 147269

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 32    aaaggttccatttgatttt 50
             |||||||||||||||||||
Sbjct: 94902 aaaggttccatttgatttt 94884



to top

>emb|BX629343.11| Zebrafish DNA sequence from clone DKEY-66M17 in linkage group 13,
              complete sequence
          Length = 207677

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 50     tcacatggcaatatatgga 68
              |||||||||||||||||||
Sbjct: 133388 tcacatggcaatatatgga 133370



to top

>gb|AC125469.3| Homo sapiens BAC clone RP11-761E16 from 4, complete sequence
          Length = 14706

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 47   ttttcacatggcaatatat 65
            |||||||||||||||||||
Sbjct: 1375 ttttcacatggcaatatat 1357



to top

>gb|AC113424.2| Homo sapiens chromosome 5 clone RP11-624C4, complete sequence
          Length = 194717

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 50     tcacatggcaatatatgga 68
              |||||||||||||||||||
Sbjct: 119751 tcacatggcaatatatgga 119733



to top

>gb|AC079789.7| Homo sapiens BAC clone RP11-475B2 from 4, complete sequence
          Length = 198586

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 31     aaaaggttccatttgattt 49
              |||||||||||||||||||
Sbjct: 115094 aaaaggttccatttgattt 115076



to top

>gb|AF004781.1| Xeroderris stuhlmannii phytochrome A1 (PHYA1) gene, partial cds
          Length = 600

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 31  aaaaggttccatttgattt 49
           |||||||||||||||||||
Sbjct: 179 aaaaggttccatttgattt 197



to top

>gb|AC000070.2| Homo sapiens Chromosome 22q11.2 Cosmid Clone 105a In DGCR Region,
             complete sequence
          Length = 38699

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 61    tatatggatcaatcattatttat 83
             ||||||||| |||||||||||||
Sbjct: 28256 tatatggatgaatcattatttat 28278



to top

>gb|AC114734.4| Homo sapiens BAC clone CTD-2018D8 from 4, complete sequence
          Length = 78693

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 47    ttttcacatggcaatatat 65
             |||||||||||||||||||
Sbjct: 78068 ttttcacatggcaatatat 78050



to top

>dbj|AB015472.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAE1
          Length = 54632

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 32   aaaggttccatttgatttt 50
            |||||||||||||||||||
Sbjct: 8367 aaaggttccatttgatttt 8349



to top

>emb|AL512308.19| Human DNA sequence from clone RP11-164H16 on chromosome 6, complete
            sequence
          Length = 107455

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 37   ttccatttgattttcacat 55
            |||||||||||||||||||
Sbjct: 3949 ttccatttgattttcacat 3931



to top

>gb|U83271.1|DEU83271 Derris elliptica phytochrome A-like (PHYA-like) gene, exon 1,
           partial cds
          Length = 435

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 31  aaaaggttccatttgattt 49
           |||||||||||||||||||
Sbjct: 176 aaaaggttccatttgattt 194



to top

>gb|U83267.1|PPU83267 Pongamia pinnata phytochrome A-like (PHYA-like) gene, exon 1,
          partial cds
          Length = 474

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 31 aaaaggttccatttgattt 49
          |||||||||||||||||||
Sbjct: 56 aaaaggttccatttgattt 74



to top

>gb|AF004803.1|AF004803 Pongamiopsis amygdalina phytochrome A2 (PHYA2) gene, partial cds
          Length = 453

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 31  aaaaggttccatttgattt 49
           |||||||||||||||||||
Sbjct: 200 aaaaggttccatttgattt 218



to top

>gb|AF004801.1|AF004801 Pongamiopsis amygdalina phytochrome A1 (PHYA1) gene, partial cds
          Length = 621

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 31  aaaaggttccatttgattt 49
           |||||||||||||||||||
Sbjct: 200 aaaaggttccatttgattt 218



to top

>gb|AF004800.1|AF004800 Lonchocarpus phaseolifolius phytochrome A1 (PHYA1) gene, partial
           cds
          Length = 620

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 31  aaaaggttccatttgattt 49
           |||||||||||||||||||
Sbjct: 200 aaaaggttccatttgattt 218



to top

>gb|AF004799.1|AF004799 Lonchocarpus eriocarinalis phytochrome A1 (PHYA1) gene, partial cds
          Length = 306

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 31  aaaaggttccatttgattt 49
           |||||||||||||||||||
Sbjct: 86  aaaaggttccatttgattt 104



to top

>gb|AF004788.1|AF004788 Millettia richardiana phytochrome A1 (PHYA1) gene, partial cds
          Length = 605

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 31  aaaaggttccatttgattt 49
           |||||||||||||||||||
Sbjct: 184 aaaaggttccatttgattt 202



to top

>gb|AF004784.1|AF004784 Millettia dura phytochrome A1 (PHYA1) gene, partial cds
          Length = 297

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 31 aaaaggttccatttgattt 49
          |||||||||||||||||||
Sbjct: 77 aaaaggttccatttgattt 95



to top

>gb|AF004778.1|AF004778 Chadsia versicolor phytochrome A1 (PHYA1) gene, partial cds
          Length = 474

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 31 aaaaggttccatttgattt 49
          |||||||||||||||||||
Sbjct: 53 aaaaggttccatttgattt 71



to top

>dbj|D86376.1| Bacillus subtilis ArgF and med genes, partial and complete cds
          Length = 4608

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 47   ttttcacatggcaatatat 65
            |||||||||||||||||||
Sbjct: 4429 ttttcacatggcaatatat 4411


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 913,431
Number of Sequences: 3902068
Number of extensions: 913431
Number of successful extensions: 60607
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 60560
Number of HSP's gapped (non-prelim): 47
length of query: 97
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 76
effective length of database: 17,151,101,840
effective search space: 1303483739840
effective search space used: 1303483739840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top