ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast36b03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X00937.1|TAHI02 Wheat histone H3 gene 276 5e-71
2dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 246 4e-62
3dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic D... 246 4e-62
4dbj|AK108078.1| Oryza sativa (japonica cultivar-group) cDNA clon... 246 4e-62
5gb|M36658.1|MZEH3A Corn histone H3 (H3C3) gene, complete cds 246 4e-62
6ref|XM_475315.1| Oryza sativa (japonica cultivar-group), predic... 242 6e-61
7ref|NM_190750.1| Oryza sativa (japonica cultivar-group), predic... 242 6e-61
8gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome... 242 6e-61
9dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 242 6e-61
10dbj|AK120955.1| Oryza sativa (japonica cultivar-group) cDNA clon... 242 6e-61
11gb|BT018179.1| Zea mays clone EL01N0557G06.c mRNA sequence 230 2e-57
12gb|M35388.1|MZEHISH3A Zea mays histone H3 gene, complete cds 224 2e-55
13gb|M13378.1|MZEH3C2 Maize (Zea mays) histone H3 gene (H3C2), com... 224 2e-55
14gb|BT018930.1| Zea mays clone Contig60.F mRNA sequence 222 6e-55
15emb|X84377.1|ZMHIS3DNA Z.mays histone H3 gene 222 6e-55
16ref|NM_185613.1| Oryza sativa (japonica cultivar-group), predic... 218 9e-54
17ref|NM_185609.1| Oryza sativa (japonica cultivar-group), predic... 218 9e-54
18gb|BT017805.1| Zea mays clone EL01N0506E02.c mRNA sequence 218 9e-54
19dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 218 9e-54
20dbj|AP005828.2| Oryza sativa (japonica cultivar-group) genomic D... 218 9e-54
21dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic D... 218 9e-54
22emb|X13679.1|OSHIS3PS Oryza sativa H3 histone pseudogene H3R-12 218 9e-54
23gb|M13379.1|MZEH3C4 Maize (Zea mays) histone H3 gene (H3C4), com... 214 1e-52
24ref|NM_185607.1| Oryza sativa (japonica cultivar-group), predic... 210 2e-51
25ref|XM_472456.1| Oryza sativa (japonica cultivar-group), predic... 210 2e-51
26emb|X13678.1|OSHIS311 Oryza sativa H3 histone gene H3R-11 210 2e-51
27dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 210 2e-51
28emb|AL606618.4|OSJN00062 Oryza sativa genomic DNA, chromosome 4,... 210 2e-51
29ref|NM_185612.1| Oryza sativa (japonica cultivar-group), predic... 202 6e-49
30gb|AC134048.3| Oryza sativa (japonica cultivar-group) chromosome... 202 6e-49
31gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome... 202 6e-49
32emb|X13680.1|OSHIS321 Oryza sativa H3 histone H3R-21 clone RH3-2 202 6e-49
33dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 202 6e-49
34gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 202 6e-49
35gb|U77296.1|OSU77296 Oryza sativa histone 3 mRNA, complete cds 202 6e-49
36gb|M34928.1|BLYHISH3PA Barley histone H3 mRNA, 3' end 194 1e-46
37ref|XM_493701.1| Oryza sativa (japonica cultivar-group), mRNA 186 3e-44
38dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic D... 186 3e-44
39gb|AF093633.1|AF093633 Oryza sativa histone H3 mRNA, complete cds 186 3e-44
40gb|U25664.1|OSU25664 Oryza sativa histone H3 gene, complete cds 186 3e-44
41gb|M15664.1|RICHIS3 Rice histone 3 gene, complete cds 186 3e-44
42gb|AF140033.1|AF140033 Phreatamoeba balamuthi histone H3 mRNA, c... 176 3e-41
43ref|NM_178203.1| Mus musculus histone 1, H3b (Hist1h3b), mRNA 170 2e-39
44ref|NM_175653.1| Mus musculus histone1, H3c (Hist1h3c), mRNA 170 2e-39
45ref|NM_178206.2| Mus musculus histone 1, H3h (Hist1h3h), mRNA 170 2e-39
46emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143 170 2e-39
47emb|X80326.1|MPMPH312 M.pahari mpH312 gene 170 2e-39
48emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr... 170 2e-39
49emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr... 170 2e-39
50gb|AY158951.1| Mus musculus histone protein Hist1h3b gene, compl... 170 2e-39
51gb|AY158950.1| Mus musculus histone protein Hist1h3c gene, compl... 170 2e-39
52gb|AY158944.1| Mus musculus histone protein Hist1h3h gene, compl... 170 2e-39
53gb|M32462.1|MUSHIS3D Mouse histone H3 (H3.1-291) gene, complete cds 170 2e-39
54emb|X79714.1|LTMRHIS3 L.temulentum mRNA for histone H3 167 3e-38
55gb|BT018950.1| Zea mays clone Contig110.F mRNA sequence 165 1e-37
56gb|BT017332.1| Zea mays clone EL01N0320H03.c mRNA sequence 163 5e-37
57gb|BT016934.1| Zea mays clone E04912703G10.c mRNA sequence 163 5e-37
58ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro... 163 5e-37
59ref|NM_145073.2| Mus musculus histone 1, H3g (Hist1h3g), mRNA 163 5e-37
60gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co... 163 5e-37
61emb|CR716243.2|CNS0GFLO Tetraodon nigroviridis full-length cDNA 163 5e-37
62emb|X80325.1|MPMPH315 M.pahari mpH315 gene 163 5e-37
63emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4... 163 5e-37
64emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr... 163 5e-37
65dbj|AB205017.1| Lolium multiflorum gene for replacement histone ... 163 5e-37
66ref|XM_694120.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 163 5e-37
67gb|AY158946.1| Mus musculus histone protein Hist1h3g gene, compl... 163 5e-37
68emb|X01684.1|MMHISH31 Mouse gene (H3.1) for histone H3 163 5e-37
69gb|M33989.1|MUSH2AX1X Mouse histone H3.2 gene, complete cds 163 5e-37
70gb|M32460.1|MUSHIS3B Mouse histone H3 (H3.1-221) gene, complete cds 163 5e-37
71emb|Z30939.1|MDH3HIST Mus domesticus partial mRNA for histone H3... 161 2e-36
72dbj|AB185026.1| Conocephalum conicum H3 gene for histone 3, comp... 161 2e-36
73dbj|AB185023.1| Conocephalum conicum H3 gene for histone 3, comp... 161 2e-36
74ref|XM_545420.2| PREDICTED: Canis familiaris similar to histone ... 159 7e-36
75ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone ... 157 3e-35
76ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone ... 157 3e-35
77gb|U38422.1|TAU38422 Triticum aestivum histone H3 gene, partial ... 157 3e-35
78gb|BC107285.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMA... 155 1e-34
79ref|NM_178205.1| Mus musculus histone 1, H3e (Hist1h3e), mRNA 155 1e-34
80ref|NM_178204.1| Mus musculus histone1, H3d (Hist1h3d), mRNA 155 1e-34
81gb|L19706.1| Rattus norvegicus H3 histone gene, complete cds 155 1e-34
82ref|XM_425464.1| PREDICTED: Gallus gallus similar to histone pro... 155 1e-34
83ref|XM_416198.1| PREDICTED: Gallus gallus similar to GLP_39_8822... 155 1e-34
84ref|XM_416190.1| PREDICTED: Gallus gallus similar to GLP_39_8822... 155 1e-34
85ref|XM_416186.1| PREDICTED: Gallus gallus similar to GLP_39_8822... 155 1e-34
86ref|XM_849194.1| PREDICTED: Canis familiaris similar to histone ... 155 1e-34
87ref|XM_545399.1| PREDICTED: Canis familiaris similar to histone ... 155 1e-34
88ref|XM_545397.2| PREDICTED: Canis familiaris similar to histone ... 155 1e-34
89ref|XM_848782.1| PREDICTED: Canis familiaris similar to histone ... 155 1e-34
90ref|XM_545429.1| PREDICTED: Canis familiaris similar to histone ... 155 1e-34
91ref|XM_545385.1| PREDICTED: Canis familiaris similar to histone ... 155 1e-34
92emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, his... 155 1e-34
93emb|X80324.1|MPMPH3110 M.pahari mpH3110 gene 155 1e-34
94emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes 155 1e-34
95gb|DQ393956.1| Cydia pomonella clone Cp4.140 microsatellite sequ... 155 1e-34
96gb|DQ393939.1| Cydia pomonella clone Cp4.P microsatellite sequence 155 1e-34
97gb|DQ393935.1| Cydia pomonella clone Cp4.118 microsatellite sequ... 155 1e-34
98gb|DQ393934.1| Cydia pomonella clone Cp4.100 microsatellite sequ... 155 1e-34
99gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016 155 1e-34
100gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108 155 1e-34
101dbj|AK006742.1| Mus musculus adult male testis cDNA, RIKEN full-... 155 1e-34
102emb|CR390239.1| Gallus gallus finished cDNA, clone ChEST932d15 155 1e-34
103gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and hist... 155 1e-34
104gb|U62671.1|MMU62671 Mus musculus histone H3.2-B (H3-B) gene, co... 155 1e-34
105gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone... 155 1e-34
106gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, comple... 155 1e-34
107ref|NM_001013056.1| Rattus norvegicus histone 1, H2ai (predicted... 155 1e-34
108gb|AY158952.1| Mus musculus histone protein Hist1h3a gene, compl... 155 1e-34
109gb|AY158949.1| Mus musculus histone protein Hist1h3d gene, compl... 155 1e-34
110gb|AY158948.1| Mus musculus histone protein Hist1h3e gene, compl... 155 1e-34
111emb|X62291.1|GGHISH3IV G.gallus gene for histone H3-IV 155 1e-34
112gb|U37579.1|GGU37579 Gallus gallus histone H3-VIII gene, complet... 155 1e-34
113gb|U37577.1|GGU37577 Gallus gallus histone H3-VI gene, complete cds 155 1e-34
114gb|M61154.1|CHKH3AA Chicken histone H3 gene, complete cds 155 1e-34
115gb|AY181030.1| Toxoplasma gondii histone H3 mRNA, complete cds 153 5e-34
116gb|BC097059.1| Danio rerio zgc:113983, mRNA (cDNA clone MGC:1139... 151 2e-33
117ref|NM_001025171.1| Danio rerio zgc:113983 (zgc:113983), mRNA 151 2e-33
118gb|BC033095.1| Homo sapiens histone 1, H3d, mRNA (cDNA clone MGC... 149 7e-33
119gb|BC031333.1| Homo sapiens histone 1, H3d, mRNA (cDNA clone MGC... 149 7e-33
120ref|NG_001335.1| Homo sapiens genomic large histone family clust... 149 7e-33
121ref|NM_003530.3| Homo sapiens histone 1, H3d (HIST1H3D), mRNA 149 7e-33
122ref|XM_848810.1| PREDICTED: Canis familiaris similar to histone ... 149 7e-33
123gb|AF531277.1| Homo sapiens histone H3 (HIST1H3D) gene, complete... 149 7e-33
124emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 o... 149 7e-33
125dbj|AK097020.1| Homo sapiens cDNA FLJ39701 fis, clone SMINT2011656 149 7e-33
126emb|X16496.1|MMHIST31 Murine H3.1 gene for histone H3.1 149 7e-33
127ref|NM_013548.2| Mus musculus histone 1, H3f (Hist1h3f), mRNA 147 3e-32
128ref|NM_013550.3| Mus musculus histone 1, H3a (Hist1h3a), mRNA 147 3e-32
129gb|BC107287.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMA... 147 3e-32
130gb|BC084311.1| Xenopus laevis cDNA clone IMAGE:6865011 147 3e-32
131ref|XM_599846.2| PREDICTED: Bos taurus similar to histone 1, H2a... 147 3e-32
132ref|XM_601510.2| PREDICTED: Bos taurus similar to histone 1, H2a... 147 3e-32
133ref|XM_545428.1| PREDICTED: Canis familiaris similar to histone ... 147 3e-32
134gb|BC103549.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC... 147 3e-32
135gb|AY125229.1| Argia vivida histone 3 gene, partial cds 147 3e-32
136emb|AJ556872.1|XLA556872 Expression vector pET3-H3 H3 gene for X... 147 3e-32
137gb|DQ393931.1| Cydia pomonella clone Cp4.61 microsatellite sequence 147 3e-32
138dbj|AK155722.1| Mus musculus B6-derived CD11 +ve dendritic cells... 147 3e-32
139ref|XM_694088.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 147 3e-32
140dbj|AK010121.1| Mus musculus adult male tongue cDNA, RIKEN full-... 147 3e-32
141gb|U62670.1|MMU62670 Mus musculus histone H3.1-I (H3-I) gene, co... 147 3e-32
142dbj|AK018952.1| Mus musculus adult male testis cDNA, RIKEN full-... 147 3e-32
143ref|XM_344595.2| PREDICTED: Rattus norvegicus histone 1, H4a (pr... 147 3e-32
144gb|AY158947.1| Mus musculus histone protein Hist1h3f gene, compl... 147 3e-32
145gb|AY158945.1| Mus musculus histone protein Hist1h3i gene, compl... 147 3e-32
146emb|X62292.1|GGHISH3V G.gallus gene for histone H3-V 147 3e-32
147emb|CR760429.2| Xenopus tropicalis finished cDNA, clone TNeu057j11 147 3e-32
148gb|U37578.1|GGU37578 Gallus gallus histone H3-VII gene, complete... 147 3e-32
149ref|NM_178207.2| Mus musculus histone 1, H3i (Hist1h3i), mRNA 147 3e-32
150gb|BC101955.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC... 147 3e-32
151gb|BC101956.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC... 147 3e-32
152gb|BC101954.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC... 147 3e-32
153gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I... 147 3e-32
154emb|X01685.1|MMHISH32 Mouse gene (H3.2) for histone H3 147 3e-32
155gb|M61155.1|CHKH3AB Chicken histone H3 gene, complete cds 147 3e-32
156gb|M32459.1|MUSHIS3A Mouse histone H3 (H3.2-221) gene, complete cds 147 3e-32
157ref|XM_694149.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 145 1e-31
158ref|XM_693458.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 145 1e-31
159gb|BC069303.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 141 2e-30
160gb|BC067490.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 141 2e-30
161gb|BC067491.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 141 2e-30
162ref|NM_003529.2| Homo sapiens histone 1, H3a (HIST1H3A), mRNA 141 2e-30
163gb|AF531274.1| Homo sapiens histone H3 (HIST1H3A) gene, complete... 141 2e-30
164emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for hist... 141 2e-30
165ref|XM_684297.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 141 2e-30
166gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, h... 141 2e-30
167emb|Z61129.1|HS45E8R H.sapiens CpG island DNA genomic Mse1 fragm... 141 2e-30
168gb|BC066246.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 141 2e-30
169gb|BC066245.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 141 2e-30
170gb|BC066247.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 141 2e-30
171emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 ... 141 2e-30
172gb|U38420.1|HVU38420 Hordeum vulgare histone H3 gene, partial cd... 141 2e-30
173gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I... 141 2e-30
174ref|XM_527604.1| PREDICTED: Pan troglodytes similar to histone 1... 139 7e-30
175gb|BC067492.1| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC... 139 7e-30
176ref|XM_871261.1| PREDICTED: Bos taurus similar to histone 1, H2a... 139 7e-30
177ref|XM_870218.1| PREDICTED: Bos taurus similar to histone 1, H2a... 139 7e-30
178ref|XM_591827.2| PREDICTED: Bos taurus similar to histone 1, H2a... 139 7e-30
179ref|XM_540290.1| PREDICTED: Canis familiaris similar to H3 histo... 139 7e-30
180ref|XM_540285.1| PREDICTED: Canis familiaris similar to H3 histo... 139 7e-30
181ref|XM_845651.1| PREDICTED: Canis familiaris similar to CG31613-... 139 7e-30
182gb|AF531279.1| Homo sapiens histone H3 (HIST1H3F) gene, complete... 139 7e-30
183gb|AF520775.1| Hypocrea jecorina histone H3 gene, complete cds 139 7e-30
184gb|AY125231.1| Melanoplus sp. OR18 histone 3 gene, partial cds 139 7e-30
185emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A... 139 7e-30
186gb|BC096131.1| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC... 139 7e-30
187gb|AF348235.1| Calonectria kyotensis strain CBS413.67 histone 3-... 139 7e-30
188gb|AF348234.1| Calonectria kyotensis strain ATCC 18882 histone 3... 139 7e-30
189gb|AF348231.1| Calonectria kyotensis strain ATCC 18443 histone 3... 139 7e-30
190gb|AF348227.1| Calonectria kyotensis strain STE-U500 histone 3-l... 139 7e-30
191ref|NM_021018.2| Homo sapiens histone 1, H3f (HIST1H3F), mRNA 139 7e-30
192emb|CR542011.1| Homo sapiens full open reading frame cDNA clone ... 139 7e-30
193emb|CR541983.1| Homo sapiens full open reading frame cDNA clone ... 139 7e-30
194dbj|AK020421.1| Mus musculus 12 days embryo embryonic body betwe... 139 7e-30
195gb|BC069818.1| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC... 139 7e-30
196gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I... 139 7e-30
197gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene... 139 7e-30
198gb|J00984.1|XELHIS3LB x.laevis histone gene h3 and flanks 139 7e-30
199emb|Z80786.1|HSH3I H.sapiens H3/i gene 139 7e-30
200ref|NM_178216.1| Mus musculus histone 2, H3c1 (Hist2h3c1), trans... 137 3e-29
201gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339 137 3e-29
202ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h... 137 3e-29
203emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23 137 3e-29
204emb|X95625.1|NPHISTOH3 N.pseudonarcissus mRNA for histone H3 137 3e-29
205gb|DQ096858.1| Xenopus laevis h3r mRNA, complete sequence 137 3e-29
206dbj|AK134918.1| Mus musculus adult male olfactory brain cDNA, RI... 137 3e-29
207ref|XM_686806.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 137 3e-29
208ref|XM_688339.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 137 3e-29
209gb|U62675.1|MMU62675 Mus musculus histone H3.2-616 (H3-616), and... 137 3e-29
210gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), ... 137 3e-29
211ref|NG_002616.1| Homo sapiens histone 2, H3b (HIST2H3B) pseudoge... 137 3e-29
212gb|BC094041.1| Mus musculus histone 2, H3c1, mRNA (cDNA clone MG... 137 3e-29
213gb|AF531306.1| Homo sapiens histone H3 (HIST2H3B) pseudogene, co... 137 3e-29
214gb|AY158955.1| Mus musculus histone protein Hist2h3b gene, compl... 137 3e-29
215gb|AY158954.1| Mus musculus histone protein Hist2h3c1 gene, comp... 137 3e-29
216gb|AY158941.1| Mus musculus histone protein Hist2h2bb gene, comp... 137 3e-29
217gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, comp... 137 3e-29
218gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, comple... 137 3e-29
219emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chr... 137 3e-29
220ref|NM_178215.1| Mus musculus histone 2, H3b (Hist2h3b), mRNA 137 3e-29
221gb|M32461.1|MUSHIS3C Mouse histone H3 (H3.2-614) gene, complete cds 137 3e-29
222ref|XM_603864.2| PREDICTED: Bos taurus similar to histone 1, H2a... 135 1e-28
223ref|XM_356549.3| PREDICTED: Mus musculus similar to histone 1, H... 135 1e-28
224ref|XM_687893.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 135 1e-28
225ref|XM_518289.1| PREDICTED: Pan troglodytes similar to Histone H... 133 4e-28
226ref|NM_021059.2| Homo sapiens histone 2, H3c (HIST2H3C), mRNA 133 4e-28
227gb|AY648851.1| Homo sapiens histone H3/o gene, complete cds 133 4e-28
228ref|XM_590015.2| PREDICTED: Bos taurus similar to histone 1, H2a... 133 4e-28
229gb|BC063540.1| Homo sapiens cDNA clone IMAGE:4523373, **** WARNI... 133 4e-28
230gb|BC015544.1| Homo sapiens histone 2, H3c, mRNA (cDNA clone IMA... 133 4e-28
231emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch... 133 4e-28
232emb|X53330.1|PDHISTCL P.dumerilii histone gene cluster for core ... 133 4e-28
233ref|XM_684517.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 133 4e-28
234ref|XM_684015.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 133 4e-28
235ref|XM_683485.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 133 4e-28
236ref|XM_683134.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 133 4e-28
237ref|XM_928391.1| PREDICTED: Homo sapiens similar to CG31613-PA (... 133 4e-28
238emb|CR541858.1| Homo sapiens full open reading frame cDNA clone ... 133 4e-28
239ref|NG_002617.1| Homo sapiens histone 2, H3a (HIST2H3A) pseudoge... 133 4e-28
240ref|NM_001005464.1| Homo sapiens histone H3/o (H3/o), mRNA 133 4e-28
241gb|BC074969.2| Homo sapiens histone H3/o, mRNA (cDNA clone IMAGE... 133 4e-28
242gb|AF531307.1| Homo sapiens histone H3 (HIST2H3C) gene, complete... 133 4e-28
243gb|AF531305.1| Homo sapiens histone H3 (HIST2H3A) pseudogene, co... 133 4e-28
244emb|Z56112.1|HS89C12R H.sapiens CpG island DNA genomic Mse1 frag... 133 4e-28
245emb|Z56111.1|HS89C12F H.sapiens CpG island DNA genomic Mse1 frag... 133 4e-28
246emb|Z63365.1|HS81H7R H.sapiens CpG island DNA genomic Mse1 fragm... 133 4e-28
247gb|U38423.1|TAU38423 Triticum aestivum histone H3 gene, partial ... 133 4e-28
248emb|Y08528.1|OSHISTON3 Oryza sativa mRNA for histone 3 133 4e-28
249gb|M14396.1|CIIHISH3A Duck H3.4 variant histone gene 133 4e-28
250emb|Z46261.1|HSHISH3A H.sapiens DNA for histone H3a 133 4e-28
251gb|AY725673.1| Cylindrocladium multiphialidicum strain CBS 11267... 131 2e-27
252gb|AY725671.1| Cylindrocladium malesianum strain CBS 112710 hist... 131 2e-27
253ref|XM_518299.1| PREDICTED: Pan troglodytes similar to Histone H... 131 2e-27
254gb|BC062305.1| Homo sapiens cDNA clone IMAGE:3162462 131 2e-27
255ref|XM_871486.1| PREDICTED: Bos taurus similar to H3 histone, fa... 131 2e-27
256ref|XM_871460.1| PREDICTED: Bos taurus similar to H3 histone, fa... 131 2e-27
257ref|XM_871299.1| PREDICTED: Bos taurus similar to histone 1, H2a... 131 2e-27
258ref|XM_865002.1| PREDICTED: Bos taurus similar to histone 1, H2a... 131 2e-27
259gb|BC007518.2| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC... 131 2e-27
260ref|XM_866756.1| PREDICTED: Bos taurus similar to H3 histone, fa... 131 2e-27
261ref|XM_866686.1| PREDICTED: Bos taurus similar to H3 histone, fa... 131 2e-27
262ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@... 131 2e-27
263ref|NM_003536.2| Homo sapiens histone 1, H3h (HIST1H3H), mRNA 131 2e-27
264gb|AF531281.1| Homo sapiens histone H3 (HIST1H3H) gene, complete... 131 2e-27
265gb|AY125233.1| Isoperla davisi histone 3 gene, partial cds 131 2e-27
266emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 o... 131 2e-27
267emb|X06964.1|VCHIS34A Volvox carteri H3-II and H4-II genes for h... 131 2e-27
268gb|BC096130.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC... 131 2e-27
269gb|BC096128.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC... 131 2e-27
270gb|BC096129.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC... 131 2e-27
271emb|Z83735.1|HSZ83735 H.sapiens hH3/k gene 131 2e-27
272gb|AF348241.1| Cylindrocladium pseudospathiphylli strain 1623 hi... 131 2e-27
273ref|XM_688063.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 131 2e-27
274dbj|AB185074.1| Conocephalum conicum H3 gene for histone 3, comp... 131 2e-27
275dbj|AB185035.1| Conocephalum supradecompositum H3 gene for histo... 131 2e-27
276gb|AY749744.1| Dipteromimus sp. EP150 histone H3 (H3) gene, part... 131 2e-27
277gb|AY749737.1| Platybaetis probus histone H3 (H3) gene, partial cds 131 2e-27
278gb|AY749705.1| Choroterpes sp. EP024 histone H3 (H3) gene, parti... 131 2e-27
279ref|NM_019469.1| Mus musculus histone 2, H3c1 (Hist2h3c1), trans... 129 7e-27
280ref|XM_527253.1| PREDICTED: Pan troglodytes similar to histone 1... 129 7e-27
281gb|BC015270.1| Mus musculus histone 2, H3c2, mRNA (cDNA clone MG... 129 7e-27
282ref|NM_054045.2| Mus musculus histone 2, H3c2 (Hist2h3c2), mRNA 129 7e-27
283ref|XM_848995.1| PREDICTED: Canis familiaris similar to histone ... 129 7e-27
284gb|BC107980.1| Danio rerio zgc:123334, mRNA (cDNA clone MGC:1233... 129 7e-27
285ref|XM_786159.1| PREDICTED: Strongylocentrotus purpuratus simila... 129 7e-27
286ref|NM_001040004.1| Danio rerio zgc:123334 (zgc:123334), mRNA 129 7e-27
287emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes 129 7e-27
288emb|X72949.1|XLH3HIS X.laevis H3r gene for histone H3 129 7e-27
289ref|XM_694212.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 129 7e-27
290gb|AY923964.1| Phenacolepas osculans isolate PHE1 histone H3 (H3... 129 7e-27
291gb|AY749746.1| Proboscidoplocia sp. EP162 histone H3 (H3) gene, ... 129 7e-27
292gb|AC151366.3| Aotus nancymaae clone CH258-105B22, complete sequ... 127 3e-26
293ref|XM_905850.2| PREDICTED: Mus musculus similar to histone 1, H... 127 3e-26
294gb|AF517884.1| Griffithsia japonica isolate Gj475 histone H3.3 p... 127 3e-26
295gb|AY749714.1| Meridialaris diguillina histone H3 (H3) gene, par... 127 3e-26
296gb|AY725666.1| Cylindrocladium hongkongense strain CBS 114711 hi... 125 1e-25
297gb|BC069079.1| Homo sapiens histone 3, H3, mRNA (cDNA clone MGC:... 125 1e-25
298gb|DQ185432.1| Rosa roxburghii clone a11 defense-related mRNA, p... 125 1e-25
299emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chr... 125 1e-25
300emb|Z49861.1|HS2132H3 H.sapiens gene for histone H3 125 1e-25
301emb|X01064.1|SGHIS2A3 Rainbow trout histone H2A and H3 genes 125 1e-25
302ref|NM_001016636.3| Xenopus tropicalis histone 2, H3c (hist1h3g)... 125 1e-25
303ref|NM_003493.2| Homo sapiens histone 3, H3 (HIST3H3), mRNA 125 1e-25
304gb|AF281810.1| Cryphonectria cubensis isolate CRY_268 histone H3... 125 1e-25
305gb|AF281809.1| Cryphonectria cubensis isolate CRY_500 histone H3... 125 1e-25
306gb|AF281808.1| Cryphonectria cubensis isolate CRY_138 histone H3... 125 1e-25
307gb|AF281807.1| Cryphonectria cubensis isolate CRY_144 histone H3... 125 1e-25
308gb|AF281806.1| Cryphonectria cubensis isolate CRY_98 histone H3 ... 125 1e-25
309gb|AF281805.1| Cryphonectria cubensis isolate CRY_0140 histone H... 125 1e-25
310gb|AF531308.1| Homo sapiens histone H3 (HIST3H3) gene, complete cds 125 1e-25
311gb|AY435465.1| Acremonium strictum strain AS5147 histone H3 gene... 125 1e-25
312gb|AY435464.1| Acremonium strictum strain AS5144 histone H3 gene... 125 1e-25
313emb|CR855729.2| Xenopus tropicalis finished cDNA, clone TGas081o10 125 1e-25
314gb|BC101837.1| Homo sapiens histone 3, H3, mRNA (cDNA clone MGC:... 125 1e-25
315gb|BC101839.1| Homo sapiens histone 3, H3, mRNA (cDNA clone MGC:... 125 1e-25
316gb|J00982.1|XELHIS358 xenopus laevis histone gene h3 on 5.8 kb e... 125 1e-25
317gb|J01175.1|SULHISL34 Sea urchin (L.pictus) late-stage histone H... 125 1e-25
318ref|XM_527254.1| PREDICTED: Pan troglodytes similar to HIST2H3C ... 123 4e-25
319ref|XM_870476.1| PREDICTED: Bos taurus similar to histone 1, H2a... 123 4e-25
320gb|AY669068.1| Chaetomium globosum histone H3 mRNA, complete cds 123 4e-25
321emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 a... 123 4e-25
322emb|X54115.1|SSH4H3 S.stimpsoni histone genes H4 and H3 123 4e-25
323gb|AF348237.1| Cylindrocladium spathiphylli strain STE-U2188 his... 123 4e-25
324gb|AF348230.1| Cylindrocladium spathiphylli strain ATCC 44730 hi... 123 4e-25
325dbj|AB195975.1| Lilium longiflorum YAH3 mRNA for histone H3, com... 123 4e-25
326dbj|AB185072.1| Conocephalum conicum H3 gene for histone 3, comp... 123 4e-25
327dbj|AB185039.1| Conocephalum supradecompositum H3 gene for histo... 123 4e-25
328ref|XM_227461.2| PREDICTED: Rattus norvegicus similar to histone... 123 4e-25
329gb|AY923981.1| Turbo setosus isolate TU5 histone H3 (H3) gene, p... 123 4e-25
330gb|AY923977.1| Gibbula zonata isolate T25 histone H3 (H3) gene, ... 123 4e-25
331gb|AY923975.1| Stomatella sp. CET-2005 histone H3 (H3) gene, par... 123 4e-25
332gb|AY923967.1| Peltospira delicata isolate PS1 histone H3 (H3) g... 123 4e-25
333gb|AY923958.1| Haliotis varia isolate H37 histone H3 (H3) gene, ... 123 4e-25
334gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo... 123 4e-25
335gb|AY749753.1| Diphlebia coerulescens histone H3 (H3) gene, part... 123 4e-25
336gb|AY749743.1| Ichthybotus hudsoni histone H3 (H3) gene, partial... 123 4e-25
337gb|AY749713.1| Penaphlebia sp. EP076 histone H3 (H3) gene, parti... 123 4e-25
338gb|AY749709.1| Mystaxiops venatoris histone H3 (H3) gene, partia... 123 4e-25
339gb|AY749708.1| Baetis tricaudatus histone H3 (H3) gene, partial cds 123 4e-25
340gb|BC054666.1| Danio rerio zgc:66241, mRNA (cDNA clone MGC:66241... 121 2e-24
341ref|XM_782287.1| PREDICTED: Strongylocentrotus purpuratus simila... 121 2e-24
342emb|Z80784.1|HSH3B H.sapiens H3/b gene 121 2e-24
343emb|X82257.1|DMH33A D.melanogaster mRNA for histone H3.3 variant 121 2e-24
344emb|X72950.1|XLH3LHIS X.laevis H3l gene for histone H3 121 2e-24
345gb|AY521732.1| Zorotypus hubbardi voucher BYU_ACZO001 histone H3... 121 2e-24
346gb|AY521731.1| Hydropsyche sp. BYU_ACTR020 histone H3 (H3) gene,... 121 2e-24
347gb|AY521720.1| Ceuthophilus utahensis voucher BYU_ACOR017 histon... 121 2e-24
348ref|NM_199745.1| Danio rerio zgc:66241 (zgc:66241), mRNA 121 2e-24
349gb|AY119629.1| Drosophila melanogaster RE21618 full insert cDNA 121 2e-24
350ref|NM_078755.2| Drosophila melanogaster Histone H3.3A CG5825-RA... 121 2e-24
351ref|XM_686609.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 121 2e-24
352gb|AY071057.1| Drosophila melanogaster RE14004 full length cDNA 121 2e-24
353ref|XM_701573.1| PREDICTED: Danio rerio similar to CG31613-PA, t... 121 2e-24
354dbj|AB185075.1| Conocephalum conicum H3 gene for histone 3, comp... 121 2e-24
355gb|AY338631.1| Anthopotamus sp. EP022 histone 3 gene, partial cds 121 2e-24
356gb|AY338619.1| Baetis sp. Eph11 histone 3 gene, partial cds 121 2e-24
357ref|XM_322230.1| Neurospora crassa OR74A hypothetical protein (N... 119 6e-24
358ref|XM_951565.1| Neurospora crassa OR74A hypothetical protein (N... 119 6e-24
359dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 119 6e-24
360gb|AY923956.1| Haliotis kamtschatkana isolate H22 histone H3 (H3... 119 6e-24
361emb|X85102.1|OSRNAHIS3 O.sativa mRNA for histone H3 119 6e-24
362ref|XM_314445.2| Anopheles gambiae str. PEST ENSANGP00000016056 ... 119 6e-24
363gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 119 6e-24
364emb|AL844879.5|CNS08CB2 Oryza sativa chromosome 12, . BAC OSJNBa... 119 6e-24
365gb|AY725667.1| Cylindrocladium hongkongense strain CBS 114828 hi... 117 3e-23
366gb|AY725665.1| Calonectria kyotensis strain CBS 114552 histone H... 117 3e-23
367gb|J01181.1|SUPHISP04 Psammechinus miliaris histone H3 gene, com... 117 3e-23
368ref|XM_868935.1| PREDICTED: Bos taurus similar to histone 1, H2a... 117 3e-23
369ref|XM_868913.1| PREDICTED: Bos taurus similar to histone 1, H2a... 117 3e-23
370ref|XM_580747.2| PREDICTED: Bos taurus similar to CG31613-PA (LO... 117 3e-23
371emb|X58895.1|UCHISTO U.caupo gene for H2A, H2B, H3, and H4 histones 117 3e-23
372ref|XM_780236.1| PREDICTED: Strongylocentrotus purpuratus simila... 117 3e-23
373ref|XM_780065.1| PREDICTED: Strongylocentrotus purpuratus simila... 117 3e-23
374ref|XM_777897.1| PREDICTED: Strongylocentrotus purpuratus simila... 117 3e-23
375ref|XM_781054.1| PREDICTED: Strongylocentrotus purpuratus simila... 117 3e-23
376emb|X03952.1|SPHISH34 Sea urchin (S. purpuratus) late embryonic ... 117 3e-23
377emb|V01143.1|PMHIS7 Sea urchin (P. miliaris) gene for histones H... 117 3e-23
378gb|DQ284405.1| Arthroleptis tanneri histone H3a gene, partial cds 117 3e-23
379gb|DQ284288.1| Gastrophryne olivacea histone H3a gene, partial cds 117 3e-23
380gb|AY829961.1| Xerophrynus machadoi isolate AMCC 124710 histone ... 117 3e-23
381gb|AF281814.1| Cryphonectria cubensis isolate CRY_0127 histone H... 117 3e-23
382gb|AF281813.1| Cryphonectria cubensis isolate CRY_33 histone H3 ... 117 3e-23
383gb|AF281812.1| Cryphonectria cubensis isolate CRY_556 histone H3... 117 3e-23
384gb|AF285165.1| Cryphonectria cubensis histone H3 gene, partial cds 117 3e-23
385emb|CR542013.1| Homo sapiens full open reading frame cDNA clone ... 117 3e-23
386dbj|AB185045.1| Conocephalum supradecompositum H3 gene for histo... 117 3e-23
387dbj|AB185037.1| Conocephalum supradecompositum H3 gene for histo... 117 3e-23
388ref|NM_214547.1| Strongylocentrotus purpuratus late embryonic hi... 117 3e-23
389gb|AY923963.1| Nerita polita isolate NR2 histone H3 (H3) gene, p... 117 3e-23
390gb|AY894086.1| Synthetic construct Homo sapiens clone FLH131254.... 117 3e-23
391ref|XM_524859.1| PREDICTED: Pan troglodytes LOC469476 (LOC469476... 115 1e-22
392emb|CR733515.2|CNS0GSRE Tetraodon nigroviridis full-length cDNA 115 1e-22
393gb|AY125243.1| Anisomorpha ferruginea histone 3 gene, partial cds 115 1e-22
394gb|AY125232.1| Pterophylla camellifolia histone 3 gene, partial cds 115 1e-22
395gb|AY125230.1| Stenopelmatus fuscus histone 3 gene, partial cds 115 1e-22
396gb|AY125218.1| Doru spiculiferum histone 3 gene, partial cds 115 1e-22
397ref|XM_793816.1| PREDICTED: Strongylocentrotus purpuratus simila... 115 1e-22
398emb|X82414.1|AOHISTH3 A.officinalis mRNA for Histone H3 115 1e-22
399emb|X07505.1|DIHIST3 Sea star (D.imbricata) histone H3 gene 115 1e-22
400gb|DQ284244.1| Ambystoma mexicanum histone H3a gene, partial cds 115 1e-22
401gb|AF348242.1| Cylindrocladium spathiphylli strain P87-0167 hist... 115 1e-22
402ref|XM_497711.2| PREDICTED: Homo sapiens similar to H3 histone, ... 115 1e-22
403dbj|AB185058.1| Marchantia polymorpha H3 gene for histone 3, com... 115 1e-22
404gb|AF404631.1| Lewia infectoria isolate CR31 histone gene, parti... 115 1e-22
405ref|XM_227460.3| PREDICTED: Rattus norvegicus histone 2, H3c2 (p... 115 1e-22
406gb|AY923982.1| Homalopoma maculosa isolate TU6 histone H3 (H3) g... 115 1e-22
407gb|AY923980.1| Astraea undosa isolate T6 histone H3 (H3) gene, p... 115 1e-22
408gb|AY923968.1| Rhynchopelta sp. CET-2005 histone H3 (H3) gene, p... 115 1e-22
409gb|AY923952.1| Haliotis jacnensis isolate H1 histone H3 (H3) gen... 115 1e-22
410gb|AY338635.1| Chaquihua sp. EP080 histone 3 gene, partial cds 115 1e-22
411gb|AY749730.1| Cinygma sp. EP123 histone H3 (H3) gene, partial cds 115 1e-22
412gb|AY749723.1| Siphlaenigma janae histone H3 (H3) gene, partial cds 115 1e-22
413gb|AY749702.1| Thraulodes sp. EP014 histone H3 (H3) gene, partia... 115 1e-22
414gb|AY655591.1| Cololabis saira histone H3a gene, partial cds 113 4e-22
415gb|DQ079682.1| Lysmata wurdemanni voucher MLP120 histone H3 (H3)... 113 4e-22
416gb|DQ073573.1| Craterostigma plantagineum histone H3.3 mRNA, com... 113 4e-22
417gb|BC097060.1| Danio rerio zgc:113984, mRNA (cDNA clone MGC:1139... 113 4e-22
418ref|XM_779415.1| PREDICTED: Strongylocentrotus purpuratus simila... 113 4e-22
419ref|NM_001025176.3| Danio rerio zgc:113984 (zgc:113984), mRNA 113 4e-22
420gb|AY521718.1| Romalea sp. BYU_ACOR015 histone H3 (H3) gene, par... 113 4e-22
421ref|XM_677616.1| PREDICTED: Danio rerio similar to CG31613-PA, t... 113 4e-22
422gb|AC008233.3|AC008233 Drosophila melanogaster, chromosome 2L, r... 113 4e-22
423gb|AY923954.1| Haliotis pustulata isolate H15 histone H3 (H3) ge... 113 4e-22
424gb|AE003608.5| Drosophila melanogaster chromosome 2L, section 17... 113 4e-22
425gb|AY662888.1| Embiotoca jacksoni histone H3a gene, partial cds 113 4e-22
426gb|AY749740.1| Isonychia sp. EP142 histone H3 (H3) gene, partial... 113 4e-22
427gb|DQ079694.1| Pachygrapsus marmoratus voucher KCpama histone H3... 111 2e-21
428gb|AY520706.1| Tetraclitella purpurascens histone H3 gene, parti... 111 2e-21
429emb|CR733198.1|CNS0GSLF Tetraodon nigroviridis full-length cDNA 111 2e-21
430emb|CR732463.2|CNS0GS44 Tetraodon nigroviridis full-length cDNA 111 2e-21
431emb|CR732337.2|CNS0GS0M Tetraodon nigroviridis full-length cDNA 111 2e-21
432emb|CR729702.2|CNS0GPZG Tetraodon nigroviridis full-length cDNA 111 2e-21
433emb|CR728891.2|CNS0GPCX Tetraodon nigroviridis full-length cDNA 111 2e-21
434emb|CR726879.2|CNS0GNT1 Tetraodon nigroviridis full-length cDNA 111 2e-21
435gb|DQ284388.1| Ambystoma tigrinum histone H3a gene, partial cds 111 2e-21
436dbj|AB185067.1| Conocephalum conicum H3 gene for histone 3, comp... 111 2e-21
437gb|AF404629.1| Lewia infectoria isolate CR30 histone gene, parti... 111 2e-21
438ref|XM_320335.2| Anopheles gambiae str. PEST ENSANGP00000014183 ... 111 2e-21
439ref|XM_314446.2| Anopheles gambiae str. PEST ENSANGP00000016066 ... 111 2e-21
440gb|AY749741.1| Rhoenanthus sp. EP143 histone H3 (H3) gene, parti... 111 2e-21
441gb|AY725694.1| Cylindrocladium pseudonaviculatum strain CPC 3570... 109 6e-21
442gb|AY655588.1| Menidia menidia histone H3a gene, partial cds 109 6e-21
443gb|DQ028125.1| Leiognathus fasciatus isolate L16 histone H3 gene... 109 6e-21
444gb|DQ028115.1| Leiognathus sp. L25 histone H3 gene, partial cds 109 6e-21
445gb|DQ028081.1| Trachipterus trachypterus histone H3 gene, partia... 109 6e-21
446gb|BC079835.1| Homo sapiens histone 1, H3g, mRNA (cDNA clone MGC... 109 6e-21
447ref|XM_610495.1| PREDICTED: Bos taurus similar to CG31613-PA (LO... 109 6e-21
448ref|NM_003534.2| Homo sapiens histone 1, H3g (HIST1H3G), mRNA 109 6e-21
449gb|AF531280.1| Homo sapiens histone H3 (HIST1H3G) gene, complete... 109 6e-21
450gb|U28732.1| Caenorhabditis elegans cosmid F45E1, complete sequence 109 6e-21
451ref|XM_789723.1| PREDICTED: Strongylocentrotus purpuratus simila... 109 6e-21
452gb|BC012185.1| Homo sapiens histone 1, H3g, mRNA (cDNA clone MGC... 109 6e-21
453gb|DQ284421.1| Pachytriton brevipes histone H3a gene, partial cds 109 6e-21
454gb|DQ284420.1| Pleurodeles waltl histone H3a gene, partial cds 109 6e-21
455gb|DQ284417.1| Triturus cristatus histone H3a gene, partial cds 109 6e-21
456gb|DQ284386.1| Elachistocleis ovalis histone H3a gene, partial cds 109 6e-21
457gb|DQ284185.1| Chaperina fusca histone H3a gene, partial cds 109 6e-21
458gb|AY829963.1| Euphrynichus bacillifer isolate AMCC 124711 histo... 109 6e-21
459ref|NM_076943.2| Caenorhabditis elegans HIStone family member (h... 109 6e-21
460gb|AY218164.1| Pomphorhynchus laevis histone H3 gene, partial cds 109 6e-21
461emb|Z66415.1|HS95B11R H.sapiens CpG island DNA genomic Mse1 frag... 109 6e-21
462gb|DQ275319.1| Graphoderus zonatus voucher BYU KBMGrzo66 histone... 109 6e-21
463gb|AY662926.1| Astronotus ocellatus histone H3a gene, partial cds 109 6e-21
464gb|AY662910.1| Paratilapia polleni 'Ravelobe' histone H3a gene, ... 109 6e-21
465gb|AY662900.1| Paretroplus maromandia histone H3a-like gene, par... 109 6e-21
466gb|AY662892.1| Etroplus maculatus histone H3a gene, partial cds 109 6e-21
467gb|AY539178.1| Menidia menidia histone H3 gene, partial cds 109 6e-21
468gb|AY749739.1| Stygifloris sp. EP141 histone H3 (H3) gene, parti... 109 6e-21
469gb|AY749710.1| Centroptilum luteolum histone H3 (H3) gene, parti... 109 6e-21
470emb|Z80785.1|HSH3H H.sapiens H3/h gene 109 6e-21
471emb|CR728060.2|CNS0GOPU Tetraodon nigroviridis full-length cDNA 107 2e-20
472gb|AY125219.1| Echinosoma sp. DM11 histone 3 gene, partial cds 107 2e-20
473gb|AY125217.1| Supella longipalpa histone 3 gene, partial cds 107 2e-20
474emb|AL357493.8| Human DNA sequence from clone RP11-439A17 on chr... 107 2e-20
475gb|AY707444.1| Grylloblattina djakonovi histone 3 gene, partial cds 107 2e-20
476ref|XM_692955.1| PREDICTED: Danio rerio similar to H3 histone, f... 107 2e-20
477ref|NM_200003.1| Danio rerio zgc:64222 (zgc:64222), mRNA 107 2e-20
478dbj|AB185071.1| Conocephalum conicum H3 gene for histone 3, comp... 107 2e-20
479gb|AF404623.1| Lewia infectoria isolate CR15 histone gene, parti... 107 2e-20
480gb|AY064472.1| Aplysia californica histone H3 (His.H3) gene, com... 107 2e-20
481gb|AY923978.1| Stomatella sp. CET-2005 histone H3 (H3) gene, par... 107 2e-20
482gb|AY923955.1| Haliotis virginea isolate H19 histone H3 (H3) gen... 107 2e-20
483gb|AY923953.1| Haliotis asinina isolate H11 histone H3 (H3) gene... 107 2e-20
484gb|BC057444.1| Danio rerio zgc:64222, mRNA (cDNA clone MGC:64222... 107 2e-20
485gb|AY338626.1| Coloburiscus humeralis histone 3 gene, partial cds 107 2e-20
486gb|AY749755.1| Griseargiolestes albescens histone H3 (H3) gene, ... 107 2e-20
487gb|AY749738.1| Jubabaetis sp. EP139 histone H3 (H3) gene, partia... 107 2e-20
488gb|AY749722.1| Adenophlebia peringueyella histone H3 (H3) gene, ... 107 2e-20
489gb|AY749721.1| Coloburiscoides sp. EP094 histone H3 (H3) gene, p... 107 2e-20
490gb|AY749718.1| Siphlonurus sp. EP084 histone H3 (H3) gene, parti... 107 2e-20
491gb|AY749707.1| Leptophlebiidae sp. EP030 histone H3 (H3) gene, p... 107 2e-20
492gb|AY655580.1| Atherinomorus lacunosus histone H3a gene, partial... 105 1e-19
493gb|DQ028128.1| Leiognathus fasciatus histone H3 gene, partial cds 105 1e-19
494gb|DQ028126.1| Leiognathus fasciatus isolate L36 histone H3 gene... 105 1e-19
495gb|BC090320.1| Rattus norvegicus tripartite motif protein 17, mR... 105 1e-19
496gb|AY521721.1| Gryllotalpidae sp. BYU_ACOR020 histone H3 (H3) ge... 105 1e-19
497emb|BX005126.10| Zebrafish DNA sequence from clone CH211-129O9 i... 105 1e-19
498emb|BX510647.10| Zebrafish DNA sequence from clone CH211-87N9 in... 105 1e-19
499gb|AY923965.1| Perotrochus amabilis isolate PL3 histone H3 (H3) ... 105 1e-19
500gb|AY923957.1| Haliotis midae isolate H35 histone H3 (H3) gene, ... 105 1e-19

>emb|X00937.1|TAHI02 Wheat histone H3 gene
          Length = 811

 Score =  276 bits (139), Expect = 5e-71
 Identities = 172/183 (93%)
 Strand = Plus / Minus

                                                                       
Query: 175 gcagcctaggccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatg 234
           ||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 663 gcagcctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatg 604

                                                                       
Query: 235 gtgacccccttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtag 294
           ||||| | |||||||||||||||||| |||||||||||||| || || || |||||||||
Sbjct: 603 gtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagaggcccacgaggtag 544

                                                                       
Query: 295 gactcggcggcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttg 354
           | |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 543 gcctcggcggcctcctgcagggcggagacggcggaggactggaagcggaggtcggtcttg 484

              
Query: 355 aag 357
           |||
Sbjct: 483 aag 481



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 32  ggcaacaagaaggtgccatcaaattaggcacaacacacccacc 74
           |||||||||||||| |||||| |||||||| |||||| |||||
Sbjct: 811 ggcaacaagaaggtaccatcagattaggcataacacatccacc 769



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  246 bits (124), Expect = 4e-62
 Identities = 166/180 (92%)
 Strand = Plus / Minus

                                                                            
Query: 178      gcctaggccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtg 237
                |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 37507568 gcctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtg 37507509

                                                                            
Query: 238      acccccttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggac 297
                || | |||||||||||||||||| |||||||||||||| || |||||||||||||||| |
Sbjct: 37507508 acgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcc 37507449

                                                                            
Query: 298      tcggcggcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
                ||||| ||||||||||| ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 37507448 tcggccgcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaag 37507389



to top

>dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0505D12
          Length = 146951

 Score =  246 bits (124), Expect = 4e-62
 Identities = 166/180 (92%)
 Strand = Plus / Minus

                                                                          
Query: 178    gcctaggccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtg 237
              |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 102105 gcctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtg 102046

                                                                          
Query: 238    acccccttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggac 297
              || | |||||||||||||||||| |||||||||||||| || |||||||||||||||| |
Sbjct: 102045 acgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcc 101986

                                                                          
Query: 298    tcggcggcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
              ||||| ||||||||||| ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 101985 tcggccgcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaag 101926



to top

>dbj|AK108078.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-138-E03, full
           insert sequence
          Length = 1296

 Score =  246 bits (124), Expect = 4e-62
 Identities = 166/180 (92%)
 Strand = Plus / Minus

                                                                       
Query: 178 gcctaggccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtg 237
           |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 491 gcctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtg 432

                                                                       
Query: 238 acccccttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggac 297
           || | |||||||||||||||||| |||||||||||||| || |||||||||||||||| |
Sbjct: 431 acgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcc 372

                                                                       
Query: 298 tcggcggcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||| ||||||||||| ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 371 tcggccgcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaag 312



to top

>gb|M36658.1|MZEH3A Corn histone H3 (H3C3) gene, complete cds
          Length = 1177

 Score =  246 bits (124), Expect = 4e-62
 Identities = 166/180 (92%)
 Strand = Plus / Minus

                                                                       
Query: 178 gcctaggccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtg 237
           |||||||| | ||| || ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 958 gcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 899

                                                                       
Query: 238 acccccttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggac 297
           || | |||||||||||||||||| |||||||||||||| ||||| ||||||||||||| |
Sbjct: 898 acgcgcttggcgtggatggcgcagaggttggtgtcctcgaacaggccgacgaggtaggcc 839

                                                                       
Query: 298 tcggcggcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||||||||| ||||  ||||||||||||||||||||||||||||||||||||
Sbjct: 838 tcggcggcctcctgcagcgcggcgacggcggaggactggaagcggaggtcggtcttgaag 779



to top

>ref|XM_475315.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  242 bits (122), Expect = 6e-61
 Identities = 161/174 (92%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| |||||||||||||| |||||||||||||||||||||||||||||||| | |
Sbjct: 407 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||| || |||||||||||||||| |||||||
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 288

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaag 234



to top

>ref|NM_190750.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  242 bits (122), Expect = 6e-61
 Identities = 164/178 (92%)
 Strand = Plus / Minus

                                                                       
Query: 180 ctaggccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgac 239
           |||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 411 ctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 240 ccccttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactc 299
            | |||||||||||||||||| |||||||||||||| || |||||||||||||||| |||
Sbjct: 351 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctc 292

                                                                     
Query: 300 ggcggcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||| ||||||||||| ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 291 ggccgcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaag 234



to top

>gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0042J17, complete sequence
          Length = 124139

 Score =  242 bits (122), Expect = 6e-61
 Identities = 161/174 (92%)
 Strand = Plus / Plus

                                                                         
Query: 184   gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
             |||||||| |||||||||||||| |||||||||||||||||||||||||||||||| | |
Sbjct: 72765 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 72824

                                                                         
Query: 244   ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
             ||||||||||||||||| |||||||||||||| || |||||||||||||||| |||||||
Sbjct: 72825 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 72884

                                                                   
Query: 304   gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
             ||||||||||| ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 72885 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaag 72938



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  242 bits (122), Expect = 6e-61
 Identities = 161/174 (92%)
 Strand = Plus / Plus

                                                                            
Query: 184      gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
                |||||||| |||||||||||||| |||||||||||||||||||||||||||||||| | |
Sbjct: 21355443 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 21355502

                                                                            
Query: 244      ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
                ||||||||||||||||| |||||||||||||| || |||||||||||||||| |||||||
Sbjct: 21355503 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 21355562

                                                                      
Query: 304      gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
                ||||||||||| ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 21355563 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaag 21355616



to top

>dbj|AK120955.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023039F20, full
           insert sequence
          Length = 735

 Score =  242 bits (122), Expect = 6e-61
 Identities = 161/174 (92%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| |||||||||||||| |||||||||||||||||||||||||||||||| | |
Sbjct: 492 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 433

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||| || |||||||||||||||| |||||||
Sbjct: 432 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 373

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 372 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaag 319



to top

>gb|BT018179.1| Zea mays clone EL01N0557G06.c mRNA sequence
          Length = 716

 Score =  230 bits (116), Expect = 2e-57
 Identities = 161/176 (91%)
 Strand = Plus / Minus

                                                                       
Query: 182 aggccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccc 241
           ||||||||||||| | ||||||||| |||||||||||||||||||||||||||||||| |
Sbjct: 469 aggccctctctcccctgatgcggcgcgcgagctggatgtccttgggcatgatggtgacgc 410

                                                                       
Query: 242 ccttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcgg 301
            |||||||||||||||||| ||| | ||||||||||| ||||| |||||||||| |||||
Sbjct: 409 gcttggcgtggatggcgcacagggtagtgtcctcaaagagccccacgaggtaggcctcgg 350

                                                                   
Query: 302 cggcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||||| || || ||||||||||||||||||||||| ||||||||||||
Sbjct: 349 cggcctcctgcagcgcagagacggcggaggactggaagcggagatcggtcttgaag 294



to top

>gb|M35388.1|MZEHISH3A Zea mays histone H3 gene, complete cds
          Length = 411

 Score =  224 bits (113), Expect = 2e-55
 Identities = 158/173 (91%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || | ||||||||| |||||||||||||||||||||||||||||||| | |
Sbjct: 407 gccctctcgcccctgatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||| || ||||| |||||||||| |||||||
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccacgaggtaggcctcggcg 288

                                                                
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaa 356
           ||||||||||| ||||  || ||||||||||||||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgcggcgacagcggaggactggaagcggaggtcggtcttgaa 235



to top

>gb|M13378.1|MZEH3C2 Maize (Zea mays) histone H3 gene (H3C2), complete cds
          Length = 1001

 Score =  224 bits (113), Expect = 2e-55
 Identities = 158/173 (91%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || | ||||||||| |||||||||||||||||||||||||||||||| | |
Sbjct: 828 gccctctcgcccctgatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 769

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||| || ||||| |||||||||| |||||||
Sbjct: 768 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccacgaggtaggcctcggcg 709

                                                                
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaa 356
           ||||||||||| ||||  || ||||||||||||||||||||||||||||||||
Sbjct: 708 gcctcctgcagcgcggcgacagcggaggactggaagcggaggtcggtcttgaa 656



to top

>gb|BT018930.1| Zea mays clone Contig60.F mRNA sequence
          Length = 887

 Score =  222 bits (112), Expect = 6e-55
 Identities = 160/176 (90%)
 Strand = Plus / Plus

                                                                       
Query: 182 aggccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccc 241
           |||||||||| || ||||||||||| |||||||||||||||||||||||||||||||| |
Sbjct: 224 aggccctctcgccccggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 283

                                                                       
Query: 242 ccttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcgg 301
            |||||||||||||||||| |||||||||||||| || || || |||||||||| |||||
Sbjct: 284 gcttggcgtggatggcgcagaggttggtgtcctcgaagaggcccacgaggtaggcctcgg 343

                                                                   
Query: 302 cggcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||||| ||||  ||||||||||||||||| |||||||| |||||||||
Sbjct: 344 cggcctcctgcagcgcggccacggcggaggactggaaccggaggtccgtcttgaag 399



to top

>emb|X84377.1|ZMHIS3DNA Z.mays histone H3 gene
          Length = 1119

 Score =  222 bits (112), Expect = 6e-55
 Identities = 160/176 (90%)
 Strand = Plus / Minus

                                                                       
Query: 182 aggccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccc 241
           |||||||||| || ||||||||||| |||||||||||||||||||||||||||||||| |
Sbjct: 793 aggccctctcgccccggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 734

                                                                       
Query: 242 ccttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcgg 301
            |||||||||||||||||| |||||||||||||| || || || |||||||||| |||||
Sbjct: 733 gcttggcgtggatggcgcagaggttggtgtcctcgaagaggcccacgaggtaggcctcgg 674

                                                                   
Query: 302 cggcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||||| ||||  ||||||||||||||||| |||||||| |||||||||
Sbjct: 673 cggcctcctgcagcgcggccacggcggaggactggaaccggaggtccgtcttgaag 618



to top

>ref|NM_185613.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  218 bits (110), Expect = 9e-54
 Identities = 149/162 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||| ||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 395 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| ||||||||||||||||| | ||| |||||||||||||||
Sbjct: 335 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcggcctcctgcagg 276

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 275 gcggcgacggcggagctctggaagcggaggtcggtcttgaag 234



to top

>ref|NM_185609.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 432

 Score =  218 bits (110), Expect = 9e-54
 Identities = 149/162 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||| ||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 416 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 357

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| ||||||||||||||||| | |||||||||||||||||| 
Sbjct: 356 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgcagc 297

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 296 gcggcgacggcggagctctggaagcggaggtcggtcttgaag 255



to top

>gb|BT017805.1| Zea mays clone EL01N0506E02.c mRNA sequence
          Length = 638

 Score =  218 bits (110), Expect = 9e-54
 Identities = 149/162 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||| ||||||||||||||||||||||| | |||||||||||||
Sbjct: 337 cggatgcggcgggcgagctgaatgtccttgggcatgatggtgacgcgcttggcgtggatg 278

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || || ||||||||||||| ||| |||||||||||||| 
Sbjct: 277 gcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctccgcggcctcctgcagc 218

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||  ||||||||||||||||||||||||||||||||||||
Sbjct: 217 gcggcgacggcggaggactggaagcggaggtcggtcttgaag 176



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  218 bits (110), Expect = 9e-54
 Identities = 149/162 (91%)
 Strand = Plus / Minus

                                                                           
Query: 196     cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
               ||||| ||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 3055557 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 3055498

                                                                           
Query: 256     gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
               ||||| |||||||||||||| ||||||||||||||||| | ||| |||||||||||||||
Sbjct: 3055497 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcggcctcctgcagg 3055438

                                                         
Query: 316     gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
               ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 3055437 gcggcgacggcggagctctggaagcggaggtcggtcttgaag 3055396



 Score =  218 bits (110), Expect = 9e-54
 Identities = 149/162 (91%)
 Strand = Plus / Plus

                                                                           
Query: 196     cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
               ||||| ||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 3045573 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 3045632

                                                                           
Query: 256     gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
               ||||| |||||||||||||| ||||||||||||||||| | |||||||||||||||||| 
Sbjct: 3045633 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgcagc 3045692

                                                         
Query: 316     gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
               ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 3045693 gcggcgacggcggagctctggaagcggaggtcggtcttgaag 3045734



 Score =  210 bits (106), Expect = 2e-51
 Identities = 148/162 (91%)
 Strand = Plus / Plus

                                                                           
Query: 196     cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
               ||||| ||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 3039543 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 3039602

                                                                           
Query: 256     gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
               || || |||||||||||||| ||||||||||||||||| | |||||||||||||||||| 
Sbjct: 3039603 gcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgcagc 3039662

                                                         
Query: 316     gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
               ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 3039663 gcggcgacggcggagctctggaagcggaggtcggtcttgaag 3039704



 Score =  202 bits (102), Expect = 6e-49
 Identities = 147/162 (90%)
 Strand = Plus / Plus

                                                                           
Query: 196     cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
               ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 3054220 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 3054279

                                                                           
Query: 256     gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
               ||||| ||||| |||||||| || |||||||||||||| | ||| |||||||||||||| 
Sbjct: 3054280 gcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccgcggcctcctgcagc 3054339

                                                         
Query: 316     gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
               ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 3054340 gcggcgacggcggagctctggaagcggaggtcggtcttgaag 3054381



 Score =  186 bits (94), Expect = 3e-44
 Identities = 145/162 (89%)
 Strand = Plus / Plus

                                                                           
Query: 196     cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
               ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 1644712 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 1644771

                                                                           
Query: 256     gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
               ||||| |||||||||||||| || || ||||||||||||| ||||||||||||||| |||
Sbjct: 1644772 gcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcggcctcctggagg 1644831

                                                         
Query: 316     gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
               |||   || |||  |  |||||||||||||||||||||||||
Sbjct: 1644832 gcgagcaccgcgtggctctggaagcggaggtcggtcttgaag 1644873



to top

>dbj|AP005828.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0702F05
          Length = 145018

 Score =  218 bits (110), Expect = 9e-54
 Identities = 149/162 (91%)
 Strand = Plus / Minus

                                                                          
Query: 196    cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
              ||||| ||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 143506 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 143447

                                                                          
Query: 256    gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
              ||||| |||||||||||||| ||||||||||||||||| | ||| |||||||||||||||
Sbjct: 143446 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcggcctcctgcagg 143387

                                                        
Query: 316    gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
              ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 143386 gcggcgacggcggagctctggaagcggaggtcggtcttgaag 143345



 Score =  218 bits (110), Expect = 9e-54
 Identities = 149/162 (91%)
 Strand = Plus / Plus

                                                                          
Query: 196    cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
              ||||| ||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 133522 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 133581

                                                                          
Query: 256    gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
              ||||| |||||||||||||| ||||||||||||||||| | |||||||||||||||||| 
Sbjct: 133582 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgcagc 133641

                                                        
Query: 316    gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
              ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 133642 gcggcgacggcggagctctggaagcggaggtcggtcttgaag 133683



 Score =  210 bits (106), Expect = 2e-51
 Identities = 148/162 (91%)
 Strand = Plus / Plus

                                                                          
Query: 196    cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
              ||||| ||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 127492 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 127551

                                                                          
Query: 256    gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
              || || |||||||||||||| ||||||||||||||||| | |||||||||||||||||| 
Sbjct: 127552 gcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgcagc 127611

                                                        
Query: 316    gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
              ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 127612 gcggcgacggcggagctctggaagcggaggtcggtcttgaag 127653



 Score =  202 bits (102), Expect = 6e-49
 Identities = 147/162 (90%)
 Strand = Plus / Plus

                                                                          
Query: 196    cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
              ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 142169 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 142228

                                                                          
Query: 256    gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
              ||||| ||||| |||||||| || |||||||||||||| | ||| |||||||||||||| 
Sbjct: 142229 gcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccgcggcctcctgcagc 142288

                                                        
Query: 316    gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
              ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 142289 gcggcgacggcggagctctggaagcggaggtcggtcttgaag 142330



to top

>dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
            clone:P0681F10
          Length = 170371

 Score =  218 bits (110), Expect = 9e-54
 Identities = 149/162 (91%)
 Strand = Plus / Minus

                                                                        
Query: 196  cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
            ||||| ||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 9742 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 9683

                                                                        
Query: 256  gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
            ||||| |||||||||||||| ||||||||||||||||| | ||| |||||||||||||||
Sbjct: 9682 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcggcctcctgcagg 9623

                                                      
Query: 316  gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 9622 gcggcgacggcggagctctggaagcggaggtcggtcttgaag 9581



 Score =  202 bits (102), Expect = 6e-49
 Identities = 147/162 (90%)
 Strand = Plus / Plus

                                                                        
Query: 196  cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
            ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 8405 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 8464

                                                                        
Query: 256  gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
            ||||| ||||| |||||||| || |||||||||||||| | ||| |||||||||||||| 
Sbjct: 8465 gcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccgcggcctcctgcagc 8524

                                                      
Query: 316  gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 8525 gcggcgacggcggagctctggaagcggaggtcggtcttgaag 8566



to top

>emb|X13679.1|OSHIS3PS Oryza sativa H3 histone pseudogene H3R-12
          Length = 1920

 Score =  218 bits (110), Expect = 9e-54
 Identities = 149/162 (91%)
 Strand = Plus / Minus

                                                                        
Query: 196  cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
            ||||| ||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 1515 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 1456

                                                                        
Query: 256  gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
            ||||| |||||||||||||| ||||||||||||||||| | |||||||||||||||||| 
Sbjct: 1455 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgcagc 1396

                                                      
Query: 316  gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 1395 gcggcgacggcggagctctggaagcggaggtcggtcttgaag 1354



to top

>gb|M13379.1|MZEH3C4 Maize (Zea mays) histone H3 gene (H3C4), complete cds
          Length = 1264

 Score =  214 bits (108), Expect = 1e-52
 Identities = 159/176 (90%)
 Strand = Plus / Minus

                                                                       
Query: 182 aggccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccc 241
           ||||||||||||| | ||||||||| |||||||| ||||||||||||||||||||||| |
Sbjct: 934 aggccctctctcccctgatgcggcgcgcgagctgaatgtccttgggcatgatggtgacgc 875

                                                                       
Query: 242 ccttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcgg 301
            |||||||||||||||||| ||||| ||||||||||| ||||| || ||||||| |||||
Sbjct: 874 gcttggcgtggatggcgcagaggttagtgtcctcaaagagccccacaaggtaggcctcgg 815

                                                                   
Query: 302 cggcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||||| || |  ||||||||||||||||||||||| ||||||||||||
Sbjct: 814 cggcctcctgcagcgcagcgacggcggaggactggaagcggagatcggtcttgaag 759



to top

>ref|NM_185607.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  210 bits (106), Expect = 2e-51
 Identities = 148/162 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||| ||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 395 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           || || |||||||||||||| ||||||||||||||||| | |||||||||||||||||| 
Sbjct: 335 gcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgcagc 276

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 275 gcggcgacggcggagctctggaagcggaggtcggtcttgaag 234



to top

>ref|XM_472456.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  210 bits (106), Expect = 2e-51
 Identities = 157/174 (90%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || | ||||||||| |||||||||||||||||||||||||||||||| | |
Sbjct: 407 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||| || || ||||||||||||| |||||||
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcg 288

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||||  |||||||| |||||||| |||||||| |||||||||
Sbjct: 287 gcctcctgcagcgcggcgacggcggacgactggaaccggaggtccgtcttgaag 234



to top

>emb|X13678.1|OSHIS311 Oryza sativa H3 histone gene H3R-11
          Length = 1200

 Score =  210 bits (106), Expect = 2e-51
 Identities = 148/162 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||| ||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 795 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 736

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           || || |||||||||||||| ||||||||||||||||| | |||||||||||||||||| 
Sbjct: 735 gcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgcagc 676

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 675 gcggcgacggcggagctctggaagcggaggtcggtcttgaag 634



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  210 bits (106), Expect = 2e-51
 Identities = 157/174 (90%)
 Strand = Plus / Minus

                                                                            
Query: 184      gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
                |||||||| || | ||||||||| |||||||||||||||||||||||||||||||| | |
Sbjct: 20749059 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 20749000

                                                                            
Query: 244      ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
                ||||||||||||||||| |||||||||||||| || || ||||||||||||| |||||||
Sbjct: 20748999 ttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcg 20748940

                                                                      
Query: 304      gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
                ||||||||||| ||||  |||||||| |||||||| |||||||| |||||||||
Sbjct: 20748939 gcctcctgcagcgcggcgacggcggacgactggaaccggaggtccgtcttgaag 20748886



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                            
Query: 177      agcctaggccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggt 236
                |||||| |||||||| |||||||| |  | ||| ||||| ||||||||||||||||||||
Sbjct: 22438395 agcctaagccctctcaccacggatcctcctagccagctgaatgtccttgggcatgatggt 22438336

                                                                            
Query: 237      gacccccttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtagga 296
                 || | |||||| ||||||||||| |||||||||||||| || || || || ||||| | 
Sbjct: 22438335 cacacgcttggcatggatggcgcacaggttggtgtcctcgaagagacccaccaggtacgc 22438276

                                     
Query: 297      ctcggcggcctcctgcagggc 317
                |||||| || ||||| |||||
Sbjct: 22438275 ctcggcagcttcctgaagggc 22438255



to top

>emb|AL606618.4|OSJN00062 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0108J11,
             complete sequence
          Length = 124629

 Score =  210 bits (106), Expect = 2e-51
 Identities = 157/174 (90%)
 Strand = Plus / Minus

                                                                         
Query: 184   gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
             |||||||| || | ||||||||| |||||||||||||||||||||||||||||||| | |
Sbjct: 95210 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 95151

                                                                         
Query: 244   ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
             ||||||||||||||||| |||||||||||||| || || ||||||||||||| |||||||
Sbjct: 95150 ttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcg 95091

                                                                   
Query: 304   gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
             ||||||||||| ||||  |||||||| |||||||| |||||||| |||||||||
Sbjct: 95090 gcctcctgcagcgcggcgacggcggacgactggaaccggaggtccgtcttgaag 95037



to top

>ref|NM_185612.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  202 bits (102), Expect = 6e-49
 Identities = 147/162 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 395 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| ||||| |||||||| || |||||||||||||| | ||| |||||||||||||| 
Sbjct: 335 gcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccgcggcctcctgcagc 276

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 275 gcggcgacggcggagctctggaagcggaggtcggtcttgaag 234



to top

>gb|AC134048.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0076K20,
              complete sequence
          Length = 127338

 Score =  202 bits (102), Expect = 6e-49
 Identities = 147/162 (90%)
 Strand = Plus / Minus

                                                                          
Query: 196    cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
              ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 118162 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 118103

                                                                          
Query: 256    gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
              ||||| |||||||||||||| || |||||||||||||||| ||||||||||||||| || 
Sbjct: 118102 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctggagc 118043

                                                        
Query: 316    gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
              ||||  |||||||||  |||||| |||||||| |||||||||
Sbjct: 118042 gcggcgacggcggagctctggaaccggaggtccgtcttgaag 118001



to top

>gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0030I09 map C83B, complete sequence
          Length = 123477

 Score =  202 bits (102), Expect = 6e-49
 Identities = 147/162 (90%)
 Strand = Plus / Minus

                                                                         
Query: 196   cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
             ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 13768 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 13709

                                                                         
Query: 256   gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
             ||||| |||||||||||||| || |||||||||||||||| ||||||||||||||| || 
Sbjct: 13708 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctggagc 13649

                                                       
Query: 316   gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
             ||||  |||||||||  |||||| |||||||| |||||||||
Sbjct: 13648 gcggcgacggcggagctctggaaccggaggtccgtcttgaag 13607



to top

>emb|X13680.1|OSHIS321 Oryza sativa H3 histone H3R-21 clone RH3-2
          Length = 1200

 Score =  202 bits (102), Expect = 6e-49
 Identities = 147/162 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 795 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 736

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || |||||||||||||||| ||||||||||||||| || 
Sbjct: 735 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctggagc 676

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||  |||||||||  |||||| |||||||| |||||||||
Sbjct: 675 gcggcgacggcggagctctggaaccggaggtccgtcttgaag 634



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  202 bits (102), Expect = 6e-49
 Identities = 147/162 (90%)
 Strand = Plus / Plus

                                                                           
Query: 196     cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
               ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 2608636 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 2608695

                                                                           
Query: 256     gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
               ||||| |||||||||||||| || |||||||||||||||| ||||||||||||||| || 
Sbjct: 2608696 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctggagc 2608755

                                                         
Query: 316     gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
               ||||  |||||||||  |||||| |||||||| |||||||||
Sbjct: 2608756 gcggcgacggcggagctctggaaccggaggtccgtcttgaag 2608797



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  202 bits (102), Expect = 6e-49
 Identities = 147/162 (90%)
 Strand = Plus / Plus

                                                                           
Query: 196     cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
               ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 2617667 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 2617726

                                                                           
Query: 256     gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
               ||||| |||||||||||||| || |||||||||||||||| ||||||||||||||| || 
Sbjct: 2617727 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctggagc 2617786

                                                         
Query: 316     gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
               ||||  |||||||||  |||||| |||||||| |||||||||
Sbjct: 2617787 gcggcgacggcggagctctggaaccggaggtccgtcttgaag 2617828



to top

>gb|U77296.1|OSU77296 Oryza sativa histone 3 mRNA, complete cds
          Length = 642

 Score =  202 bits (102), Expect = 6e-49
 Identities = 147/162 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 466 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 407

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || |||||||||||||||| ||||||||||||||| || 
Sbjct: 406 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctggagc 347

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||  |||||||||  |||||| |||||||| |||||||||
Sbjct: 346 gcggcgacggcggagctctggaaccggaggtccgtcttgaag 305



to top

>gb|M34928.1|BLYHISH3PA Barley histone H3 mRNA, 3' end
          Length = 505

 Score =  194 bits (98), Expect = 1e-46
 Identities = 146/162 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 227 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 168

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| ||||||||||||||||| | ||||||||||||||| |||
Sbjct: 167 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctggagg 108

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||||  ||||||||| | ||||||||||||||||
Sbjct: 107 gccagcacggcgtgggactggaacctgaggtcggtcttgaag 66



to top

>ref|XM_493701.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 411

 Score =  186 bits (94), Expect = 3e-44
 Identities = 145/162 (89%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 395 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || || ||||||||||||| ||||||||||||||| |||
Sbjct: 335 gcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcggcctcctggagg 276

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           |||   || |||  |  |||||||||||||||||||||||||
Sbjct: 275 gcgagcaccgcgtggctctggaagcggaggtcggtcttgaag 234



to top

>dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
             clone:P0493C11
          Length = 143113

 Score =  186 bits (94), Expect = 3e-44
 Identities = 145/162 (89%)
 Strand = Plus / Plus

                                                                         
Query: 196   cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
             ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 47883 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 47942

                                                                         
Query: 256   gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
             ||||| |||||||||||||| || || ||||||||||||| ||||||||||||||| |||
Sbjct: 47943 gcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcggcctcctggagg 48002

                                                       
Query: 316   gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
             |||   || |||  |  |||||||||||||||||||||||||
Sbjct: 48003 gcgagcaccgcgtggctctggaagcggaggtcggtcttgaag 48044



to top

>gb|AF093633.1|AF093633 Oryza sativa histone H3 mRNA, complete cds
          Length = 793

 Score =  186 bits (94), Expect = 3e-44
 Identities = 145/162 (89%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 483 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 424

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || || ||||||||||||| ||||||||||||||| |||
Sbjct: 423 gcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcggcctcctggagg 364

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           |||   || |||  |  |||||||||||||||||||||||||
Sbjct: 363 gcgagcaccgcgtggctctggaagcggaggtcggtcttgaag 322



to top

>gb|U25664.1|OSU25664 Oryza sativa histone H3 gene, complete cds
          Length = 711

 Score =  186 bits (94), Expect = 3e-44
 Identities = 145/162 (89%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 625 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 566

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| ||||| |||||||| || ||||||||||||||   ||| |||||||||||||| 
Sbjct: 565 gcgcacaggttagtgtcctcgaagagcccgacgaggtaccgctccgcggcctcctgcagc 506

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           |||   |||||||| | |||||||||||||||||||||||||
Sbjct: 505 gcgcggacggcggacgtctggaagcggaggtcggtcttgaag 464



to top

>gb|M15664.1|RICHIS3 Rice histone 3 gene, complete cds
          Length = 568

 Score =  186 bits (94), Expect = 3e-44
 Identities = 145/162 (89%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 532 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 473

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| ||||| |||||||| || ||||||||||||||   ||| |||||||||||||| 
Sbjct: 472 gcgcacaggttagtgtcctcgaagagcccgacgaggtaccgctccgcggcctcctgcagc 413

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           |||   |||||||| | |||||||||||||||||||||||||
Sbjct: 412 gcgcggacggcggacgtctggaagcggaggtcggtcttgaag 371



to top

>gb|AF140033.1|AF140033 Phreatamoeba balamuthi histone H3 mRNA, complete cds
          Length = 626

 Score =  176 bits (89), Expect = 3e-41
 Identities = 125/137 (91%)
 Strand = Plus / Minus

                                                                       
Query: 178 gcctaggccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtg 237
           |||||||| | ||| |||||||||||||| || ||||||||||||||||||||||| || 
Sbjct: 424 gcctaggcgcgctcgccacggatgcggcgggccagctggatgtccttgggcatgatcgtc 365

                                                                       
Query: 238 acccccttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggac 297
           || | |||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
Sbjct: 364 acacgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtaggcc 305

                            
Query: 298 tcggcggcctcctgcag 314
           |||||||||||||||||
Sbjct: 304 tcggcggcctcctgcag 288



to top

>ref|NM_178203.1| Mus musculus histone 1, H3b (Hist1h3b), mRNA
          Length = 411

 Score =  170 bits (86), Expect = 2e-39
 Identities = 152/174 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| ||||| |||||||| |||||||||||||||||||||||||||||||| | |
Sbjct: 407 gccctctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || || ||||||| ||||   
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 288

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 287 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 234



to top

>ref|NM_175653.1| Mus musculus histone1, H3c (Hist1h3c), mRNA
          Length = 480

 Score =  170 bits (86), Expect = 2e-39
 Identities = 152/174 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| | |
Sbjct: 431 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 372

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || || ||||||| ||||   
Sbjct: 371 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 312

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 311 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaag 258



to top

>ref|NM_178206.2| Mus musculus histone 1, H3h (Hist1h3h), mRNA
          Length = 488

 Score =  170 bits (86), Expect = 2e-39
 Identities = 152/174 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||||||||| || ||||||||||||||||||||||||||||| | |
Sbjct: 438 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 379

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || |||||||||| |||   |
Sbjct: 378 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 319

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 318 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 265



to top

>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143
          Length = 3210

 Score =  170 bits (86), Expect = 2e-39
 Identities = 152/174 (87%)
 Strand = Plus / Minus

                                                                        
Query: 184  gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
            ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| | |
Sbjct: 3041 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 2982

                                                                        
Query: 244  ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
            ||||||||||||||||| |||||||||||||||||||| || || ||||||| ||||   
Sbjct: 2981 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 2922

                                                                  
Query: 304  gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 2921 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaag 2868



to top

>emb|X80326.1|MPMPH312 M.pahari mpH312 gene
          Length = 580

 Score =  170 bits (86), Expect = 2e-39
 Identities = 152/174 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| |||||||||||||| || ||||||||||||||||||||||||||||| | |
Sbjct: 452 gccctctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 393

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || || ||||||| ||||   
Sbjct: 392 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 333

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 332 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 279



to top

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score =  170 bits (86), Expect = 2e-39
 Identities = 152/174 (87%)
 Strand = Plus / Minus

                                                                          
Query: 184    gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
              |||||||| || ||||||||||| || ||||||||||||||||||||||||||||| | |
Sbjct: 139055 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 138996

                                                                          
Query: 244    ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
              ||||||||||||||||| |||||||||||||||||||| || |||||||||| |||   |
Sbjct: 138995 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 138936

                                                                    
Query: 304    gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
              ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 138935 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 138882



 Score =  147 bits (74), Expect = 3e-32
 Identities = 149/174 (85%)
 Strand = Plus / Plus

                                                                          
Query: 184    gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
              |||||||| || || ||||| || || ||||||||||||||||||||||||||||| | |
Sbjct: 203954 gccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 204013

                                                                          
Query: 244    ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
              ||||||||||||||||| |||||||||||||||||||| || |||||||||| |||   |
Sbjct: 204014 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 204073

                                                                    
Query: 304    gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
              ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 204074 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaag 204127



to top

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score =  170 bits (86), Expect = 2e-39
 Identities = 152/174 (87%)
 Strand = Plus / Minus

                                                                          
Query: 184    gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
              ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| | |
Sbjct: 143287 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 143228

                                                                          
Query: 244    ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
              ||||||||||||||||| |||||||||||||||||||| || || ||||||| ||||   
Sbjct: 143227 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 143168

                                                                    
Query: 304    gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
              ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 143167 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaag 143114



 Score =  170 bits (86), Expect = 2e-39
 Identities = 152/174 (87%)
 Strand = Plus / Plus

                                                                          
Query: 184    gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
              |||||||| ||||| |||||||| |||||||||||||||||||||||||||||||| | |
Sbjct: 135592 gccctctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 135651

                                                                          
Query: 244    ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
              ||||||||||||||||| |||||||||||||||||||| || || ||||||| ||||   
Sbjct: 135652 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 135711

                                                                    
Query: 304    gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
              ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 135712 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 135765



 Score =  155 bits (78), Expect = 1e-34
 Identities = 150/174 (86%)
 Strand = Plus / Minus

                                                                          
Query: 184    gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
              |||||||| || ||||||||||| || || |||||||||||||||||||||||||| | |
Sbjct: 126431 gccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgc 126372

                                                                          
Query: 244    ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
              ||||||||||||||||| |||||||||||||||||||| || || ||||||| |||   |
Sbjct: 126371 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacag 126312

                                                                    
Query: 304    gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
              ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 126311 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 126258



to top

>gb|AY158951.1| Mus musculus histone protein Hist1h3b gene, complete cds
          Length = 1411

 Score =  170 bits (86), Expect = 2e-39
 Identities = 152/174 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| ||||| |||||||| |||||||||||||||||||||||||||||||| | |
Sbjct: 907 gccctctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 848

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || || ||||||| ||||   
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 788

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 787 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 734



to top

>gb|AY158950.1| Mus musculus histone protein Hist1h3c gene, complete cds
          Length = 1408

 Score =  170 bits (86), Expect = 2e-39
 Identities = 152/174 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| | |
Sbjct: 907 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 848

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || || ||||||| ||||   
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 788

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 787 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaag 734



to top

>gb|AY158944.1| Mus musculus histone protein Hist1h3h gene, complete cds
          Length = 1408

 Score =  170 bits (86), Expect = 2e-39
 Identities = 152/174 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||||||||| || ||||||||||||||||||||||||||||| | |
Sbjct: 907 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 848

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || |||||||||| |||   |
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 788

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 787 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 734



to top

>gb|M32462.1|MUSHIS3D Mouse histone H3 (H3.1-291) gene, complete cds
          Length = 927

 Score =  170 bits (86), Expect = 2e-39
 Identities = 152/174 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||||||||| || ||||||||||||||||||||||||||||| | |
Sbjct: 745 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 686

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || |||||||||| |||   |
Sbjct: 685 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 626

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 625 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 572



to top

>emb|X79714.1|LTMRHIS3 L.temulentum mRNA for histone H3
          Length = 657

 Score =  167 bits (84), Expect = 3e-38
 Identities = 108/116 (93%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 446 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 387

                                                                   
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctg 311
           ||||| |||||||||||||| || |||||||||||||||| |||||| ||||||||
Sbjct: 386 gcgcacaggttggtgtcctcgaagagcccgacgaggtaggcctcggccgcctcctg 331



to top

>gb|BT018950.1| Zea mays clone Contig110.F mRNA sequence
          Length = 636

 Score =  165 bits (83), Expect = 1e-37
 Identities = 110/119 (92%)
 Strand = Plus / Plus

                                                                       
Query: 193 ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
           |||||||||||||| |||||||||||||||||||||||||||||||| | ||| ||||||
Sbjct: 146 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttagcgtgg 205

                                                                      
Query: 253 atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctg 311
           |||||||| |||||||||||||| || || ||||||||||||| |||||||||||||||
Sbjct: 206 atggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcggcctcctg 264



to top

>gb|BT017332.1| Zea mays clone EL01N0320H03.c mRNA sequence
          Length = 639

 Score =  163 bits (82), Expect = 5e-37
 Identities = 112/122 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||| ||||||||||||||||| | |||||||||||||
Sbjct: 394 cggatgcggcgggcgagctggatgtctttgggcatgatggtgacgcgcttggcgtggatg 335

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| ||||| ||||||||||||| ||||||||| ||||| |||
Sbjct: 334 gcgcagaggttggtgtcctcgaacaggccgacgaggtaggcctcggcggcttcctggagg 275

             
Query: 316 gc 317
           ||
Sbjct: 274 gc 273



to top

>gb|BT016934.1| Zea mays clone E04912703G10.c mRNA sequence
          Length = 663

 Score =  163 bits (82), Expect = 5e-37
 Identities = 151/174 (86%)
 Strand = Plus / Plus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || | ||||||||| |||||||||||||||||||||||||||||||||| |
Sbjct: 154 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgaccctc 213

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||| || ||||| || ||||| | ||| |||
Sbjct: 214 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtacgcctccgcg 273

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| || |  || || || |||||||| || ||||| |||||||||
Sbjct: 274 gcctcctgcagcgccgccaccgccgacgactggaaccgcaggtccgtcttgaag 327



to top

>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
            (LOC417953), mRNA
          Length = 2271

 Score =  163 bits (82), Expect = 5e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                        
Query: 184  gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
            |||||||| || ||||||||||| |||||||||||||||||||||||||||||||| | |
Sbjct: 2267 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 2208

                                                                        
Query: 244  ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
            ||||||||||||||||| |||||||||||||| || ||||| || ||||||| ||||   
Sbjct: 2207 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctc 2148

                                                                  
Query: 304  gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 2147 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaag 2094



to top

>ref|NM_145073.2| Mus musculus histone 1, H3g (Hist1h3g), mRNA
          Length = 492

 Score =  163 bits (82), Expect = 5e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || |||||||| || || ||||||||||||||||||||||||||||| | |
Sbjct: 435 gccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 376

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || |||||||||| |||   |
Sbjct: 375 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 316

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 315 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 262



to top

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score =  163 bits (82), Expect = 5e-37
 Identities = 151/174 (86%)
 Strand = Plus / Plus

                                                                         
Query: 184   gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
             |||||||| || |||||||| || || ||||||||||||||||||||||||||||| | |
Sbjct: 99526 gccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 99585

                                                                         
Query: 244   ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
             ||||||||||||||||| |||||||||||||||||||| || |||||||||| |||   |
Sbjct: 99586 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 99645

                                                                   
Query: 304   gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
             ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 99646 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 99699



 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Minus

                                                                         
Query: 196   cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
             ||||| ||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 73407 cggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 73348

                                                                         
Query: 256   gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
             ||||| |||||||||||||||||||| || |||||||||| ||||   ||||||||||| 
Sbjct: 73347 gcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcctcctgcaga 73288

                                                       
Query: 316   gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
             ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 73287 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 73246



 Score =  155 bits (78), Expect = 1e-34
 Identities = 150/174 (86%)
 Strand = Plus / Plus

                                                                         
Query: 184   gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
             |||||||| ||||| ||||| || || ||||||||||||||||||||||||||||| | |
Sbjct: 59170 gccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 59229

                                                                         
Query: 244   ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
             |||||||||||||| || |||||||||||||||||||| || |||||||||| ||||   
Sbjct: 59230 ttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 59289

                                                                   
Query: 304   gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
             ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 59290 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 59343



 Score =  147 bits (74), Expect = 3e-32
 Identities = 140/162 (86%)
 Strand = Plus / Plus

                                                                         
Query: 196   cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
             ||||| ||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 90499 cggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 90558

                                                                         
Query: 256   gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
             ||||| |||||||||||||||||||| || || ||||||| ||||   ||||||||||| 
Sbjct: 90559 gcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgcaga 90618

                                                       
Query: 316   gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
             ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 90619 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 90660



to top

>emb|CR716243.2|CNS0GFLO Tetraodon nigroviridis full-length cDNA
          Length = 844

 Score =  163 bits (82), Expect = 5e-37
 Identities = 124/138 (89%)
 Strand = Plus / Minus

                                                                       
Query: 180 ctaggccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgac 239
           |||||||||||| || |||||||||||||| ||||||||||| |||||||||||||||||
Sbjct: 648 ctaggccctctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtgac 589

                                                                       
Query: 240 ccccttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactc 299
           || |||||||||||||||||| |||||||||||||| ||||| || || ||||||| |||
Sbjct: 588 cctcttggcgtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaggcctc 529

                             
Query: 300 ggcggcctcctgcagggc 317
           |   ||||||||||||||
Sbjct: 528 gctcgcctcctgcagggc 511



to top

>emb|X80325.1|MPMPH315 M.pahari mpH315 gene
          Length = 974

 Score =  163 bits (82), Expect = 5e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||||||||| || ||||||||||||||||||||||||||||| | |
Sbjct: 588 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 529

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || || ||||||| |||   |
Sbjct: 528 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacag 469

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 468 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 415



to top

>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene
          Length = 8384

 Score =  163 bits (82), Expect = 5e-37
 Identities = 151/174 (86%)
 Strand = Plus / Plus

                                                                        
Query: 184  gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
            |||||||| || ||||||||||| |||||||||||||||||||||||||||||||| | |
Sbjct: 3348 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 3407

                                                                        
Query: 244  ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
            ||||||||||||||||| |||||||||||||| || ||||| || ||||||| ||||   
Sbjct: 3408 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctc 3467

                                                                  
Query: 304  gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 3468 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaag 3521



to top

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
             novel gene, the genes for three H1, four H2a, five H2b,
             four H3 and four H4 histone family members, the 3' end of
             a variant of the Hfe gene for hemochromatosis protein
             (Mr2) and ten CpG islands, complete sequence
          Length = 184730

 Score =  163 bits (82), Expect = 5e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                         
Query: 184   gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
             |||||||| || |||||||| || || ||||||||||||||||||||||||||||| | |
Sbjct: 16454 gccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 16395

                                                                         
Query: 244   ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
             ||||||||||||||||| |||||||||||||||||||| || |||||||||| |||   |
Sbjct: 16394 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 16335

                                                                   
Query: 304   gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
             ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 16334 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 16281



 Score =  155 bits (78), Expect = 1e-34
 Identities = 150/174 (86%)
 Strand = Plus / Minus

                                                                         
Query: 184   gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
             |||||||| ||||| ||||| || || ||||||||||||||||||||||||||||| | |
Sbjct: 56814 gccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 56755

                                                                         
Query: 244   ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
             |||||||||||||| || |||||||||||||||||||| || |||||||||| ||||   
Sbjct: 56754 ttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 56695

                                                                   
Query: 304   gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
             ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 56694 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 56641



 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Plus

                                                                         
Query: 196   cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
             ||||| ||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 42577 cggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 42636

                                                                         
Query: 256   gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
             ||||| |||||||||||||||||||| || |||||||||| ||||   ||||||||||| 
Sbjct: 42637 gcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcctcctgcaga 42696

                                                       
Query: 316   gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
             ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 42697 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 42738



 Score =  147 bits (74), Expect = 3e-32
 Identities = 140/162 (86%)
 Strand = Plus / Minus

                                                                         
Query: 196   cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
             ||||| ||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 25481 cggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 25422

                                                                         
Query: 256   gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
             ||||| |||||||||||||||||||| || || ||||||| ||||   ||||||||||| 
Sbjct: 25421 gcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgcaga 25362

                                                       
Query: 316   gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
             ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 25361 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 25320



to top

>dbj|AB205017.1| Lolium multiflorum gene for replacement histone H3, exon 1-2,
           complete cds
          Length = 784

 Score =  163 bits (82), Expect = 5e-37
 Identities = 121/134 (90%)
 Strand = Plus / Minus

                                                                       
Query: 178 gcctaggccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtg 237
           |||||||| | ||| || ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 577 gcctaggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 518

                                                                       
Query: 238 acccccttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggac 297
           || | |||||||||||||||||| |||||||||||||| || || ||||||||||||| |
Sbjct: 517 acgcgcttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcc 458

                         
Query: 298 tcggcggcctcctg 311
           ||||| ||||||||
Sbjct: 457 tcggccgcctcctg 444



to top

>ref|XM_694120.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570618), mRNA
          Length = 411

 Score =  163 bits (82), Expect = 5e-37
 Identities = 115/126 (91%)
 Strand = Plus / Minus

                                                                       
Query: 189 ctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggc 248
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||
Sbjct: 402 ctctccacggatgcggcgagccagctggatgtccttgggcatgatggtgaccctcttggc 343

                                                                       
Query: 249 gtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctc 308
           |||||||||||| |||||||||||||| ||||| ||||| || || | ||||  ||||||
Sbjct: 342 gtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctggcctc 283

                 
Query: 309 ctgcag 314
           ||||||
Sbjct: 282 ctgcag 277



to top

>gb|AY158946.1| Mus musculus histone protein Hist1h3g gene, complete cds
          Length = 1405

 Score =  163 bits (82), Expect = 5e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || |||||||| || || ||||||||||||||||||||||||||||| | |
Sbjct: 904 gccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 845

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || |||||||||| |||   |
Sbjct: 844 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 785

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 784 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 731



to top

>emb|X01684.1|MMHISH31 Mouse gene (H3.1) for histone H3
          Length = 1244

 Score =  163 bits (82), Expect = 5e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || |||||||| || || ||||||||||||||||||||||||||||| | |
Sbjct: 759 gccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 700

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || |||||||||| |||   |
Sbjct: 699 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 640

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 639 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 586



to top

>gb|M33989.1|MUSH2AX1X Mouse histone H3.2 gene, complete cds
          Length = 693

 Score =  163 bits (82), Expect = 5e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| ||||| |||||||| |||||||||||||||||||||||||||||||| | |
Sbjct: 557 gccctctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 498

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || || ||||||| ||||   
Sbjct: 497 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 438

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 437 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaag 384



to top

>gb|M32460.1|MUSHIS3B Mouse histone H3 (H3.1-221) gene, complete cds
          Length = 1125

 Score =  163 bits (82), Expect = 5e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || |||||||| || || ||||||||||||||||||||||||||||| | |
Sbjct: 759 gccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 700

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || |||||||||| |||   |
Sbjct: 699 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 640

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 639 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 586



to top

>emb|Z30939.1|MDH3HIST Mus domesticus partial mRNA for histone H3, CD-1
          Length = 287

 Score =  161 bits (81), Expect = 2e-36
 Identities = 150/173 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| ||||| ||||| || || ||||||||||||||||||||||||||||| | |
Sbjct: 173 gccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 114

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || |||||||||| ||||   
Sbjct: 113 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 54

                                                                
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaa 356
           ||||||||||| ||    ||||| |||  ||||||||| ||||||||||||||
Sbjct: 53  gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaa 1



to top

>dbj|AB185026.1| Conocephalum conicum H3 gene for histone 3, complete cds, clone:
           T135
          Length = 473

 Score =  161 bits (81), Expect = 2e-36
 Identities = 138/157 (87%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 457 cggatgcggcgggccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 398

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || || ||||| ||||||| ||| |  ||||||||||||
Sbjct: 397 gcgcagaggttggtgtcctcgaagaggccgaccaggtaggcctcagacgcctcctgcagg 338

                                                
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtct 352
           ||    ||||| |||||||||||||| ||||||||||
Sbjct: 337 gccagcacggccgaggactggaagcgcaggtcggtct 301



to top

>dbj|AB185023.1| Conocephalum conicum H3 gene for histone 3, complete cds, clone:
           T117
          Length = 474

 Score =  161 bits (81), Expect = 2e-36
 Identities = 138/157 (87%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 458 cggatgcggcgggccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 399

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || || ||||| ||||||| ||| |  ||||||||||||
Sbjct: 398 gcgcagaggttggtgtcctcgaagaggccgaccaggtaggcctcagacgcctcctgcagg 339

                                                
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtct 352
           ||    ||||| |||||||||||||| ||||||||||
Sbjct: 338 gccagcacggccgaggactggaagcgcaggtcggtct 302



to top

>ref|XM_545420.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488298), mRNA
          Length = 411

 Score =  159 bits (80), Expect = 7e-36
 Identities = 152/176 (86%)
 Strand = Plus / Minus

                                                                       
Query: 182 aggccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccc 241
           |||||||||| || ||||||||||| || ||||||||||||||||||||||||||||| |
Sbjct: 409 aggccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgc 350

                                                                       
Query: 242 ccttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcgg 301
            |||||||||||||||||| |||||||||||||| || ||||| || ||||||| |||| 
Sbjct: 349 gcttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgc 290

                                                                   
Query: 302 cggcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
             ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 289 acgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaag 234



to top

>ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 3 (LOC480760), mRNA
          Length = 862

 Score =  157 bits (79), Expect = 3e-35
 Identities = 151/175 (86%)
 Strand = Plus / Minus

                                                                       
Query: 183 ggccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccc 242
           ||||||||| || ||||||||||| || ||||||||||||||||||||||||||||| | 
Sbjct: 408 ggccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcg 349

                                                                       
Query: 243 cttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggc 302
           |||||||||||||||||| |||||||||||||| || ||||| || ||||||| ||||  
Sbjct: 348 cttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgca 289

                                                                  
Query: 303 ggcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 288 cgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaag 234



to top

>ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 1 (LOC480760), mRNA
          Length = 1422

 Score =  157 bits (79), Expect = 3e-35
 Identities = 151/175 (86%)
 Strand = Plus / Minus

                                                                       
Query: 183 ggccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccc 242
           ||||||||| || ||||||||||| || ||||||||||||||||||||||||||||| | 
Sbjct: 408 ggccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcg 349

                                                                       
Query: 243 cttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggc 302
           |||||||||||||||||| |||||||||||||| || ||||| || ||||||| ||||  
Sbjct: 348 cttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgca 289

                                                                  
Query: 303 ggcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 288 cgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaag 234



to top

>gb|U38422.1|TAU38422 Triticum aestivum histone H3 gene, partial cds, clone W1
          Length = 479

 Score =  157 bits (79), Expect = 3e-35
 Identities = 130/147 (88%)
 Strand = Plus / Minus

                                                                       
Query: 211 agctggatgtccttgggcatgatggtgacccccttggcgtggatggcgcaaaggttggtg 270
           ||||||||||||||||||||||||||||| | |||||||||||||||||| |||||||||
Sbjct: 479 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 420

                                                                       
Query: 271 tcctcaaacagcccgacgaggtaggactcggcggcctcctgcagggcggaaacggcggag 330
           ||||| |||||||| || ||||| | |||||| |||||||| |||||    ||||||  |
Sbjct: 419 tcctcgaacagccccaccaggtacgcctcggccgcctcctggagggccagcacggcgtgg 360

                                      
Query: 331 gactggaagcggaggtcggtcttgaag 357
           ||||||||||||||||| |||||||||
Sbjct: 359 gactggaagcggaggtccgtcttgaag 333



to top

>gb|BC107285.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMAGE:40053006),
           partial cds
          Length = 417

 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||| ||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 393 cggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 334

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||||||||| || |||||||||| |||   |||||||||||| 
Sbjct: 333 gcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctcctgcaga 274

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 273 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 232



to top

>ref|NM_178205.1| Mus musculus histone 1, H3e (Hist1h3e), mRNA
          Length = 411

 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||| ||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 395 cggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 336

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||||||||| || |||||||||| ||||   ||||||||||| 
Sbjct: 335 gcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcctcctgcaga 276

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 275 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 234



to top

>ref|NM_178204.1| Mus musculus histone1, H3d (Hist1h3d), mRNA
          Length = 411

 Score =  155 bits (78), Expect = 1e-34
 Identities = 150/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| ||||| ||||| || || ||||||||||||||||||||||||||||| | |
Sbjct: 407 gccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           |||||||||||||| || |||||||||||||||||||| || |||||||||| ||||   
Sbjct: 347 ttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 288

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 287 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 234



to top

>gb|L19706.1| Rattus norvegicus H3 histone gene, complete cds
          Length = 2040

 Score =  155 bits (78), Expect = 1e-34
 Identities = 150/174 (86%)
 Strand = Plus / Minus

                                                                        
Query: 184  gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
            |||||||| ||||| |||||||| || |||||||||||||||||||||||||| || | |
Sbjct: 1923 gccctctcgccacgaatgcggcgggccagctggatgtccttgggcatgatggtcacacgc 1864

                                                                        
Query: 244  ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
            ||||||||||||||||| |||||||||||||||||||| || || ||||||| |||   |
Sbjct: 1863 ttggcgtggatggcgcataggttggtgtcctcaaacagacccacaaggtaggcctcacag 1804

                                                                  
Query: 304  gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 1803 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaag 1750



to top

>ref|XM_425464.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
           (LOC427890), mRNA
          Length = 600

 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 584 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 525

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || ||||| || ||||||| ||||   ||||||||||| 
Sbjct: 524 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 465

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 464 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 423



to top

>ref|XM_416198.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417958),
           mRNA
          Length = 1512

 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Plus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 584 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 643

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || ||||| || ||||||| ||||   ||||||||||| 
Sbjct: 644 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 703

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 704 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 745



to top

>ref|XM_416190.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417949),
           mRNA
          Length = 752

 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Plus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 329 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 388

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || ||||| || ||||||| ||||   ||||||||||| 
Sbjct: 389 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 448

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 449 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 490



to top

>ref|XM_416186.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417945),
           mRNA
          Length = 972

 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Plus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 392 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 451

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || ||||| || ||||||| ||||   ||||||||||| 
Sbjct: 452 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 511

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 512 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 553



to top

>ref|XM_849194.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611519), mRNA
          Length = 471

 Score =  155 bits (78), Expect = 1e-34
 Identities = 150/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||||||||| || ||||||||||||||||||||||||||||| | |
Sbjct: 467 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 408

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||| || ||||| || ||||||| ||||   
Sbjct: 407 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 348

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 347 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaag 294



to top

>ref|XM_545399.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488277), mRNA
          Length = 411

 Score =  155 bits (78), Expect = 1e-34
 Identities = 150/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||||||||| || ||||||||||||||||||||||||||||| | |
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||| || ||||| || ||||||| ||||   
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaag 234



to top

>ref|XM_545397.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488275), mRNA
          Length = 459

 Score =  155 bits (78), Expect = 1e-34
 Identities = 150/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||||||||| || ||||||||||||||||||||||||||||| | |
Sbjct: 455 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 396

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||| || ||||| || ||||||| ||||   
Sbjct: 395 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 336

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 335 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaag 282



to top

>ref|XM_848782.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611138), mRNA
          Length = 411

 Score =  155 bits (78), Expect = 1e-34
 Identities = 150/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||||||||| || ||||||||||||||||||||||||||||| | |
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||| || ||||| || ||||||| ||||   
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaag 234



to top

>ref|XM_545429.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488307), mRNA
          Length = 411

 Score =  155 bits (78), Expect = 1e-34
 Identities = 150/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||||||||| || ||||||||||||||||||||||||||||| | |
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||| || ||||| || ||||||| ||||   
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaag 234



to top

>ref|XM_545385.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488263), mRNA
          Length = 411

 Score =  155 bits (78), Expect = 1e-34
 Identities = 150/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||||||||| || ||||||||||||||||||||||||||||| | |
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||| || ||||| || ||||||| ||||   
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaag 234



to top

>emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, histone H3 and histone H1.1
          Length = 5597

 Score =  155 bits (78), Expect = 1e-34
 Identities = 150/174 (86%)
 Strand = Plus / Plus

                                                                        
Query: 184  gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
            |||||||| || ||||||||||| || || |||||||||||||||||||||||||| | |
Sbjct: 2130 gccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgc 2189

                                                                        
Query: 244  ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
            ||||||||||||||||| |||||||||||||||||||| || || ||||||| |||   |
Sbjct: 2190 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacag 2249

                                                                  
Query: 304  gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 2250 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 2303



to top

>emb|X80324.1|MPMPH3110 M.pahari mpH3110 gene
          Length = 990

 Score =  155 bits (78), Expect = 1e-34
 Identities = 150/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||||||||| || |||||||||||||| |||||||||||||| | |
Sbjct: 847 gccctctccccgcggatgcggcgggccagctggatgtccttaggcatgatggtgacacgc 788

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || || ||||||| |||   |
Sbjct: 787 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacag 728

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 727 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 674



to top

>emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes
          Length = 4717

 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Minus

                                                                        
Query: 196  cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
            ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 3230 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 3171

                                                                        
Query: 256  gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
            ||||| |||||||||||||| || ||||| || ||||||| ||||   ||||||||||| 
Sbjct: 3170 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 3111

                                                      
Query: 316  gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 3110 gccatcacggccgagctctggaagcgcaggtcggtcttgaag 3069



 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Plus

                                                                        
Query: 196  cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
            ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 1491 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 1550

                                                                        
Query: 256  gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
            ||||| |||||||||||||| || ||||| || ||||||| ||||   ||||||||||| 
Sbjct: 1551 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 1610

                                                      
Query: 316  gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 1611 gccatcacggccgagctctggaagcgcaggtcggtcttgaag 1652



to top

>gb|DQ393956.1| Cydia pomonella clone Cp4.140 microsatellite sequence
          Length = 517

 Score =  155 bits (78), Expect = 1e-34
 Identities = 135/154 (87%)
 Strand = Plus / Plus

                                                                       
Query: 204 gcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatggcgcaaag 263
           |||||| ||||||||||||||||||||||||||||| | |||||||||||||||||| ||
Sbjct: 140 gcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacag 199

                                                                       
Query: 264 gttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagggcggaaac 323
           |||||||||||| || || ||||||||||| | ||||  ||||||||| || ||   |||
Sbjct: 200 gttggtgtcctcgaagagaccgacgaggtaagcctcgctggcctcctggagagccataac 259

                                             
Query: 324 ggcggaggactggaagcggaggtcggtcttgaag 357
           |||||||  ||||||||| |||||||||||||||
Sbjct: 260 ggcggagctctggaagcgcaggtcggtcttgaag 293



to top

>gb|DQ393939.1| Cydia pomonella clone Cp4.P microsatellite sequence
          Length = 517

 Score =  155 bits (78), Expect = 1e-34
 Identities = 135/154 (87%)
 Strand = Plus / Minus

                                                                       
Query: 204 gcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatggcgcaaag 263
           |||||| ||||||||||||||||||||||||||||| | |||||||||||||||||| ||
Sbjct: 378 gcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacag 319

                                                                       
Query: 264 gttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagggcggaaac 323
           |||||||||||| || || ||||||||||| | ||||  ||||||||| || ||   |||
Sbjct: 318 gttggtgtcctcgaagagaccgacgaggtaagcctcgctggcctcctggagagccataac 259

                                             
Query: 324 ggcggaggactggaagcggaggtcggtcttgaag 357
           |||||||  ||||||||| |||||||||||||||
Sbjct: 258 ggcggagctctggaagcgcaggtcggtcttgaag 225



to top

>gb|DQ393935.1| Cydia pomonella clone Cp4.118 microsatellite sequence
          Length = 438

 Score =  155 bits (78), Expect = 1e-34
 Identities = 135/154 (87%)
 Strand = Plus / Plus

                                                                       
Query: 204 gcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatggcgcaaag 263
           |||||| ||||||||||||||||||||||||||||| | |||||||||||||||||| ||
Sbjct: 61  gcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacag 120

                                                                       
Query: 264 gttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagggcggaaac 323
           |||||||||||| || || ||||||||||| | ||||  ||||||||| || ||   |||
Sbjct: 121 gttggtgtcctcgaagagaccgacgaggtaagcctcgctggcctcctggagagccataac 180

                                             
Query: 324 ggcggaggactggaagcggaggtcggtcttgaag 357
           |||||||  ||||||||| |||||||||||||||
Sbjct: 181 ggcggagctctggaagcgcaggtcggtcttgaag 214



to top

>gb|DQ393934.1| Cydia pomonella clone Cp4.100 microsatellite sequence
          Length = 490

 Score =  155 bits (78), Expect = 1e-34
 Identities = 135/154 (87%)
 Strand = Plus / Plus

                                                                       
Query: 204 gcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatggcgcaaag 263
           |||||| ||||||||||||||||||||||||||||| | |||||||||||||||||| ||
Sbjct: 114 gcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacag 173

                                                                       
Query: 264 gttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagggcggaaac 323
           |||||||||||| || || ||||||||||| | ||||  ||||||||| || ||   |||
Sbjct: 174 gttggtgtcctcgaagagaccgacgaggtaagcctcgctggcctcctggagagccataac 233

                                             
Query: 324 ggcggaggactggaagcggaggtcggtcttgaag 357
           |||||||  ||||||||| |||||||||||||||
Sbjct: 234 ggcggagctctggaagcgcaggtcggtcttgaag 267



to top

>gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016
          Length = 2110

 Score =  155 bits (78), Expect = 1e-34
 Identities = 150/174 (86%)
 Strand = Plus / Minus

                                                                        
Query: 184  gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
            |||||||| ||||| ||||| || || ||||||||||||||||||||||||||||| | |
Sbjct: 2008 gccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 1949

                                                                        
Query: 244  ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
            |||||||||||||| || |||||||||||||||||||| || |||||||||| ||||   
Sbjct: 1948 ttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 1889

                                                                  
Query: 304  gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 1888 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 1835



to top

>gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108
          Length = 2221

 Score =  155 bits (78), Expect = 1e-34
 Identities = 150/174 (86%)
 Strand = Plus / Minus

                                                                        
Query: 184  gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
            |||||||| ||||| ||||| || || ||||||||||||||||||||||||||||| | |
Sbjct: 2006 gccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 1947

                                                                        
Query: 244  ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
            |||||||||||||| || |||||||||||||||||||| || |||||||||| ||||   
Sbjct: 1946 ttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 1887

                                                                  
Query: 304  gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 1886 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 1833



to top

>dbj|AK006742.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700049H14 product:H3 HISTONE homolog
           [Rattus norvegicus], full insert sequence
          Length = 514

 Score =  155 bits (78), Expect = 1e-34
 Identities = 150/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||||||||| || || |||||||||||||||||||||||||| | |
Sbjct: 420 gccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgc 361

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || || ||||||| |||   |
Sbjct: 360 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacag 301

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 300 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 247



to top

>emb|CR390239.1| Gallus gallus finished cDNA, clone ChEST932d15
          Length = 578

 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Plus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 148 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 207

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || ||||| || ||||||| ||||   ||||||||||| 
Sbjct: 208 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 267

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 268 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 309



to top

>gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and histone H4-D (H4-D) genes,
           complete cds
          Length = 2321

 Score =  155 bits (78), Expect = 1e-34
 Identities = 150/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||||||||| || || |||||||||||||||||||||||||| | |
Sbjct: 758 gccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgc 699

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || || ||||||| |||   |
Sbjct: 698 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacag 639

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 638 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 585



to top

>gb|U62671.1|MMU62671 Mus musculus histone H3.2-B (H3-B) gene, complete cds
          Length = 1100

 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||| ||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 881 cggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 822

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||||||||| || |||||||||| ||||   ||||||||||| 
Sbjct: 821 gcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcctcctgcaga 762

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 761 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 720



to top

>gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone H2a.1-F (H2a-F),
           histone H2b-F (H2b-F) genes, complete cds
          Length = 2822

 Score =  155 bits (78), Expect = 1e-34
 Identities = 150/174 (86%)
 Strand = Plus / Plus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| ||||| ||||| || || ||||||||||||||||||||||||||||| | |
Sbjct: 91  gccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 150

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           |||||||||||||| || |||||||||||||||||||| || |||||||||| ||||   
Sbjct: 151 ttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 210

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 211 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 264



to top

>gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, complete sequence
          Length = 211945

 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Plus

                                                                          
Query: 196    cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
              ||||||||||| || ||||||||||| ||||||||||||||||||| |||||||||||||
Sbjct: 102364 cggatgcggcgggccagctggatgtctttgggcatgatggtgacccgcttggcgtggatg 102423

                                                                          
Query: 256    gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
              ||||| |||||||||||||| ||||| || || ||||| | ||||  || ||||||||||
Sbjct: 102424 gcgcacaggttggtgtcctcgaacaggcccaccaggtaagcctcgctggactcctgcagg 102483

                                                        
Query: 316    gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
              ||    |||||||||  ||||||||| |||||||||||||||
Sbjct: 102484 gccatgacggcggagctctggaagcgcaggtcggtcttgaag 102525



to top

>ref|NM_001013056.1| Rattus norvegicus histone 1, H2ai (predicted)
           (Hist1h2ai_predicted), mRNA
          Length = 411

 Score =  155 bits (78), Expect = 1e-34
 Identities = 150/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| ||||| |||||||| || |||||||||||||||||||||||||| || | |
Sbjct: 407 gccctctcgccacgaatgcggcgggccagctggatgtccttgggcatgatggtcacacgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || || ||||||| |||   |
Sbjct: 347 ttggcgtggatggcgcataggttggtgtcctcaaacagacccacaaggtaggcctcacag 288

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaag 234



to top

>gb|AY158952.1| Mus musculus histone protein Hist1h3a gene, complete cds
          Length = 1408

 Score =  155 bits (78), Expect = 1e-34
 Identities = 150/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||||||||| || || |||||||||||||||||||||||||| | |
Sbjct: 907 gccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgc 848

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || || ||||||| |||   |
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacag 788

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 787 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 734



to top

>gb|AY158949.1| Mus musculus histone protein Hist1h3d gene, complete cds
          Length = 2249

 Score =  155 bits (78), Expect = 1e-34
 Identities = 150/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| ||||| ||||| || || ||||||||||||||||||||||||||||| | |
Sbjct: 946 gccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 887

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           |||||||||||||| || |||||||||||||||||||| || |||||||||| ||||   
Sbjct: 886 ttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 827

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 826 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 773



to top

>gb|AY158948.1| Mus musculus histone protein Hist1h3e gene, complete cds
          Length = 1408

 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||| ||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 895 cggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 836

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||||||||| || |||||||||| ||||   ||||||||||| 
Sbjct: 835 gcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcctcctgcaga 776

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 775 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 734



to top

>emb|X62291.1|GGHISH3IV G.gallus gene for histone H3-IV
          Length = 1094

 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 809 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 750

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || ||||| || ||||||| ||||   ||||||||||| 
Sbjct: 749 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 690

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 689 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 648



to top

>gb|U37579.1|GGU37579 Gallus gallus histone H3-VIII gene, complete cds
          Length = 1809

 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 866 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 807

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || ||||| || ||||||| ||||   ||||||||||| 
Sbjct: 806 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 747

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 746 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 705



to top

>gb|U37577.1|GGU37577 Gallus gallus histone H3-VI gene, complete cds
          Length = 1271

 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 679 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 620

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || ||||| || ||||||| ||||   ||||||||||| 
Sbjct: 619 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 560

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 559 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 518



to top

>gb|M61154.1|CHKH3AA Chicken histone H3 gene, complete cds
          Length = 784

 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 748 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 689

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || ||||| || ||||||| ||||   ||||||||||| 
Sbjct: 688 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 629

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 628 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 587



to top

>gb|AY181030.1| Toxoplasma gondii histone H3 mRNA, complete cds
          Length = 411

 Score =  153 bits (77), Expect = 5e-34
 Identities = 143/165 (86%)
 Strand = Plus / Minus

                                                                       
Query: 193 ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
           ||||||||||||||||||||||| ||||||||||||||||||||||| | ||||||||||
Sbjct: 398 ccacggatgcggcgagcgagctgaatgtccttgggcatgatggtgacacgcttggcgtgg 339

                                                                       
Query: 253 atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
           |||||||| | |||||||||||| || |||||||||||||| | ||| ||||| ||||| 
Sbjct: 338 atggcgcacaagttggtgtcctcgaagagcccgacgaggtaagcctcagcggcttcctgg 279

                                                        
Query: 313 agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           || ||    || ||||| |||||||| || || ||||||||||||
Sbjct: 278 agagcaaggacagcggacgactggaaacgcagatcggtcttgaag 234



to top

>gb|BC097059.1| Danio rerio zgc:113983, mRNA (cDNA clone MGC:113983 IMAGE:7226638),
           complete cds
          Length = 1331

 Score =  151 bits (76), Expect = 2e-33
 Identities = 115/128 (89%)
 Strand = Plus / Minus

                                                                       
Query: 190 tctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcg 249
           ||||||||||||||||| || ||||||||||| ||||||||||||||||||| |||||||
Sbjct: 446 tctccacggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggcg 387

                                                                       
Query: 250 tggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcc 309
           ||||||||||| |||||||||||| | ||||| |||||||| || | ||||  |||||||
Sbjct: 386 tggatggcgcacaggttggtgtccccgaacagaccgacgagataagcctcgctggcctcc 327

                   
Query: 310 tgcagggc 317
           ||||||||
Sbjct: 326 tgcagggc 319



to top

>ref|NM_001025171.1| Danio rerio zgc:113983 (zgc:113983), mRNA
          Length = 1331

 Score =  151 bits (76), Expect = 2e-33
 Identities = 115/128 (89%)
 Strand = Plus / Minus

                                                                       
Query: 190 tctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcg 249
           ||||||||||||||||| || ||||||||||| ||||||||||||||||||| |||||||
Sbjct: 446 tctccacggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggcg 387

                                                                       
Query: 250 tggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcc 309
           ||||||||||| |||||||||||| | ||||| |||||||| || | ||||  |||||||
Sbjct: 386 tggatggcgcacaggttggtgtccccgaacagaccgacgagataagcctcgctggcctcc 327

                   
Query: 310 tgcagggc 317
           ||||||||
Sbjct: 326 tgcagggc 319



to top

>gb|BC033095.1| Homo sapiens histone 1, H3d, mRNA (cDNA clone MGC:45669
           IMAGE:5440523), complete cds
          Length = 1362

 Score =  149 bits (75), Expect = 7e-33
 Identities = 117/131 (89%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| ||||| ||||||||||| ||||||||||||||||||||||| || || | |
Sbjct: 417 gccctctccccacgaatgcggcgagcaagctggatgtccttgggcatgatagtcactcgc 358

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           |||||||| |||||||| ||||||||||||||||||||||| || ||||||| ||||  |
Sbjct: 357 ttggcgtgaatggcgcataggttggtgtcctcaaacagccccaccaggtaggcctcgcag 298

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 297 gcctcctgcag 287



to top

>gb|BC031333.1| Homo sapiens histone 1, H3d, mRNA (cDNA clone MGC:45668
           IMAGE:3608479), complete cds
          Length = 890

 Score =  149 bits (75), Expect = 7e-33
 Identities = 117/131 (89%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| ||||| ||||||||||| ||||||||||||||||||||||| || || | |
Sbjct: 780 gccctctccccacgaatgcggcgagcaagctggatgtccttgggcatgatagtcactcgc 721

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           |||||||| |||||||| ||||||||||||||||||||||| || ||||||| ||||  |
Sbjct: 720 ttggcgtgaatggcgcataggttggtgtcctcaaacagccccaccaggtaggcctcgcag 661

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 660 gcctcctgcag 650



to top

>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on chromosome 6
          Length = 269712

 Score =  149 bits (75), Expect = 7e-33
 Identities = 117/131 (89%)
 Strand = Plus / Plus

                                                                          
Query: 184    gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
              |||||||| ||||| ||||||||||| ||||||||||||||||||||||| || || | |
Sbjct: 180844 gccctctccccacgaatgcggcgagcaagctggatgtccttgggcatgatagtcactcgc 180903

                                                                          
Query: 244    ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
              |||||||| |||||||| ||||||||||||||||||||||| || ||||||| ||||  |
Sbjct: 180904 ttggcgtgaatggcgcataggttggtgtcctcaaacagccccaccaggtaggcctcgcag 180963

                         
Query: 304    gcctcctgcag 314
              |||||||||||
Sbjct: 180964 gcctcctgcag 180974



 Score =  141 bits (71), Expect = 2e-30
 Identities = 116/131 (88%)
 Strand = Plus / Minus

                                                                        
Query: 184  gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
            ||||||||||| ||||||||||| |||||||||||||||||||||||||| ||||| | |
Sbjct: 4838 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 4779

                                                                        
Query: 244  ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
            ||||||||||||||||| ||||| ||||||||||| ||||| || | ||||| ||||   
Sbjct: 4778 ttggcgtggatggcgcacaggttagtgtcctcaaatagccctaccaagtaggcctcgcac 4719

                       
Query: 304  gcctcctgcag 314
            |||||||||||
Sbjct: 4718 gcctcctgcag 4708



 Score =  139 bits (70), Expect = 7e-30
 Identities = 148/174 (85%)
 Strand = Plus / Plus

                                                                          
Query: 184    gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
              ||||||||||| || ||||||||||||||||||||||||||||||||||| || || | |
Sbjct: 234199 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 234258

                                                                          
Query: 244    ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
              ||||||||||| || || ||||||||||||||||| ||||| || ||||| | ||||  |
Sbjct: 234259 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 234318

                                                                    
Query: 304    gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
              ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 234319 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaag 234372



 Score =  109 bits (55), Expect = 6e-21
 Identities = 112/131 (85%)
 Strand = Plus / Plus

                                                                          
Query: 187    ctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttg 246
              ||||| ||||| ||||||||||||||||| ||||||||||||||||| || || | ||| 
Sbjct: 254981 ctctccccacgaatgcggcgagcgagctgaatgtccttgggcatgatagtcactcgctta 255040

                                                                          
Query: 247    gcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcc 306
              || |||||||| || |||||||| |||||||| ||||| || | ||||| ||||  ||||
Sbjct: 255041 gcatggatggcacacaggttggtatcctcaaagagccccaccaagtaggcctcgcaggcc 255100

                         
Query: 307    tcctgcagggc 317
              |||||||||||
Sbjct: 255101 tcctgcagggc 255111



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 83/95 (87%)
 Strand = Plus / Plus

                                                                         
Query: 190   tctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcg 249
             ||||| || ||||||||||||||||||||||| |||||||| || || || | ||| || 
Sbjct: 15602 tctccgcgaatgcggcgagcgagctggatgtctttgggcataatagtcactcgcttagca 15661

                                                
Query: 250   tggatggcgcaaaggttggtgtcctcaaacagccc 284
             ||||||||||||||||| ||||||||||| |||||
Sbjct: 15662 tggatggcgcaaaggtttgtgtcctcaaagagccc 15696



 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 142/174 (81%)
 Strand = Plus / Minus

                                                                          
Query: 184    gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
              |||||||| ||||| |||||||| || ||||||||||| || ||||||||||| || |  
Sbjct: 209561 gccctctccccacgaatgcggcgggcaagctggatgtctttaggcatgatggtcacgcgt 209502

                                                                          
Query: 244    ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
              ||||| || || ||||| |||||||||||||| || ||||| || | ||||| ||||  |
Sbjct: 209501 ttggcatgaatagcgcacaggttggtgtcctcgaaaagccccaccaagtaggcctcgcag 209442

                                                                    
Query: 304    gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
              ||||||||||| ||    || |||||   ||||||||| |||||||||||||||
Sbjct: 209441 gcctcctgcagcgccatcaccgcggaactctggaagcgcaggtcggtcttgaag 209388



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                         
Query: 184   gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
             ||||| || ||||||||||| || || |||||||| || ||||||||||||||||| |  
Sbjct: 29759 gccctttccccacggatgcgacgtgccagctggatatctttgggcatgatggtgacgcgt 29700

                                          
Query: 244   ttggcgtggatggcgcaaaggttggtgtc 272
             || ||||| || ||||| || ||||||||
Sbjct: 29699 ttagcgtgaatagcgcacagattggtgtc 29671



to top

>ref|NM_003530.3| Homo sapiens histone 1, H3d (HIST1H3D), mRNA
          Length = 864

 Score =  149 bits (75), Expect = 7e-33
 Identities = 117/131 (89%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| ||||| ||||||||||| ||||||||||||||||||||||| || || | |
Sbjct: 804 gccctctccccacgaatgcggcgagcaagctggatgtccttgggcatgatagtcactcgc 745

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           |||||||| |||||||| ||||||||||||||||||||||| || ||||||| ||||  |
Sbjct: 744 ttggcgtgaatggcgcataggttggtgtcctcaaacagccccaccaggtaggcctcgcag 685

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 684 gcctcctgcag 674



to top

>ref|XM_848810.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611167), mRNA
          Length = 504

 Score =  149 bits (75), Expect = 7e-33
 Identities = 147/171 (85%)
 Strand = Plus / Minus

                                                                       
Query: 187 ctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttg 246
           ||||| || ||||||||||| || ||||||||||||||||||||||||||||| | ||||
Sbjct: 497 ctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttg 438

                                                                       
Query: 247 gcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcc 306
           |||||||||||||| |||||||||||||| || ||||| || ||||||| ||||   |||
Sbjct: 437 gcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcc 378

                                                              
Query: 307 tcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           |||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 377 tcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaag 327



to top

>gb|AF531277.1| Homo sapiens histone H3 (HIST1H3D) gene, complete cds
          Length = 1227

 Score =  149 bits (75), Expect = 7e-33
 Identities = 117/131 (89%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| ||||| ||||||||||| ||||||||||||||||||||||| || || | |
Sbjct: 816 gccctctccccacgaatgcggcgagcaagctggatgtccttgggcatgatagtcactcgc 757

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           |||||||| |||||||| ||||||||||||||||||||||| || ||||||| ||||  |
Sbjct: 756 ttggcgtgaatggcgcataggttggtgtcctcaaacagccccaccaggtaggcctcgcag 697

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 696 gcctcctgcag 686



to top

>emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 on chromosome 6p21.31-22.2
            Contains seventeen histone (pseudo)genes and gene RPS10P1
            (40S Ribosomal protein S10 pseudogene 1), three CpG
            islands, ESTs, STSs and GSSs, complete sequence
          Length = 89301

 Score =  149 bits (75), Expect = 7e-33
 Identities = 117/131 (89%)
 Strand = Plus / Plus

                                                                        
Query: 184  gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
            |||||||| ||||| ||||||||||| ||||||||||||||||||||||| || || | |
Sbjct: 2226 gccctctccccacgaatgcggcgagcaagctggatgtccttgggcatgatagtcactcgc 2285

                                                                        
Query: 244  ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
            |||||||| |||||||| ||||||||||||||||||||||| || ||||||| ||||  |
Sbjct: 2286 ttggcgtgaatggcgcataggttggtgtcctcaaacagccccaccaggtaggcctcgcag 2345

                       
Query: 304  gcctcctgcag 314
            |||||||||||
Sbjct: 2346 gcctcctgcag 2356



 Score =  139 bits (70), Expect = 7e-30
 Identities = 148/174 (85%)
 Strand = Plus / Plus

                                                                         
Query: 184   gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
             ||||||||||| || ||||||||||||||||||||||||||||||||||| || || | |
Sbjct: 55581 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 55640

                                                                         
Query: 244   ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
             ||||||||||| || || ||||||||||||||||| ||||| || ||||| | ||||  |
Sbjct: 55641 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 55700

                                                                   
Query: 304   gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
             ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 55701 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaag 55754



 Score =  109 bits (55), Expect = 6e-21
 Identities = 112/131 (85%)
 Strand = Plus / Plus

                                                                         
Query: 187   ctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttg 246
             ||||| ||||| ||||||||||||||||| ||||||||||||||||| || || | ||| 
Sbjct: 76363 ctctccccacgaatgcggcgagcgagctgaatgtccttgggcatgatagtcactcgctta 76422

                                                                         
Query: 247   gcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcc 306
             || |||||||| || |||||||| |||||||| ||||| || | ||||| ||||  ||||
Sbjct: 76423 gcatggatggcacacaggttggtatcctcaaagagccccaccaagtaggcctcgcaggcc 76482

                        
Query: 307   tcctgcagggc 317
             |||||||||||
Sbjct: 76483 tcctgcagggc 76493



 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 142/174 (81%)
 Strand = Plus / Minus

                                                                         
Query: 184   gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
             |||||||| ||||| |||||||| || ||||||||||| || ||||||||||| || |  
Sbjct: 30943 gccctctccccacgaatgcggcgggcaagctggatgtctttaggcatgatggtcacgcgt 30884

                                                                         
Query: 244   ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
             ||||| || || ||||| |||||||||||||| || ||||| || | ||||| ||||  |
Sbjct: 30883 ttggcatgaatagcgcacaggttggtgtcctcgaaaagccccaccaagtaggcctcgcag 30824

                                                                   
Query: 304   gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
             ||||||||||| ||    || |||||   ||||||||| |||||||||||||||
Sbjct: 30823 gcctcctgcagcgccatcaccgcggaactctggaagcgcaggtcggtcttgaag 30770



to top

>dbj|AK097020.1| Homo sapiens cDNA FLJ39701 fis, clone SMINT2011656
          Length = 2332

 Score =  149 bits (75), Expect = 7e-33
 Identities = 117/131 (89%)
 Strand = Plus / Plus

                                                                        
Query: 184  gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
            |||||||| ||||| ||||||||||| ||||||||||||||||||||||| || || | |
Sbjct: 1293 gccctctccccacgaatgcggcgagcaagctggatgtccttgggcatgatagtcactcgc 1352

                                                                        
Query: 244  ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
            |||||||| |||||||| ||||||||||||||||||||||| || ||||||| ||||  |
Sbjct: 1353 ttggcgtgaatggcgcataggttggtgtcctcaaacagccccaccaggtaggcctcgcag 1412

                       
Query: 304  gcctcctgcag 314
            |||||||||||
Sbjct: 1413 gcctcctgcag 1423



to top

>emb|X16496.1|MMHIST31 Murine H3.1 gene for histone H3.1
          Length = 592

 Score =  149 bits (75), Expect = 7e-33
 Identities = 117/131 (89%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| ||||| ||||||||||| ||||||||||||||||||||||| || || | |
Sbjct: 510 gccctctccccacgaatgcggcgagcaagctggatgtccttgggcatgatagtcactcgc 451

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           |||||||| |||||||| ||||||||||||||||||||||| || ||||||| ||||  |
Sbjct: 450 ttggcgtgaatggcgcataggttggtgtcctcaaacagccccaccaggtaggcctcgcag 391

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 390 gcctcctgcag 380



to top

>ref|NM_013548.2| Mus musculus histone 1, H3f (Hist1h3f), mRNA
          Length = 1851

 Score =  147 bits (74), Expect = 3e-32
 Identities = 140/162 (86%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||| ||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 915 cggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 856

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||||||||| || || ||||||| ||||   ||||||||||| 
Sbjct: 855 gcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgcaga 796

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 795 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 754



to top

>ref|NM_013550.3| Mus musculus histone 1, H3a (Hist1h3a), mRNA
          Length = 535

 Score =  147 bits (74), Expect = 3e-32
 Identities = 149/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||||||||| || || |||||||||||||||||||||||||| | |
Sbjct: 441 gccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgc 382

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || || ||||||| |||   |
Sbjct: 381 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacag 322

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||  ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 321 gcctcctgcaaagccatgacggccgagctctggaagcgcaggtcggtcttgaag 268



to top

>gb|BC107287.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMAGE:40053019),
           partial cds
          Length = 415

 Score =  147 bits (74), Expect = 3e-32
 Identities = 149/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || || ||||| || || ||||||||||||||||||||||||||||| | |
Sbjct: 403 gccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 344

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || |||||||||| |||   |
Sbjct: 343 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 284

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 283 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaag 230



to top

>gb|BC084311.1| Xenopus laevis cDNA clone IMAGE:6865011
          Length = 1959

 Score =  147 bits (74), Expect = 3e-32
 Identities = 149/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||| | ||| || ||||||||||||||||||||||||||||||| |
Sbjct: 440 gccctctcgccccggatcctgcgggccagctggatgtccttgggcatgatggtgaccctc 381

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||  ||||| || || | ||||  |
Sbjct: 380 ttggcgtggatggcgcacaggttggtgtcctcaaacaaaccgaccagataagcctcgctg 321

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 320 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 267



to top

>ref|XM_599846.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC521581), mRNA
          Length = 411

 Score =  147 bits (74), Expect = 3e-32
 Identities = 149/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||||||||| || ||||||||||||||||||||||||||||| | |
Sbjct: 407 gccctctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           |||||||||||||| ||||||||||||||||| || ||||| || ||||||| ||||   
Sbjct: 347 ttggcgtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 287 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaag 234



to top

>ref|XM_601510.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC523214), mRNA
          Length = 1459

 Score =  147 bits (74), Expect = 3e-32
 Identities = 149/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           ||||| ||||| ||||||||||| || ||||||||||||||||||||||||||||| | |
Sbjct: 927 gccctttctccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 868

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           |||||||||||||| ||||||||||||||||| || ||||| || ||||||| ||||   
Sbjct: 867 ttggcgtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 808

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 807 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaag 754



to top

>ref|XM_545428.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488306), mRNA
          Length = 411

 Score =  147 bits (74), Expect = 3e-32
 Identities = 140/162 (86%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 395 cggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || ||||| || ||||||| ||||   ||||||||||| 
Sbjct: 335 gcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctcctgcagc 276

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 275 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 234



to top

>gb|BC103549.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123925
           IMAGE:40044771), complete cds
          Length = 1003

 Score =  147 bits (74), Expect = 3e-32
 Identities = 140/162 (86%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||| ||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 828 cggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 769

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||||||||| || || ||||||| ||||   ||||||||||| 
Sbjct: 768 gcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgcaga 709

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 708 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 667



to top

>gb|AY125229.1| Argia vivida histone 3 gene, partial cds
          Length = 372

 Score =  147 bits (74), Expect = 3e-32
 Identities = 122/138 (88%)
 Strand = Plus / Minus

                                                                       
Query: 220 tccttgggcatgatggtgacccccttggcgtggatggcgcaaaggttggtgtcctcaaac 279
           |||||||||||||||||||| | |||||||||||||||||| |||||||||||||| || 
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 309

                                                                       
Query: 280 agcccgacgaggtaggactcggcggcctcctgcagggcggaaacggcggaggactggaag 339
           || ||||||||||||| |||||  ||||||||||| ||    |||||||||  |||||||
Sbjct: 308 agaccgacgaggtaggcctcggacgcctcctgcagagccatgacggcggagctctggaag 249

                             
Query: 340 cggaggtcggtcttgaag 357
           ||||||||||||||||||
Sbjct: 248 cggaggtcggtcttgaag 231



to top

>emb|AJ556872.1|XLA556872 Expression vector pET3-H3 H3 gene for Xenopus laevis-like histone
           H3
          Length = 509

 Score =  147 bits (74), Expect = 3e-32
 Identities = 149/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||| | ||| || ||||||||||||||||||||||||||||||| |
Sbjct: 448 gccctctcgcctcggattctgcgggccagctggatgtccttgggcatgatggtgaccctc 389

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||||||||||||||| ||  |||| || || | ||||  |
Sbjct: 388 ttggcgtggatggcgcacaggttggtgtcctcaaagagagcgaccagataagcctcgctg 329

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||   |||||| |||  ||||||||| |||||||||||||||
Sbjct: 328 gcctcctgcagagccataacggccgagctctggaagcgcaggtcggtcttgaag 275



to top

>gb|DQ393931.1| Cydia pomonella clone Cp4.61 microsatellite sequence
          Length = 517

 Score =  147 bits (74), Expect = 3e-32
 Identities = 134/154 (87%)
 Strand = Plus / Minus

                                                                       
Query: 204 gcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatggcgcaaag 263
           |||||| ||||||||||||||||||||||||||||| | |||||||||||||||||| ||
Sbjct: 377 gcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacag 318

                                                                       
Query: 264 gttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagggcggaaac 323
           |||||||||||| ||  | ||||||||||| | ||||  ||||||||| || ||   |||
Sbjct: 317 gttggtgtcctcgaagggaccgacgaggtaagcctcgctggcctcctggagagccataac 258

                                             
Query: 324 ggcggaggactggaagcggaggtcggtcttgaag 357
           |||||||  ||||||||| |||||||||||||||
Sbjct: 257 ggcggagctctggaagcgcaggtcggtcttgaag 224



to top

>dbj|AK155722.1| Mus musculus B6-derived CD11 +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F730210F11
           product:histone 1, H3h, full insert sequence
          Length = 1806

 Score =  147 bits (74), Expect = 3e-32
 Identities = 149/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || || ||||| || || ||||||||||||||||||||||||||||| | |
Sbjct: 435 gccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 376

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || |||||||||| |||   |
Sbjct: 375 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 316

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 315 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaag 262



to top

>ref|XM_694088.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570590), mRNA
          Length = 411

 Score =  147 bits (74), Expect = 3e-32
 Identities = 113/126 (89%)
 Strand = Plus / Minus

                                                                       
Query: 189 ctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggc 248
           |||||||||||||||||| || ||||||||||||||||||||||||||||||| ||||||
Sbjct: 402 ctctccacggatgcggcgggctagctggatgtccttgggcatgatggtgaccctcttggc 343

                                                                       
Query: 249 gtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctc 308
           |||||||||||| || ||||||||||| ||||| ||||| || || | ||||  ||||||
Sbjct: 342 gtggatggcgcacagattggtgtcctcgaacagaccgaccagataagcctcgctggcctc 283

                 
Query: 309 ctgcag 314
           ||||||
Sbjct: 282 ctgcag 277



to top

>dbj|AK010121.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched
           library, clone:2310069A13 product:HISTONE H3-VI homolog
           [Gallus gallus], full insert sequence
          Length = 852

 Score =  147 bits (74), Expect = 3e-32
 Identities = 140/162 (86%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||| ||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 417 cggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 358

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||||||||| || || ||||||| ||||   ||||||||||| 
Sbjct: 357 gcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgcaga 298

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 297 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 256



to top

>gb|U62670.1|MMU62670 Mus musculus histone H3.1-I (H3-I) gene, complete cds
          Length = 727

 Score =  147 bits (74), Expect = 3e-32
 Identities = 149/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || || ||||| || || ||||||||||||||||||||||||||||| | |
Sbjct: 553 gccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 494

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || |||||||||| |||   |
Sbjct: 493 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 434

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 433 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaag 380



to top

>dbj|AK018952.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700111A06 product:H3 HISTONE homolog
           [Rattus norvegicus], full insert sequence
          Length = 535

 Score =  147 bits (74), Expect = 3e-32
 Identities = 149/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||||||||| || || |||||||||||||||||||||||||| | |
Sbjct: 441 gccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgc 382

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || || ||||||| |||   |
Sbjct: 381 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacag 322

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||  ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 321 gcctcctgcaaagccatgacggccgagctctggaagcgcaggtcggtcttgaag 268



to top

>ref|XM_344595.2| PREDICTED: Rattus norvegicus histone 1, H4a (predicted)
           (Hist1h4a_predicted), mRNA
          Length = 428

 Score =  147 bits (74), Expect = 3e-32
 Identities = 149/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| ||||| |||||||| || |||||||||||||||||||||||||| || | |
Sbjct: 408 gccctctcgccacgaatgcggcgggccagctggatgtccttgggcatgatggtcacacgc 349

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| || ||||||||||||||||| || || ||||||| ||||  |
Sbjct: 348 ttggcgtggatggcgcacagattggtgtcctcaaacagacccacaaggtaggcctcgctg 289

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           |||||||| |||||    || || |||  ||||||||| |||||||||||||||
Sbjct: 288 gcctcctgaagggccatgaccgccgagctctggaagcgaaggtcggtcttgaag 235



to top

>gb|AY158947.1| Mus musculus histone protein Hist1h3f gene, complete cds
          Length = 1851

 Score =  147 bits (74), Expect = 3e-32
 Identities = 140/162 (86%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||| ||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 915 cggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 856

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||||||||| || || ||||||| ||||   ||||||||||| 
Sbjct: 855 gcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgcaga 796

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 795 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 754



to top

>gb|AY158945.1| Mus musculus histone protein Hist1h3i gene, complete cds
          Length = 1408

 Score =  147 bits (74), Expect = 3e-32
 Identities = 149/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || || ||||| || || ||||||||||||||||||||||||||||| | |
Sbjct: 907 gccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 848

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || |||||||||| |||   |
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 788

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 787 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaag 734



to top

>emb|X62292.1|GGHISH3V G.gallus gene for histone H3-V
          Length = 1107

 Score =  147 bits (74), Expect = 3e-32
 Identities = 140/162 (86%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||||||| | |||||| ||||||
Sbjct: 809 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcatggatg 750

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || ||||| || ||||||| ||||   ||||||||||| 
Sbjct: 749 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 690

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 689 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 648



to top

>emb|CR760429.2| Xenopus tropicalis finished cDNA, clone TNeu057j11
          Length = 538

 Score =  147 bits (74), Expect = 3e-32
 Identities = 149/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||| | ||| || ||||||||||||||||||||||||||||||| |
Sbjct: 425 gccctctcgcctcggatcctgcgggccagctggatgtccttgggcatgatggtgaccctc 366

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||||||||||||||| || ||||| || || | ||||  |
Sbjct: 365 ttggcgtggatggcgcacaggttggtgtcctcaaagagaccgaccagataagcctcgctg 306

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 305 gcctcctgcagagccatgacggctgagctctggaagcgcaggtcggtcttgaag 252



to top

>gb|U37578.1|GGU37578 Gallus gallus histone H3-VII gene, complete cds
          Length = 1204

 Score =  147 bits (74), Expect = 3e-32
 Identities = 137/158 (86%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 883 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 824

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || ||||| || ||||||| ||||   ||||||||||| 
Sbjct: 823 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 764

                                                 
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtctt 353
           ||    ||||| |||  ||||||||| |||||||||||
Sbjct: 763 gccatgacggccgagctctggaagcgcaggtcggtctt 726



to top

>ref|NM_178207.2| Mus musculus histone 1, H3i (Hist1h3i), mRNA
          Length = 483

 Score =  147 bits (74), Expect = 3e-32
 Identities = 149/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || || ||||| || || ||||||||||||||||||||||||||||| | |
Sbjct: 434 gccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 375

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||| || |||||||||| |||   |
Sbjct: 374 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 315

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 314 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaag 261



to top

>gb|BC101955.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123923
           IMAGE:40044769), complete cds
          Length = 1004

 Score =  147 bits (74), Expect = 3e-32
 Identities = 140/162 (86%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||| ||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 828 cggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 769

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||||||||| || || ||||||| ||||   ||||||||||| 
Sbjct: 768 gcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgcaga 709

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 708 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 667



to top

>gb|BC101956.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123922
           IMAGE:40044765), complete cds
          Length = 1004

 Score =  147 bits (74), Expect = 3e-32
 Identities = 140/162 (86%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||| ||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 828 cggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 769

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||||||||| || || ||||||| ||||   ||||||||||| 
Sbjct: 768 gcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgcaga 709

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 708 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 667



to top

>gb|BC101954.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123924
           IMAGE:40044770), complete cds
          Length = 1004

 Score =  147 bits (74), Expect = 3e-32
 Identities = 140/162 (86%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||| ||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 828 cggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 769

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||||||||| || || ||||||| ||||   ||||||||||| 
Sbjct: 768 gcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgcaga 709

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 708 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 667



to top

>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4
           (ch4-III), histone H2B (ch2b-III) and histone H2A
           (ch2a-III) genes, complete cds
          Length = 4582

 Score =  147 bits (74), Expect = 3e-32
 Identities = 110/122 (90%)
 Strand = Plus / Plus

                                                                       
Query: 193 ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
           |||||||||||||| || |||||||||||||||||||||||||| || | ||||||||||
Sbjct: 477 ccacggatgcggcgggccagctggatgtccttgggcatgatggtcacacgcttggcgtgg 536

                                                                       
Query: 253 atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
           |||||||| |||||||||||||| ||||| || || ||||||| ||| ||||||||||||
Sbjct: 537 atggcgcacaggttggtgtcctcgaacaggcccaccaggtaggcctcagcggcctcctgc 596

             
Query: 313 ag 314
           ||
Sbjct: 597 ag 598



to top

>emb|X01685.1|MMHISH32 Mouse gene (H3.2) for histone H3
          Length = 702

 Score =  147 bits (74), Expect = 3e-32
 Identities = 140/162 (86%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||| ||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 546 cggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 487

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||||||||| || || ||||||| ||||   ||||||||||| 
Sbjct: 486 gcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgcaga 427

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 426 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 385



to top

>gb|M61155.1|CHKH3AB Chicken histone H3 gene, complete cds
          Length = 1017

 Score =  147 bits (74), Expect = 3e-32
 Identities = 140/162 (86%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||||||| | ||||||||| |||
Sbjct: 555 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgcatg 496

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || ||||| || ||||||| ||||   ||||||||||| 
Sbjct: 495 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 436

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 435 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 394



to top

>gb|M32459.1|MUSHIS3A Mouse histone H3 (H3.2-221) gene, complete cds
          Length = 982

 Score =  147 bits (74), Expect = 3e-32
 Identities = 140/162 (86%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||| ||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 803 cggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 744

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||||||||| || || ||||||| ||||   ||||||||||| 
Sbjct: 743 gcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgcaga 684

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 683 gccatgacggccgagctctggaagcgcaggtcggtcttgaag 642



to top

>ref|XM_694149.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570644), mRNA
          Length = 411

 Score =  145 bits (73), Expect = 1e-31
 Identities = 115/129 (89%)
 Strand = Plus / Minus

                                                                       
Query: 189 ctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggc 248
           |||||| ||||||||||| || ||||||||||| ||||||||||||||||||| ||||||
Sbjct: 402 ctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggc 343

                                                                       
Query: 249 gtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctc 308
           |||||||||||| |||||||||||||| ||||| ||||| || || | ||||  ||||||
Sbjct: 342 gtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctggcctc 283

                    
Query: 309 ctgcagggc 317
           |||||||||
Sbjct: 282 ctgcagggc 274



to top

>ref|XM_693458.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570028), mRNA
          Length = 725

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Minus

                                                                       
Query: 189 ctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggc 248
           |||||| ||||||||||| || ||||||||||||||||||||||||||||||| ||||||
Sbjct: 402 ctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttggc 343

                                                                       
Query: 249 gtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctc 308
           |||||||||||| ||||| |||||||| || || ||||| || || | ||||  || |||
Sbjct: 342 gtggatggcgcacaggtttgtgtcctcgaaaaggccgaccagataagcctcgctggactc 283

                                                            
Query: 309 ctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           |||||||||    |||||||||  ||||||||| ||||| |||||||||
Sbjct: 282 ctgcagggccatgacggcggagctctggaagcgcaggtcagtcttgaag 234



to top

>gb|BC069303.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:97421
           IMAGE:7262697), complete cds
          Length = 461

 Score =  141 bits (71), Expect = 2e-30
 Identities = 116/131 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           ||||||||||| ||||||||||| |||||||||||||||||||||||||| ||||| | |
Sbjct: 407 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||||||||| ||||| || | ||||| ||||   
Sbjct: 347 ttggcgtggatggcgcacaggttagtgtcctcaaatagccctaccaagtaggcctcgcac 288

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 287 gcctcctgcag 277



to top

>gb|BC067490.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79343
           IMAGE:7002071), complete cds
          Length = 465

 Score =  141 bits (71), Expect = 2e-30
 Identities = 116/131 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           ||||||||||| ||||||||||| |||||||||||||||||||||||||| ||||| | |
Sbjct: 407 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||||||||| ||||| || | ||||| ||||   
Sbjct: 347 ttggcgtggatggcgcacaggttagtgtcctcaaatagccctaccaagtaggcctcgcac 288

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 287 gcctcctgcag 277



to top

>gb|BC067491.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79344
           IMAGE:7002072), complete cds
          Length = 464

 Score =  141 bits (71), Expect = 2e-30
 Identities = 116/131 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           ||||||||||| ||||||||||| |||||||||||||||||||||||||| ||||| | |
Sbjct: 407 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||||||||| ||||| || | ||||| ||||   
Sbjct: 347 ttggcgtggatggcgcacaggttagtgtcctcaaatagccctaccaagtaggcctcgcac 288

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 287 gcctcctgcag 277



to top

>ref|NM_003529.2| Homo sapiens histone 1, H3a (HIST1H3A), mRNA
          Length = 469

 Score =  141 bits (71), Expect = 2e-30
 Identities = 116/131 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           ||||||||||| ||||||||||| |||||||||||||||||||||||||| ||||| | |
Sbjct: 407 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||||||||| ||||| || | ||||| ||||   
Sbjct: 347 ttggcgtggatggcgcacaggttagtgtcctcaaatagccctaccaagtaggcctcgcac 288

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 287 gcctcctgcag 277



to top

>gb|AF531274.1| Homo sapiens histone H3 (HIST1H3A) gene, complete cds
          Length = 1227

 Score =  141 bits (71), Expect = 2e-30
 Identities = 116/131 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           ||||||||||| ||||||||||| |||||||||||||||||||||||||| ||||| | |
Sbjct: 817 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 758

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||||||||| ||||| || | ||||| ||||   
Sbjct: 757 ttggcgtggatggcgcacaggttagtgtcctcaaatagccctaccaagtaggcctcgcac 698

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 697 gcctcctgcag 687



to top

>emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for histones H3 and H4
          Length = 1898

 Score =  141 bits (71), Expect = 2e-30
 Identities = 116/131 (88%)
 Strand = Plus / Minus

                                                                        
Query: 184  gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
            |||| ||| ||||| |||||||| || ||||||||||||||||||||||||||||| | |
Sbjct: 1510 gcccgctcgccacgaatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 1451

                                                                        
Query: 244  ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
            ||||||||||||||||| |||||||| ||||| ||||| || || ||||||| |||||| 
Sbjct: 1450 ttggcgtggatggcgcacaggttggtatcctcgaacaggcccaccaggtaggcctcggca 1391

                       
Query: 304  gcctcctgcag 314
            |||||||||||
Sbjct: 1390 gcctcctgcag 1380



to top

>ref|XM_684297.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC560897), mRNA
          Length = 471

 Score =  141 bits (71), Expect = 2e-30
 Identities = 92/99 (92%)
 Strand = Plus / Minus

                                                                       
Query: 189 ctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggc 248
           |||||| ||||||||||| || ||||||||||||||||||||||||||||||| ||||||
Sbjct: 462 ctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttggc 403

                                                  
Query: 249 gtggatggcgcaaaggttggtgtcctcaaacagcccgac 287
           |||||||||||| |||||||||||||| ||||| |||||
Sbjct: 402 gtggatggcgcacaggttggtgtcctcgaacagaccgac 364



to top

>gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, histone 2A-like protein gene,
              hereditary haemochromatosis (HLA-H) gene, RoRet gene, and
              sodium phosphate transporter (NPT3) gene, complete cds
          Length = 246282

 Score =  141 bits (71), Expect = 2e-30
 Identities = 116/131 (88%)
 Strand = Plus / Plus

                                                                          
Query: 184    gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
              ||||||||||| ||||||||||| |||||||||||||||||||||||||| ||||| | |
Sbjct: 120163 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 120222

                                                                          
Query: 244    ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
              ||||||||||||||||| ||||| ||||||||||| ||||| || | ||||| ||||   
Sbjct: 120223 ttggcgtggatggcgcacaggttagtgtcctcaaatagccctaccaagtaggcctcgcac 120282

                         
Query: 304    gcctcctgcag 314
              |||||||||||
Sbjct: 120283 gcctcctgcag 120293



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 83/95 (87%)
 Strand = Plus / Minus

                                                                          
Query: 190    tctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcg 249
              ||||| || ||||||||||||||||||||||| |||||||| || || || | ||| || 
Sbjct: 109399 tctccgcgaatgcggcgagcgagctggatgtctttgggcataatagtcactcgcttagca 109340

                                                 
Query: 250    tggatggcgcaaaggttggtgtcctcaaacagccc 284
              ||||||||||||||||| ||||||||||| |||||
Sbjct: 109339 tggatggcgcaaaggtttgtgtcctcaaagagccc 109305



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                         
Query: 184   gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
             ||||| || ||||||||||| || || |||||||| || ||||||||||||||||| |  
Sbjct: 95242 gccctttccccacggatgcgacgtgccagctggatatctttgggcatgatggtgacgcgt 95301

                                          
Query: 244   ttggcgtggatggcgcaaaggttggtgtc 272
             || ||||| || ||||| || ||||||||
Sbjct: 95302 ttagcgtgaatagcgcacagattggtgtc 95330



to top

>emb|Z61129.1|HS45E8R H.sapiens CpG island DNA genomic Mse1 fragment, clone 45e8, reverse
           read cpg45e8.rt1d
          Length = 257

 Score =  141 bits (71), Expect = 2e-30
 Identities = 116/131 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           ||||||||||| ||||||||||| |||||||||||||||||||||||||| ||||| | |
Sbjct: 169 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 110

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||||||||| ||||| || | ||||| ||||   
Sbjct: 109 ttggcgtggatggcgcacaggttagtgtcctcaaatagccctaccaagtaggcctcgcac 50

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 49  gcctcctgcag 39



to top

>gb|BC066246.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79341
           IMAGE:7002069), complete cds
          Length = 465

 Score =  141 bits (71), Expect = 2e-30
 Identities = 116/131 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           ||||||||||| ||||||||||| |||||||||||||||||||||||||| ||||| | |
Sbjct: 407 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||||||||| ||||| || | ||||| ||||   
Sbjct: 347 ttggcgtggatggcgcacaggttagtgtcctcaaatagccctaccaagtaggcctcgcac 288

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 287 gcctcctgcag 277



to top

>gb|BC066245.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79340
           IMAGE:7002068), complete cds
          Length = 465

 Score =  141 bits (71), Expect = 2e-30
 Identities = 116/131 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           ||||||||||| ||||||||||| |||||||||||||||||||||||||| ||||| | |
Sbjct: 407 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||||||||| ||||| || | ||||| ||||   
Sbjct: 347 ttggcgtggatggcgcacaggttagtgtcctcaaatagccctaccaagtaggcctcgcac 288

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 287 gcctcctgcag 277



to top

>gb|BC066247.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79342
           IMAGE:7002070), complete cds
          Length = 465

 Score =  141 bits (71), Expect = 2e-30
 Identities = 116/131 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           ||||||||||| ||||||||||| |||||||||||||||||||||||||| ||||| | |
Sbjct: 407 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||||||||| ||||| || | ||||| ||||   
Sbjct: 347 ttggcgtggatggcgcacaggttagtgtcctcaaatagccctaccaagtaggcctcgcac 288

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 287 gcctcctgcag 277



to top

>emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 in linkage group 25,
             complete sequence
          Length = 167326

 Score =  141 bits (71), Expect = 2e-30
 Identities = 92/99 (92%)
 Strand = Plus / Plus

                                                                         
Query: 189   ctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggc 248
             |||||| ||||||||||| || ||||||||||||||||||||||||||||||| ||||||
Sbjct: 79278 ctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttggc 79337

                                                    
Query: 249   gtggatggcgcaaaggttggtgtcctcaaacagcccgac 287
             |||||||||||| |||||||||||||| ||||| |||||
Sbjct: 79338 gtggatggcgcacaggttggtgtcctcgaacagaccgac 79376



 Score =  133 bits (67), Expect = 4e-28
 Identities = 91/99 (91%)
 Strand = Plus / Plus

                                                                          
Query: 189    ctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggc 248
              |||||| ||||||||||| || ||||||||||| ||||||||||||||||||| ||||||
Sbjct: 116393 ctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggc 116452

                                                     
Query: 249    gtggatggcgcaaaggttggtgtcctcaaacagcccgac 287
              |||||||||||| |||||||||||||| ||||| |||||
Sbjct: 116453 gtggatggcgcacaggttggtgtcctcgaacagaccgac 116491



 Score =  133 bits (67), Expect = 4e-28
 Identities = 91/99 (91%)
 Strand = Plus / Plus

                                                                         
Query: 189   ctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggc 248
             |||||| ||||||||||| || ||||||||||||||||||||||||||||||| ||||||
Sbjct: 99229 ctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttggc 99288

                                                    
Query: 249   gtggatggcgcaaaggttggtgtcctcaaacagcccgac 287
             |||||||||||| ||||| |||||||| ||||| |||||
Sbjct: 99289 gtggatggcgcacaggttagtgtcctcgaacagaccgac 99327



 Score =  133 bits (67), Expect = 4e-28
 Identities = 91/99 (91%)
 Strand = Plus / Plus

                                                                         
Query: 189   ctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggc 248
             |||||| ||||||||||| || ||||||||||| ||||||||||||||||||| ||||||
Sbjct: 85977 ctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggc 86036

                                                    
Query: 249   gtggatggcgcaaaggttggtgtcctcaaacagcccgac 287
             |||||||||||| |||||||||||||| ||||| |||||
Sbjct: 86037 gtggatggcgcacaggttggtgtcctcgaacagaccgac 86075



 Score =  133 bits (67), Expect = 4e-28
 Identities = 91/99 (91%)
 Strand = Plus / Minus

                                                                         
Query: 189   ctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggc 248
             |||||| ||||||||||| || ||||||||||| ||||||||||||||||||| ||||||
Sbjct: 63677 ctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggc 63618

                                                    
Query: 249   gtggatggcgcaaaggttggtgtcctcaaacagcccgac 287
             |||||||||||| |||||||||||||| ||||| |||||
Sbjct: 63617 gtggatggcgcacaggttggtgtcctcgaacagaccgac 63579



to top

>gb|U38420.1|HVU38420 Hordeum vulgare histone H3 gene, partial cds, clone B1
          Length = 494

 Score =  141 bits (71), Expect = 2e-30
 Identities = 128/147 (87%)
 Strand = Plus / Minus

                                                                       
Query: 211 agctggatgtccttgggcatgatggtgacccccttggcgtggatggcgcaaaggttggtg 270
           ||||||||||||||||||||||||||||| | |||||||||||||||||| |||||||||
Sbjct: 494 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 435

                                                                       
Query: 271 tcctcaaacagcccgacgaggtaggactcggcggcctcctgcagggcggaaacggcggag 330
           ||||| |||||||||   ||||| | |||||| |||||||| |||||    ||||||  |
Sbjct: 434 tcctcgaacagcccgcgaaggtatgcctcggcagcctcctggagggccagcacggcgtgg 375

                                      
Query: 331 gactggaagcggaggtcggtcttgaag 357
           |||||||| | ||||||||||||||||
Sbjct: 374 gactggaacctgaggtcggtcttgaag 348



to top

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
           histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
           complete cds
          Length = 3777

 Score =  141 bits (71), Expect = 2e-30
 Identities = 107/119 (89%)
 Strand = Plus / Plus

                                                                       
Query: 193 ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
           |||||||||||||| || ||||||||||||||||||||||| || || | ||||||||||
Sbjct: 257 ccacggatgcggcgggccagctggatgtccttgggcatgatcgtcacacgcttggcgtgg 316

                                                                      
Query: 253 atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctg 311
           |||||||| |||||||||||||| ||||| || || ||||||| |||||||||||||||
Sbjct: 317 atggcgcacaggttggtgtcctcgaacaggcccaccaggtaggcctcggcggcctcctg 375



to top

>ref|XM_527604.1| PREDICTED: Pan troglodytes similar to histone 1, H3g (LOC472230),
           mRNA
          Length = 411

 Score =  139 bits (70), Expect = 7e-30
 Identities = 148/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           ||||||||||| || ||||||||||||||||||||||||||||||||||| || || | |
Sbjct: 407 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||| || || ||||||||||||||||| ||||| || ||||| | ||||  |
Sbjct: 347 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 288

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 287 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaag 234



to top

>gb|BC067492.1| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC:79345
           IMAGE:7002073), complete cds
          Length = 468

 Score =  139 bits (70), Expect = 7e-30
 Identities = 148/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           ||||||||||| || ||||||||||||||||||||||||||||||||||| || || | |
Sbjct: 407 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||| || || ||||||||||||||||| ||||| || ||||| | ||||  |
Sbjct: 347 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 288

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 287 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaag 234



to top

>ref|XM_871261.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618948), mRNA
          Length = 484

 Score =  139 bits (70), Expect = 7e-30
 Identities = 148/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || || |||||||| || ||||||||||||||||||||||||||||| | |
Sbjct: 407 gccctctccccgcgaatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           |||||||||||||| ||||||||||||||||| || ||||| || ||||||| ||||   
Sbjct: 347 ttggcgtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 287 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaag 234



to top

>ref|XM_870218.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC617888), mRNA
          Length = 714

 Score =  139 bits (70), Expect = 7e-30
 Identities = 151/178 (84%)
 Strand = Plus / Minus

                                                                       
Query: 180 ctaggccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgac 239
           |||||||||||| || ||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 714 ctaggccctctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgac 655

                                                                       
Query: 240 ccccttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactc 299
            | ||||||||||||||| || |||||||||||||| || || || || ||||||| |||
Sbjct: 654 gcgcttggcgtggatggcacacaggttggtgtcctcgaagagtcccaccaggtaggcctc 595

                                                                     
Query: 300 ggcggcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           |   ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 594 gcacgcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaag 537



to top

>ref|XM_591827.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC540148), mRNA
          Length = 484

 Score =  139 bits (70), Expect = 7e-30
 Identities = 148/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || || |||||||| || ||||||||||||||||||||||||||||| | |
Sbjct: 407 gccctctccccgcgaatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           |||||||||||||| ||||||||||||||||| || ||||| || ||||||| ||||   
Sbjct: 347 ttggcgtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 287 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaag 234



to top

>ref|XM_540290.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform
           2 (LOC483172), mRNA
          Length = 525

 Score =  139 bits (70), Expect = 7e-30
 Identities = 139/162 (85%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 509 cggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 450

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || ||||| || ||||||| ||||   ||||||||||| 
Sbjct: 449 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 390

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 389 gccatgacggccgagctctggaagcgcaggtccgtcttgaag 348



to top

>ref|XM_540285.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform
           2 (LOC483167), mRNA
          Length = 525

 Score =  139 bits (70), Expect = 7e-30
 Identities = 139/162 (85%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 509 cggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 450

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || ||||| || ||||||| ||||   ||||||||||| 
Sbjct: 449 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 390

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 389 gccatgacggccgagctctggaagcgcaggtccgtcttgaag 348



to top

>ref|XM_845651.1| PREDICTED: Canis familiaris similar to CG31613-PA (LOC608586), mRNA
          Length = 411

 Score =  139 bits (70), Expect = 7e-30
 Identities = 139/162 (85%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| || ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 395 cggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || ||||| || ||||||| ||||   ||||||||||| 
Sbjct: 335 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 276

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 275 gccatgacggccgagctctggaagcgcaggtccgtcttgaag 234



to top

>gb|AF531279.1| Homo sapiens histone H3 (HIST1H3F) gene, complete cds
          Length = 1227

 Score =  139 bits (70), Expect = 7e-30
 Identities = 148/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           ||||||||||| || ||||||||||||||||||||||||||||||||||| || || | |
Sbjct: 816 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 757

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||| || || ||||||||||||||||| ||||| || ||||| | ||||  |
Sbjct: 756 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 697

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 696 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaag 643



to top

>gb|AF520775.1| Hypocrea jecorina histone H3 gene, complete cds
          Length = 497

 Score =  139 bits (70), Expect = 7e-30
 Identities = 139/162 (85%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           |||| |||||| ||||||||||||||||||| |  ||||||||| | |||||||||||||
Sbjct: 481 cggaggcggcgggcgagctggatgtccttggactggatggtgacacgcttggcgtggatg 422

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||||||||| || ||   |||||||||||||||| | | |||||| |||
Sbjct: 421 gcgcacaggttggtgtcctcgaagagggagacgaggtaggactcgacagactcctggagg 362

                                                     
Query: 316 gcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           |||   | |||||| |||||||||||||||||| ||||||||
Sbjct: 361 gcgccgatggcggacgactggaagcggaggtcgctcttgaag 320



to top

>gb|AY125231.1| Melanoplus sp. OR18 histone 3 gene, partial cds
          Length = 372

 Score =  139 bits (70), Expect = 7e-30
 Identities = 121/138 (87%)
 Strand = Plus / Minus

                                                                       
Query: 220 tccttgggcatgatggtgacccccttggcgtggatggcgcaaaggttggtgtcctcaaac 279
           |||||||||||||||||||| | |||||||||||||||||| |||||||||||||| || 
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 309

                                                                       
Query: 280 agcccgacgaggtaggactcggcggcctcctgcagggcggaaacggcggaggactggaag 339
           || ||||||||||||| ||||  |||||||||||| ||    |||||||||  |||||||
Sbjct: 308 aggccgacgaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaag 249

                             
Query: 340 cggaggtcggtcttgaag 357
           || |||||||||||||||
Sbjct: 248 cgcaggtcggtcttgaag 231



to top

>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3
            and H4
          Length = 8592

 Score =  139 bits (70), Expect = 7e-30
 Identities = 148/174 (85%)
 Strand = Plus / Plus

                                                                        
Query: 184  gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
            ||||||||||| ||||| | ||| || ||||||||||||||||||||||||||||| | |
Sbjct: 5556 gccctctctcctcggatcctgcgggccagctggatgtccttgggcatgatggtgactctc 5615

                                                                        
Query: 244  ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
            ||||||||||||||||| |||||||||||||| || ||||| || || || | ||||  |
Sbjct: 5616 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccagataagcctcgctg 5675

                                                                  
Query: 304  gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            ||||||||||| ||    ||||| |||  |||||||||||| ||||||||||||
Sbjct: 5676 gcctcctgcagagccatgacggctgagctctggaagcggagatcggtcttgaag 5729



to top

>gb|BC096131.1| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC:116777
           IMAGE:40002512), complete cds
          Length = 463

 Score =  139 bits (70), Expect = 7e-30
 Identities = 148/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           ||||||||||| || ||||||||||||||||||||||||||||||||||| || || | |
Sbjct: 407 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||| || || ||||||||||||||||| ||||| || ||||| | ||||  |
Sbjct: 347 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 288

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 287 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaag 234



to top

>gb|AF348235.1| Calonectria kyotensis strain CBS413.67 histone 3-like gene, partial
           sequence
          Length = 431

 Score =  139 bits (70), Expect = 7e-30
 Identities = 130/150 (86%)
 Strand = Plus / Minus

                                                                       
Query: 208 gcgagctggatgtccttgggcatgatggtgacccccttggcgtggatggcgcaaaggttg 267
           ||||||||||||||||||| |  |||||| || | |||||||||||||||||||||||||
Sbjct: 429 gcgagctggatgtccttggactggatggtaacacgcttggcgtggatggcgcaaaggttg 370

                                                                       
Query: 268 gtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagggcggaaacggcg 327
           |||||||| || ||   |||||||||||||||| ||| |||||| ||||||   | ||| 
Sbjct: 369 gtgtcctcgaagagtgagacgaggtaggactcgacggactcctggagggcgccgatggca 310

                                         
Query: 328 gaggactggaagcggaggtcggtcttgaag 357
           ||||||||||||||||||||| ||||||||
Sbjct: 309 gaggactggaagcggaggtcgctcttgaag 280



to top

>gb|AF348234.1| Calonectria kyotensis strain ATCC 18882 histone 3-like gene,
           partial sequence
          Length = 432

 Score =  139 bits (70), Expect = 7e-30
 Identities = 130/150 (86%)
 Strand = Plus / Minus

                                                                       
Query: 208 gcgagctggatgtccttgggcatgatggtgacccccttggcgtggatggcgcaaaggttg 267
           ||||||||||||||||||| |  |||||| || | |||||||||||||||||||||||||
Sbjct: 430 gcgagctggatgtccttggactggatggtaacacgcttggcgtggatggcgcaaaggttg 371

                                                                       
Query: 268 gtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagggcggaaacggcg 327
           |||||||| || ||   |||||||||||||||| ||| |||||| ||||||   | ||| 
Sbjct: 370 gtgtcctcgaagagtgagacgaggtaggactcgacggactcctggagggcgccgatggca 311

                                         
Query: 328 gaggactggaagcggaggtcggtcttgaag 357
           ||||||||||||||||||||| ||||||||
Sbjct: 310 gaggactggaagcggaggtcgctcttgaag 281



to top

>gb|AF348231.1| Calonectria kyotensis strain ATCC 18443 histone 3-like gene,
           partial sequence
          Length = 438

 Score =  139 bits (70), Expect = 7e-30
 Identities = 130/150 (86%)
 Strand = Plus / Minus

                                                                       
Query: 208 gcgagctggatgtccttgggcatgatggtgacccccttggcgtggatggcgcaaaggttg 267
           ||||||||||||||||||| |  |||||| || | |||||||||||||||||||||||||
Sbjct: 436 gcgagctggatgtccttggactggatggtaacacgcttggcgtggatggcgcaaaggttg 377

                                                                       
Query: 268 gtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagggcggaaacggcg 327
           |||||||| || ||   |||||||||||||||| ||| |||||| ||||||   | ||| 
Sbjct: 376 gtgtcctcgaagagtgagacgaggtaggactcgacggactcctggagggcgccgatggca 317

                                         
Query: 328 gaggactggaagcggaggtcggtcttgaag 357
           ||||||||||||||||||||| ||||||||
Sbjct: 316 gaggactggaagcggaggtcgctcttgaag 287



to top

>gb|AF348227.1| Calonectria kyotensis strain STE-U500 histone 3-like gene, partial
           sequence
          Length = 430

 Score =  139 bits (70), Expect = 7e-30
 Identities = 130/150 (86%)
 Strand = Plus / Minus

                                                                       
Query: 208 gcgagctggatgtccttgggcatgatggtgacccccttggcgtggatggcgcaaaggttg 267
           ||||||||||||||||||| |  |||||| || | |||||||||||||||||||||||||
Sbjct: 428 gcgagctggatgtccttggactggatggtaacacgcttggcgtggatggcgcaaaggttg 369

                                                                       
Query: 268 gtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagggcggaaacggcg 327
           |||||||| || ||   |||||||||||||||| ||| |||||| ||||||   | ||| 
Sbjct: 368 gtgtcctcgaagagtgagacgaggtaggactcgacggactcctggagggcgccgatggca 309

                                         
Query: 328 gaggactggaagcggaggtcggtcttgaag 357
           ||||||||||||||||||||| ||||||||
Sbjct: 308 gaggactggaagcggaggtcgctcttgaag 279



to top

>ref|NM_021018.2| Homo sapiens histone 1, H3f (HIST1H3F), mRNA
          Length = 466

 Score =  139 bits (70), Expect = 7e-30
 Identities = 148/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           ||||||||||| || ||||||||||||||||||||||||||||||||||| || || | |
Sbjct: 409 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 350

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||| || || ||||||||||||||||| ||||| || ||||| | ||||  |
Sbjct: 349 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 290

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 289 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaag 236



to top

>emb|CR542011.1| Homo sapiens full open reading frame cDNA clone RZPDo834F0335D for
           gene HIST1H3F, histone 1, H3f; complete cds, without
           stopcodon
          Length = 408

 Score =  139 bits (70), Expect = 7e-30
 Identities = 148/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           ||||||||||| || ||||||||||||||||||||||||||||||||||| || || | |
Sbjct: 407 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||| || || ||||||||||||||||| ||||| || ||||| | ||||  |
Sbjct: 347 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 288

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 287 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaag 234



to top

>emb|CR541983.1| Homo sapiens full open reading frame cDNA clone RZPDo834C0335D for
           gene HIST1H3F, histone 1, H3f; complete cds, incl.
           stopcodon
          Length = 411

 Score =  139 bits (70), Expect = 7e-30
 Identities = 148/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           ||||||||||| || ||||||||||||||||||||||||||||||||||| || || | |
Sbjct: 407 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||| || || ||||||||||||||||| ||||| || ||||| | ||||  |
Sbjct: 347 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 288

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 287 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaag 234



to top

>dbj|AK020421.1| Mus musculus 12 days embryo embryonic body between diaphragm region
           and neck cDNA, RIKEN full-length enriched library,
           clone:9430017D03 product:histone 2, H3c2, full insert
           sequence
          Length = 1251

 Score =  139 bits (70), Expect = 7e-30
 Identities = 148/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || || ||||| || || |||||||||||||||||||| |||||||| | |
Sbjct: 447 gccctctccccccgaatgcgacgggccagctggatgtccttgggcataatggtgacacgc 388

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           |||||||||||||| || |||||||||||||||||||| || |||||||||| ||||   
Sbjct: 387 ttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 328

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    ||||| |||  ||||||||| |||||||||||||||
Sbjct: 327 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaag 274



to top

>gb|BC069818.1| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC:97445
           IMAGE:7262721), complete cds
          Length = 463

 Score =  139 bits (70), Expect = 7e-30
 Identities = 148/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           ||||||||||| || ||||||||||||||||||||||||||||||||||| || || | |
Sbjct: 409 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 350

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||| || || ||||||||||||||||| ||||| || ||||| | ||||  |
Sbjct: 349 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 290

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 289 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaag 236



to top

>gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I) and histone H4 (ch4-I)
           genes, complete cds
          Length = 1338

 Score =  139 bits (70), Expect = 7e-30
 Identities = 109/122 (89%)
 Strand = Plus / Plus

                                                                       
Query: 193 ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
           |||||||||||||| || |||||||||||||||||||||||||| || | ||||||||||
Sbjct: 213 ccacggatgcggcgggccagctggatgtccttgggcatgatggtcacacgcttggcgtgg 272

                                                                       
Query: 253 atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
           |||||||| ||||| |||||||| ||||| || || ||||||| ||| ||||||||||||
Sbjct: 273 atggcgcacaggttcgtgtcctcgaacaggcccaccaggtaggcctcagcggcctcctgc 332

             
Query: 313 ag 314
           ||
Sbjct: 333 ag 334



to top

>gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and
            histone H3 gene, 3' end, gene cluster X1h3
          Length = 8608

 Score =  139 bits (70), Expect = 7e-30
 Identities = 148/174 (85%)
 Strand = Plus / Plus

                                                                        
Query: 184  gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
            ||||||||||| ||||| | ||| || ||||||||||||||||||||||||||||| | |
Sbjct: 5573 gccctctctcctcggatcctgcgggccagctggatgtccttgggcatgatggtgactctc 5632

                                                                        
Query: 244  ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
            ||||||||||||||||| |||||||||||||| || ||||| || || || | ||||  |
Sbjct: 5633 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccagataagcctcgctg 5692

                                                                  
Query: 304  gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            ||||||||||| ||    ||||| |||  |||||||||||| ||||||||||||
Sbjct: 5693 gcctcctgcagagccatgacggctgagctctggaagcggagatcggtcttgaag 5746



to top

>gb|J00984.1|XELHIS3LB x.laevis histone gene h3 and flanks
          Length = 488

 Score =  139 bits (70), Expect = 7e-30
 Identities = 148/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||| | ||| || ||||||||||||||||||||||||||||||| |
Sbjct: 407 gccctctcgcctcggatcctgcgggccagctggatgtccttgggcatgatggtgaccctc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||||||||||||||| ||  |||| || || | ||||  |
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcaaagagagcgaccagataagcctcgctg 288

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||   |||||| ||   ||||||||| |||||||||||||||
Sbjct: 287 gcctcctgcagagccataacggccgacctctggaagcgcaggtcggtcttgaag 234



to top

>emb|Z80786.1|HSH3I H.sapiens H3/i gene
          Length = 701

 Score =  139 bits (70), Expect = 7e-30
 Identities = 148/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           ||||||||||| || ||||||||||||||||||||||||||||||||||| || || | |
Sbjct: 546 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 487

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||| || || ||||||||||||||||| ||||| || ||||| | ||||  |
Sbjct: 486 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 427

                                                                 
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||||||||| ||    || || |||  ||||||||| |||||||||||||||
Sbjct: 426 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaag 373



to top

>ref|NM_178216.1| Mus musculus histone 2, H3c1 (Hist2h3c1), transcript variant 2,
           mRNA
          Length = 546

 Score =  137 bits (69), Expect = 3e-29
 Identities = 141/165 (85%)
 Strand = Plus / Minus

                                                                       
Query: 193 ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
           |||||||||||||| || | ||||||||||||||||||||||||||| |  |||||||||
Sbjct: 533 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 474

                                                                       
Query: 253 atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
           |||||||| |||||||||||||| |||||||| || ||||||| ||||   |||||||||
Sbjct: 473 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 414

                                                        
Query: 313 agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           || ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 413 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaag 369



to top

>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339
          Length = 2972

 Score =  137 bits (69), Expect = 3e-29
 Identities = 141/165 (85%)
 Strand = Plus / Minus

                                                                        
Query: 193  ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
            |||||||||||||| || | ||||||||||||||||||||||||||| |  |||||||||
Sbjct: 1730 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 1671

                                                                        
Query: 253  atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
            |||||||| |||||||||||||| |||||||| || ||||||| ||||   |||||||||
Sbjct: 1670 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 1611

                                                         
Query: 313  agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            || ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 1610 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaag 1566



to top

>ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h3c1), mRNA
          Length = 2956

 Score =  137 bits (69), Expect = 3e-29
 Identities = 141/165 (85%)
 Strand = Plus / Minus

                                                                        
Query: 193  ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
            |||||||||||||| || | ||||||||||||||||||||||||||| |  |||||||||
Sbjct: 1730 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 1671

                                                                        
Query: 253  atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
            |||||||| |||||||||||||| |||||||| || ||||||| ||||   |||||||||
Sbjct: 1670 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 1611

                                                         
Query: 313  agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            || ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 1610 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaag 1566



to top

>emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23
          Length = 2724

 Score =  137 bits (69), Expect = 3e-29
 Identities = 141/165 (85%)
 Strand = Plus / Minus

                                                                        
Query: 193  ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
            ||||||||||||||  | | ||||||||||||||||||||||||||| | ||||||||||
Sbjct: 2539 ccacggatgcggcggaccaactggatgtccttgggcatgatggtgacgcgcttggcgtgg 2480

                                                                        
Query: 253  atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
            |||||||| |||||||||||||| |||||||| || ||||||| ||||   |||||||||
Sbjct: 2479 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 2420

                                                         
Query: 313  agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            || ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 2419 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaag 2375



to top

>emb|X95625.1|NPHISTOH3 N.pseudonarcissus mRNA for histone H3
          Length = 610

 Score =  137 bits (69), Expect = 3e-29
 Identities = 127/147 (86%)
 Strand = Plus / Minus

                                                                       
Query: 211 agctggatgtccttgggcatgatggtgacccccttggcgtggatggcgcaaaggttggtg 270
           |||||||| ||||| |||||||||||||||| ||| || |||||||||||||  ||||||
Sbjct: 358 agctggatatccttaggcatgatggtgaccctcttcgcatggatggcgcaaanattggtg 299

                                                                       
Query: 271 tcctcaaacagcccgacgaggtaggactcggcggcctcctgcagggcggaaacggcggag 330
           ||||||||||| || |||||||| |||||||| |||||||| || ||||  || ||||| 
Sbjct: 298 tcctcaaacaggcccacgaggtacgactcggccgcctcctggagcgcggccacagcggan 239

                                      
Query: 331 gactggaagcggaggtcggtcttgaag 357
             ||||||||||||||| |||||||||
Sbjct: 238 ctctggaagcggaggtcagtcttgaag 212



to top

>gb|DQ096858.1| Xenopus laevis h3r mRNA, complete sequence
          Length = 1062

 Score =  137 bits (69), Expect = 3e-29
 Identities = 147/173 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||| | ||| || ||||||||||||||||||||||||||||||| |
Sbjct: 425 gccctctcgcctcggatcctgcgggccagctggatgtccttgggcatgatggtgaccctc 366

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| |||||||||||||||||||  ||||| || || | ||||  |
Sbjct: 365 ttggcgtggatggcgcacaggttggtgtcctcaaacaaaccgaccagataagcctcgctg 306

                                                                
Query: 304 gcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaa 356
           ||||||||||| ||    ||||| |||  |||||| || ||||||||||||||
Sbjct: 305 gcctcctgcagagccatgacggccgagctctggaaccgcaggtcggtcttgaa 253



to top

>dbj|AK134918.1| Mus musculus adult male olfactory brain cDNA, RIKEN full-length
            enriched library, clone:6430517B15
            product:unclassifiable, full insert sequence
          Length = 3217

 Score =  137 bits (69), Expect = 3e-29
 Identities = 141/165 (85%)
 Strand = Plus / Plus

                                                                        
Query: 193  ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
            |||||||||||||| || | ||||||||||||||||||||||||||| |  |||||||||
Sbjct: 1200 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 1259

                                                                        
Query: 253  atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
            |||||||| |||||||||||||| |||||||| || ||||||| ||||   |||||||||
Sbjct: 1260 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 1319

                                                         
Query: 313  agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            || ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 1320 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaag 1364



to top

>ref|XM_686806.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC563445), mRNA
          Length = 444

 Score =  137 bits (69), Expect = 3e-29
 Identities = 111/125 (88%)
 Strand = Plus / Minus

                                                                       
Query: 189 ctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggc 248
           |||||| ||||||||||| || ||||||||||||||||||||||||||||||| ||||||
Sbjct: 435 ctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttggc 376

                                                                       
Query: 249 gtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctc 308
           |||||||||||| |||||||||||||| ||||| || || || || | ||||  ||||||
Sbjct: 375 gtggatggcgcacaggttggtgtcctcgaacagaccaaccagataagcctcgctggcctc 316

                
Query: 309 ctgca 313
           |||||
Sbjct: 315 ctgca 311



to top

>ref|XM_688339.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC565028), mRNA
          Length = 411

 Score =  137 bits (69), Expect = 3e-29
 Identities = 114/129 (88%)
 Strand = Plus / Minus

                                                                       
Query: 189 ctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggc 248
           |||||| ||||||||||| || ||||||||||| ||||||||||||||||||| ||||||
Sbjct: 402 ctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggc 343

                                                                       
Query: 249 gtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctc 308
           |||||||||||| ||||| |||||||||||||| || || || || | ||||  ||||||
Sbjct: 342 gtggatggcgcacaggtttgtgtcctcaaacagacccaccagataagcctcgctggcctc 283

                    
Query: 309 ctgcagggc 317
           |||||||||
Sbjct: 282 ctgcagggc 274



to top

>gb|U62675.1|MMU62675 Mus musculus histone H3.2-616 (H3-616), and histone H2b-616
           (H2b-616) genes, complete cds
          Length = 2371

 Score =  137 bits (69), Expect = 3e-29
 Identities = 141/165 (85%)
 Strand = Plus / Minus

                                                                       
Query: 193 ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
           |||||||||||||| || | ||||||||||||||||||||||||||| |  |||||||||
Sbjct: 978 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 919

                                                                       
Query: 253 atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
           |||||||| |||||||||||||| |||||||| || ||||||| ||||   |||||||||
Sbjct: 918 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 859

                                                        
Query: 313 agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           || ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 858 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaag 814



to top

>gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615),  and histone H3.2-615
            (H3-615) genes, complete cds
          Length = 2997

 Score =  137 bits (69), Expect = 3e-29
 Identities = 141/165 (85%)
 Strand = Plus / Minus

                                                                        
Query: 193  ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
            |||||||||||||| || | ||||||||||||||||||||||||||| |  |||||||||
Sbjct: 2713 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 2654

                                                                        
Query: 253  atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
            |||||||| |||||||||||||| |||||||| || ||||||| ||||   |||||||||
Sbjct: 2653 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 2594

                                                         
Query: 313  agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            || ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 2593 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaag 2549



to top

>ref|NG_002616.1| Homo sapiens histone 2, H3b (HIST2H3B) pseudogene on chromosome 1
          Length = 1411

 Score =  137 bits (69), Expect = 3e-29
 Identities = 141/165 (85%)
 Strand = Plus / Minus

                                                                       
Query: 193 ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
           |||||||||||||| || | ||||||||||||||||||||||||||| |  |||||||||
Sbjct: 898 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 839

                                                                       
Query: 253 atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
           |||||||| |||||||||||||| |||||||| || ||||||| ||||   |||||||||
Sbjct: 838 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 779

                                                        
Query: 313 agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           || ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 778 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaag 734



to top

>gb|BC094041.1| Mus musculus histone 2, H3c1, mRNA (cDNA clone MGC:102454
           IMAGE:5099464), complete cds
          Length = 1831

 Score =  137 bits (69), Expect = 3e-29
 Identities = 141/165 (85%)
 Strand = Plus / Minus

                                                                       
Query: 193 ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
           |||||||||||||| || | ||||||||||||||||||||||||||| |  |||||||||
Sbjct: 599 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 540

                                                                       
Query: 253 atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
           |||||||| |||||||||||||| |||||||| || ||||||| ||||   |||||||||
Sbjct: 539 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 480

                                                        
Query: 313 agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           || ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 479 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaag 435



to top

>gb|AF531306.1| Homo sapiens histone H3 (HIST2H3B) pseudogene, complete sequence
          Length = 1411

 Score =  137 bits (69), Expect = 3e-29
 Identities = 141/165 (85%)
 Strand = Plus / Minus

                                                                       
Query: 193 ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
           |||||||||||||| || | ||||||||||||||||||||||||||| |  |||||||||
Sbjct: 898 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 839

                                                                       
Query: 253 atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
           |||||||| |||||||||||||| |||||||| || ||||||| ||||   |||||||||
Sbjct: 838 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 779

                                                        
Query: 313 agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           || ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 778 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaag 734



to top

>gb|AY158955.1| Mus musculus histone protein Hist2h3b gene, complete cds
          Length = 1411

 Score =  137 bits (69), Expect = 3e-29
 Identities = 141/165 (85%)
 Strand = Plus / Minus

                                                                       
Query: 193 ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
           |||||||||||||| || | ||||||||||||||||||||||||||| |  |||||||||
Sbjct: 898 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 839

                                                                       
Query: 253 atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
           |||||||| |||||||||||||| |||||||| || ||||||| ||||   |||||||||
Sbjct: 838 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 779

                                                        
Query: 313 agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           || ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 778 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaag 734



to top

>gb|AY158954.1| Mus musculus histone protein Hist2h3c1 gene, complete cds
          Length = 1675

 Score =  137 bits (69), Expect = 3e-29
 Identities = 141/165 (85%)
 Strand = Plus / Minus

                                                                        
Query: 193  ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
            |||||||||||||| || | ||||||||||||||||||||||||||| |  |||||||||
Sbjct: 1084 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 1025

                                                                        
Query: 253  atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
            |||||||| |||||||||||||| |||||||| || ||||||| ||||   |||||||||
Sbjct: 1024 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 965

                                                         
Query: 313  agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            || ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 964  agcgccatgacggccgagctctggaagcgcaggtccgtcttgaag 920



to top

>gb|AY158941.1| Mus musculus histone protein Hist2h2bb gene, complete cds
          Length = 1500

 Score =  137 bits (69), Expect = 3e-29
 Identities = 141/165 (85%)
 Strand = Plus / Plus

                                                                       
Query: 193 ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
           |||||||||||||| || | ||||||||||||||||||||||||||| |  |||||||||
Sbjct: 523 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 582

                                                                       
Query: 253 atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
           |||||||| |||||||||||||| |||||||| || ||||||| ||||   |||||||||
Sbjct: 583 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 642

                                                        
Query: 313 agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           || ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 643 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaag 687



to top

>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence
          Length = 200326

 Score =  137 bits (69), Expect = 3e-29
 Identities = 141/165 (85%)
 Strand = Plus / Minus

                                                                         
Query: 193   ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
             |||||||||||||| || | ||||||||||||||||||||||||||| |  |||||||||
Sbjct: 93730 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 93671

                                                                         
Query: 253   atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
             |||||||| |||||||||||||| |||||||| || ||||||| ||||   |||||||||
Sbjct: 93670 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 93611

                                                          
Query: 313   agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
             || ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 93610 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaag 93566



 Score =  137 bits (69), Expect = 3e-29
 Identities = 141/165 (85%)
 Strand = Plus / Minus

                                                                         
Query: 193   ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
             |||||||||||||| || | ||||||||||||||||||||||||||| |  |||||||||
Sbjct: 71922 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 71863

                                                                         
Query: 253   atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
             |||||||| |||||||||||||| |||||||| || ||||||| ||||   |||||||||
Sbjct: 71862 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 71803

                                                          
Query: 313   agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
             || ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 71802 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaag 71758



 Score =  137 bits (69), Expect = 3e-29
 Identities = 141/165 (85%)
 Strand = Plus / Plus

                                                                         
Query: 193   ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
             |||||||||||||| || | ||||||||||||||||||||||||||| |  |||||||||
Sbjct: 63183 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 63242

                                                                         
Query: 253   atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
             |||||||| |||||||||||||| |||||||| || ||||||| ||||   |||||||||
Sbjct: 63243 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 63302

                                                          
Query: 313   agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
             || ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 63303 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaag 63347



to top

>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence
          Length = 166720

 Score =  137 bits (69), Expect = 3e-29
 Identities = 141/165 (85%)
 Strand = Plus / Minus

                                                                         
Query: 193   ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
             |||||||||||||| || | ||||||||||||||||||||||||||| |  |||||||||
Sbjct: 37510 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 37451

                                                                         
Query: 253   atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
             |||||||| |||||||||||||| |||||||| || ||||||| ||||   |||||||||
Sbjct: 37450 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 37391

                                                          
Query: 313   agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
             || ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 37390 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaag 37346



 Score =  137 bits (69), Expect = 3e-29
 Identities = 141/165 (85%)
 Strand = Plus / Plus

                                                                         
Query: 193   ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
             |||||||||||||| || | ||||||||||||||||||||||||||| |  |||||||||
Sbjct: 28771 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 28830

                                                                         
Query: 253   atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
             |||||||| |||||||||||||| |||||||| || ||||||| ||||   |||||||||
Sbjct: 28831 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 28890

                                                          
Query: 313   agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
             || ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 28891 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaag 28935



 Score =  137 bits (69), Expect = 3e-29
 Identities = 141/165 (85%)
 Strand = Plus / Plus

                                                                        
Query: 193  ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
            |||||||||||||| || | ||||||||||||||||||||||||||| |  |||||||||
Sbjct: 6963 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 7022

                                                                        
Query: 253  atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
            |||||||| |||||||||||||| |||||||| || ||||||| ||||   |||||||||
Sbjct: 7023 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 7082

                                                         
Query: 313  agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            || ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 7083 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaag 7127



to top

>emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chromosome 11, complete
             sequence
          Length = 103129

 Score =  137 bits (69), Expect = 3e-29
 Identities = 153/181 (84%)
 Strand = Plus / Minus

                                                                         
Query: 177   agcctaggccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggt 236
             |||||| ||||  ||||| |||||||| ||||| | ||||||||| ||||||||||||||
Sbjct: 46697 agcctaagcccgttctccgcggatgcgccgagccaactggatgtctttgggcatgatggt 46638

                                                                         
Query: 237   gacccccttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtagga 296
              |||| |||||||||||| ||||| ||||| ||||| || |||||||| |||||||| ||
Sbjct: 46637 cacccgcttggcgtggatagcgcacaggttcgtgtcttcgaacagccccacgaggtacga 46578

                                                                         
Query: 297   ctcggcggcctcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaa 356
             ||||  |||||||||||| ||    || ||||||  ||||||||| ||||||||||||||
Sbjct: 46577 ctcgcaggcctcctgcagcgccatcaccgcggagctctggaagcgcaggtcggtcttgaa 46518

              
Query: 357   g 357
             |
Sbjct: 46517 g 46517



to top

>ref|NM_178215.1| Mus musculus histone 2, H3b (Hist2h3b), mRNA
          Length = 411

 Score =  137 bits (69), Expect = 3e-29
 Identities = 141/165 (85%)
 Strand = Plus / Minus

                                                                       
Query: 193 ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
           |||||||||||||| || | ||||||||||||||||||||||||||| |  |||||||||
Sbjct: 398 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 339

                                                                       
Query: 253 atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
           |||||||| |||||||||||||| |||||||| || ||||||| ||||   |||||||||
Sbjct: 338 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 279

                                                        
Query: 313 agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           || ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 278 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaag 234



to top

>gb|M32461.1|MUSHIS3C Mouse histone H3 (H3.2-614) gene, complete cds
          Length = 1110

 Score =  137 bits (69), Expect = 3e-29
 Identities = 141/165 (85%)
 Strand = Plus / Minus

                                                                       
Query: 193 ccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtgg 252
           |||||||||||||| || | ||||||||||||||||||||||||||| |  |||||||||
Sbjct: 737 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 678

                                                                       
Query: 253 atggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgc 312
           |||||||| |||||||||||||| |||||||| || ||||||| ||||   |||||||||
Sbjct: 677 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 618

                                                        
Query: 313 agggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           || ||    ||||| |||  ||||||||| ||||| |||||||||
Sbjct: 617 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaag 573



to top

>ref|XM_603864.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC525511), mRNA
          Length = 448

 Score =  135 bits (68), Expect = 1e-28
 Identities = 113/128 (88%)
 Strand = Plus / Minus

                                                                       
Query: 187 ctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttg 246
           ||||| || ||||||||||| || ||||||||||||||||||||||||||||| | ||||
Sbjct: 404 ctctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttg 345

                                                                       
Query: 247 gcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcc 306
           ||||||||||| || ||||||||||||||||| ||||| || ||||||| ||||   |||
Sbjct: 344 gcgtggatggcacacaggttggtgtcctcaaagagccccaccaggtaggcctcgcacgcc 285

                   
Query: 307 tcctgcag 314
           ||||||||
Sbjct: 284 tcctgcag 277



to top

>ref|XM_356549.3| PREDICTED: Mus musculus similar to histone 1, H2ai (predicted)
           (LOC382523), mRNA
          Length = 411

 Score =  135 bits (68), Expect = 1e-28
 Identities = 143/168 (85%)
 Strand = Plus / Minus

                                                                       
Query: 190 tctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcg 249
           ||||| |||||||| ||||| | ||||||||| |||||||||||||| |||| |||||||
Sbjct: 401 tctccgcggatgcgccgagccaactggatgtctttgggcatgatggtcacccgcttggcg 342

                                                                       
Query: 250 tggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcc 309
           ||||| ||||| ||||| ||||| || |||||||| |||||||| ||||||  |||||||
Sbjct: 341 tggatagcgcacaggttcgtgtcttcgaacagccccacgaggtacgactcgcaggcctcc 282

                                                           
Query: 310 tgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
           ||||| ||    || ||||||  ||||||||| |||||||||||||||
Sbjct: 281 tgcagcgccatcaccgcggagctctggaagcgcaggtcggtcttgaag 234



to top

>ref|XM_687893.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC564560), mRNA
          Length = 411

 Score =  135 bits (68), Expect = 1e-28
 Identities = 143/168 (85%)
 Strand = Plus / Minus

                                                                       
Query: 189 ctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggc 248
           |||||| ||||||||||| || ||||||||||| ||||||||||||||||||| ||||||
Sbjct: 402 ctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggc 343

                                                                       
Query: 249 gtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctc 308
           |||||||||||| |||||||||||||| ||||| ||||| || || | ||||  || |||
Sbjct: 342 gtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctggactc 283

                                                           
Query: 309 ctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaa 356
           ||| || ||    |||||||||  ||||||||| || |||||||||||
Sbjct: 282 ctgaagagccatgacggcggagctctggaagcgcagatcggtcttgaa 235



to top

>ref|XM_518289.1| PREDICTED: Pan troglodytes similar to Histone H2A.g (H2A/g) (H2A.3)
           (LOC462493), mRNA
          Length = 1052

 Score =  133 bits (67), Expect = 4e-28
 Identities = 115/131 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| ||||| ||||| ||||| |||||||||||||||||||| || || || | |
Sbjct: 858 gccctctccccacgaatgcgacgagccagctggatgtccttgggcataatagtcactcgc 799

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           |||||||| |||||||| ||||||||||||||||||||||| || ||||||| ||||  |
Sbjct: 798 ttggcgtgaatggcgcataggttggtgtcctcaaacagccccaccaggtaggcctcgcag 739

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 738 gcctcctgcag 728



to top

>ref|NM_021059.2| Homo sapiens histone 2, H3c (HIST2H3C), mRNA
          Length = 507

 Score =  133 bits (67), Expect = 4e-28
 Identities = 115/131 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||| |||||||||||||||||| || |||||||||||||||||||| ||||| || | |
Sbjct: 443 gcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgc 384

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||| || |||||||| || ||||||| ||||  |
Sbjct: 383 ttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctg 324

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 323 gcctcctgcag 313



to top

>gb|AY648851.1| Homo sapiens histone H3/o gene, complete cds
          Length = 1227

 Score =  133 bits (67), Expect = 4e-28
 Identities = 115/131 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||| |||||||||||||||||| || |||||||||||||||||||| ||||| || | |
Sbjct: 816 gcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgc 757

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||| || |||||||| || ||||||| ||||  |
Sbjct: 756 ttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctg 697

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 696 gcctcctgcag 686



to top

>ref|XM_590015.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC539875), mRNA
          Length = 411

 Score =  133 bits (67), Expect = 4e-28
 Identities = 115/131 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || |||||||||||||| ||||||||||||||||||||||||||||| | |
Sbjct: 407 gccctctccccgcggatgcggcgagcaagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| || ||||||||||| || || || || ||||||| ||||   
Sbjct: 347 ttggcgtggatggcgcagagattggtgtcctcgaagaggcccaccaggtaggcctcgcac 288

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 287 gcctcctgcag 277



to top

>gb|BC063540.1| Homo sapiens cDNA clone IMAGE:4523373, **** WARNING: chimeric clone
           ****
          Length = 1047

 Score =  133 bits (67), Expect = 4e-28
 Identities = 115/131 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||| |||||||||||||||||| || |||||||||||||||||||| ||||| || | |
Sbjct: 420 gcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgc 361

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||| || |||||||| || ||||||| ||||  |
Sbjct: 360 ttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctg 301

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 300 gcctcctgcag 290



to top

>gb|BC015544.1| Homo sapiens histone 2, H3c, mRNA (cDNA clone IMAGE:3913365)
          Length = 1672

 Score =  133 bits (67), Expect = 4e-28
 Identities = 115/131 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||| |||||||||||||||||| || |||||||||||||||||||| ||||| || | |
Sbjct: 443 gcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgc 384

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||| || |||||||| || ||||||| ||||  |
Sbjct: 383 ttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctg 324

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 323 gcctcctgcag 313



to top

>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a
              ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
              (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of
              IgG, high affinity Ia, receptor for (CD64), a novel gene
              similar to histone 2, H2be (HIST2H2BE), a novel gene
              similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for
              histone 2, H4, the HIST2H3C gene for histone 2, H3c, the
              HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd
              pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene
              (HIST2H2BC), a novel gene similar to histone 2, H2aa
              (HIST2H2AA), a novel gene similar to histone 2, H3c
              (HIST2H3C), a novel gene similar to histone 1, H4
              (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the
              HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for
              histone 2, H2ab, a novel protein similar to histone 2, a
              novel gene, the SV2A gene for synaptic vesicle glycoprotein
              2A, the 3' end of the SF3B4 gene for splicing factor 3b,
              subunit 4, 49kDa and five CpG islands, complete sequence
          Length = 188956

 Score =  133 bits (67), Expect = 4e-28
 Identities = 115/131 (87%)
 Strand = Plus / Minus

                                                                          
Query: 184    gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
              |||| |||||||||||||||||| || |||||||||||||||||||| ||||| || | |
Sbjct: 114783 gcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgc 114724

                                                                          
Query: 244    ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
              ||||||||||||||||| ||||| ||||| || |||||||| || ||||||| ||||  |
Sbjct: 114723 ttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctg 114664

                         
Query: 304    gcctcctgcag 314
              |||||||||||
Sbjct: 114663 gcctcctgcag 114653



 Score =  133 bits (67), Expect = 4e-28
 Identities = 115/131 (87%)
 Strand = Plus / Plus

                                                                          
Query: 184    gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
              |||| |||||||||||||||||| || |||||||||||||||||||| ||||| || | |
Sbjct: 102483 gcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgc 102542

                                                                          
Query: 244    ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
              ||||||||||||||||| ||||| ||||| || |||||||| || ||||||| ||||  |
Sbjct: 102543 ttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctg 102602

                         
Query: 304    gcctcctgcag 314
              |||||||||||
Sbjct: 102603 gcctcctgcag 102613



 Score =  115 bits (58), Expect = 1e-22
 Identities = 115/134 (85%)
 Strand = Plus / Plus

                                                                         
Query: 181   taggccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacc 240
             ||||||| ||| || ||||||||||| || | |||||||||||||||||||||||| || 
Sbjct: 74987 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 75046

                                                                         
Query: 241   cccttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcg 300
             | |||||| ||||||||||| ||||| ||||| || |||||||| || ||||||| ||||
Sbjct: 75047 cgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcg 75106

                           
Query: 301   gcggcctcctgcag 314
               ||||||||||||
Sbjct: 75107 ctggcctcctgcag 75120



to top

>emb|X53330.1|PDHISTCL P.dumerilii histone gene cluster for core histones H2A, H2B, H3 and
            H4
          Length = 6052

 Score =  133 bits (67), Expect = 4e-28
 Identities = 145/171 (84%)
 Strand = Plus / Plus

                                                                        
Query: 187  ctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttg 246
            |||||||||||||| ||||| || | ||||||||||||||||||||||||||| | ||||
Sbjct: 4150 ctctctccacggatacggcgggccaactggatgtccttgggcatgatggtgactcgcttg 4209

                                                                        
Query: 247  gcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcc 306
            |||||||||||||| | ||||||||||||||| || || || | ||| | ||| | ||||
Sbjct: 4210 gcgtggatggcgcacaagttggtgtcctcaaagagaccaaccaagtaagcctcagaggcc 4269

                                                               
Query: 307  tcctgcagggcggaaacggcggaggactggaagcggaggtcggtcttgaag 357
            ||||| || ||    ||||| ||||||||||| || |||||||||||||||
Sbjct: 4270 tcctggagagccatgacggcagaggactggaatcgcaggtcggtcttgaag 4320



to top

>ref|XM_684517.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC561114), mRNA
          Length = 411

 Score =  133 bits (67), Expect = 4e-28
 Identities = 91/99 (91%)
 Strand = Plus / Minus

                                                                       
Query: 189 ctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggc 248
           |||||| ||||||||||| || ||||||||||| ||||||||||||||||||| ||||||
Sbjct: 402 ctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggc 343

                                                  
Query: 249 gtggatggcgcaaaggttggtgtcctcaaacagcccgac 287
           |||||||||||| |||||||||||||| ||||| |||||
Sbjct: 342 gtggatggcgcacaggttggtgtcctcgaacagaccgac 304



to top

>ref|XM_684015.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC560616), mRNA
          Length = 411

 Score =  133 bits (67), Expect = 4e-28
 Identities = 91/99 (91%)
 Strand = Plus / Minus

                                                                       
Query: 189 ctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggc 248
           |||||| ||||||||||| || ||||||||||| ||||||||||||||||||| ||||||
Sbjct: 402 ctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggc 343

                                                  
Query: 249 gtggatggcgcaaaggttggtgtcctcaaacagcccgac 287
           |||||||||||| |||||||||||||| ||||| |||||
Sbjct: 342 gtggatggcgcacaggttggtgtcctcgaacagaccgac 304



to top

>ref|XM_683485.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC560090), mRNA
          Length = 411

 Score =  133 bits (67), Expect = 4e-28
 Identities = 91/99 (91%)
 Strand = Plus / Minus

                                                                       
Query: 189 ctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggc 248
           |||||| ||||||||||| || ||||||||||||||||||||||||||||||| ||||||
Sbjct: 402 ctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttggc 343

                                                  
Query: 249 gtggatggcgcaaaggttggtgtcctcaaacagcccgac 287
           |||||||||||| ||||| |||||||| ||||| |||||
Sbjct: 342 gtggatggcgcacaggttagtgtcctcgaacagaccgac 304



to top

>ref|XM_683134.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC559765), mRNA
          Length = 411

 Score =  133 bits (67), Expect = 4e-28
 Identities = 91/99 (91%)
 Strand = Plus / Minus

                                                                       
Query: 189 ctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggc 248
           |||||| ||||||||||| || ||||||||||| ||||||||||||||||||| ||||||
Sbjct: 402 ctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggc 343

                                                  
Query: 249 gtggatggcgcaaaggttggtgtcctcaaacagcccgac 287
           |||||||||||| |||||||||||||| ||||| |||||
Sbjct: 342 gtggatggcgcacaggttggtgtcctcgaacagaccgac 304



to top

>ref|XM_928391.1| PREDICTED: Homo sapiens similar to CG31613-PA (LOC653611), mRNA
          Length = 824

 Score =  133 bits (67), Expect = 4e-28
 Identities = 115/131 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||| |||||||||||||||||| || |||||||||||||||||||| ||||| || | |
Sbjct: 696 gcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgc 637

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||| || |||||||| || ||||||| ||||  |
Sbjct: 636 ttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctg 577

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 576 gcctcctgcag 566



to top

>emb|CR541858.1| Homo sapiens full open reading frame cDNA clone RZPDo834H0632D for
           gene HIST1H3A, histone 1, H3a; complete cds, incl.
           stopcodon
          Length = 411

 Score =  133 bits (67), Expect = 4e-28
 Identities = 115/131 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||||||||| |||||||||||||||||||||||||| ||||| | |
Sbjct: 407 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||||||||| ||||| || | ||||| ||||   
Sbjct: 347 ttggcgtggatggcgcacaggttagtgtcctcaaatagccctaccaagtaggcctcgcac 288

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 287 gcctcctgcag 277



to top

>ref|NG_002617.1| Homo sapiens histone 2, H3a (HIST2H3A) pseudogene on chromosome 1
          Length = 1323

 Score =  133 bits (67), Expect = 4e-28
 Identities = 115/131 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||| |||||||||||||||||| || |||||||||||||||||||| ||||| || | |
Sbjct: 930 gcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgc 871

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||| || |||||||| || ||||||| ||||  |
Sbjct: 870 ttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctg 811

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 810 gcctcctgcag 800



to top

>ref|NM_001005464.1| Homo sapiens histone H3/o (H3/o), mRNA
          Length = 411

 Score =  133 bits (67), Expect = 4e-28
 Identities = 115/131 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||| |||||||||||||||||| || |||||||||||||||||||| ||||| || | |
Sbjct: 407 gcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgc 348

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||| || |||||||| || ||||||| ||||  |
Sbjct: 347 ttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctg 288

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 287 gcctcctgcag 277



to top

>gb|BC074969.2| Homo sapiens histone H3/o, mRNA (cDNA clone IMAGE:30915509),
           partial cds
          Length = 481

 Score =  133 bits (67), Expect = 4e-28
 Identities = 115/131 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||| |||||||||||||||||| || |||||||||||||||||||| ||||| || | |
Sbjct: 435 gcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgc 376

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||| || |||||||| || ||||||| ||||  |
Sbjct: 375 ttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctg 316

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 315 gcctcctgcag 305



to top

>gb|AF531307.1| Homo sapiens histone H3 (HIST2H3C) gene, complete cds
          Length = 1227

 Score =  133 bits (67), Expect = 4e-28
 Identities = 115/131 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||| |||||||||||||||||| || |||||||||||||||||||| ||||| || | |
Sbjct: 816 gcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgc 757

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||| || |||||||| || ||||||| ||||  |
Sbjct: 756 ttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctg 697

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 696 gcctcctgcag 686



to top

>gb|AF531305.1| Homo sapiens histone H3 (HIST2H3A) pseudogene, complete sequence
          Length = 1323

 Score =  133 bits (67), Expect = 4e-28
 Identities = 115/131 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||| |||||||||||||||||| || |||||||||||||||||||| ||||| || | |
Sbjct: 930 gcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgc 871

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||| || |||||||| || ||||||| ||||  |
Sbjct: 870 ttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctg 811

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 810 gcctcctgcag 800



to top

>emb|Z56112.1|HS89C12R H.sapiens CpG island DNA genomic Mse1 fragment, clone 89c12,
           reverse read cpg89c12.rt1a
          Length = 172

 Score =  133 bits (67), Expect = 4e-28
 Identities = 115/131 (87%)
 Strand = Plus / Plus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||| |||||||||||||||||| || |||||||||||||||||||| ||||| || | |
Sbjct: 2   gcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgc 61

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||| || |||||||| || ||||||| ||||  |
Sbjct: 62  ttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctg 121

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 122 gcctcctgcag 132



to top

>emb|Z56111.1|HS89C12F H.sapiens CpG island DNA genomic Mse1 fragment, clone 89c12,
           forward read cpg89c12.ft1a
          Length = 171

 Score =  133 bits (67), Expect = 4e-28
 Identities = 115/131 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||| |||||||||||||||||| || |||||||||||||||||||| ||||| || | |
Sbjct: 171 gcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgc 112

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||| || |||||||| || ||||||| ||||  |
Sbjct: 111 ttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctg 52

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 51  gcctcctgcag 41



to top

>emb|Z63365.1|HS81H7R H.sapiens CpG island DNA genomic Mse1 fragment, clone 81h7, reverse
           read cpg81h7.rt1a
          Length = 171

 Score =  133 bits (67), Expect = 4e-28
 Identities = 115/131 (87%)
 Strand = Plus / Plus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||| |||||||||||||||||| || |||||||||||||||||||| ||||| || | |
Sbjct: 2   gcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgc 61

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||| || |||||||| || ||||||| ||||  |
Sbjct: 62  ttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctg 121

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 122 gcctcctgcag 132



to top

>gb|U38423.1|TAU38423 Triticum aestivum histone H3 gene, partial cds, clone W2
          Length = 486

 Score =  133 bits (67), Expect = 4e-28
 Identities = 97/107 (90%)
 Strand = Plus / Minus

                                                                       
Query: 211 agctggatgtccttgggcatgatggtgacccccttggcgtggatggcgcaaaggttggtg 270
           ||||||||||||||||||||||||||||| | |||||| |||||||||||  ||||||||
Sbjct: 486 agctggatgtccttgggcatgatggtgacgcgcttggcatggatggcgcaggggttggtg 427

                                                          
Query: 271 tcctcaaacagcccgacgaggtaggactcggcggcctcctgcagggc 317
           ||||| || |||||||||||||| | ||||||||||||||| |||||
Sbjct: 426 tcctcgaagagcccgacgaggtacgcctcggcggcctcctggagggc 380



to top

>emb|Y08528.1|OSHISTON3 Oryza sativa mRNA for histone 3
          Length = 529

 Score =  133 bits (67), Expect = 4e-28
 Identities = 130/152 (85%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| |||||||||||||||||||||||||||| ||| | |||||||||||||
Sbjct: 467 cggatgcggcgggcgagctggatgtccttgggcatgatggagacgcgcttggcgtggatg 408

                                                                       
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcagg 315
           ||||| |||||||| || || || |||| ||||||||||   |||||||| || || || 
Sbjct: 407 gcgcagaggttggtntcntcgaagagccngacgaggtagccttcggcggcttcttggagc 348

                                           
Query: 316 gcggaaacggcggaggactggaagcggaggtc 347
           ||||  |||||||||  |||||| ||||||||
Sbjct: 347 gcggcgacggcggagctctggaaccggaggtc 316



to top

>gb|M14396.1|CIIHISH3A Duck H3.4 variant histone gene
          Length = 921

 Score =  133 bits (67), Expect = 4e-28
 Identities = 106/119 (89%)
 Strand = Plus / Minus

                                                                       
Query: 196 cggatgcggcgagcgagctggatgtccttgggcatgatggtgacccccttggcgtggatg 255
           ||||||||||| | |||||||||||||||||||||||||| ||| | |||||| ||||||
Sbjct: 735 cggatgcggcgggtgagctggatgtccttgggcatgatggagacgcgcttggcatggatg 676

                                                                      
Query: 256 gcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcggcctcctgcag 314
           ||||| ||||||||||||||||| ||||| || ||||||| ||||  ||||||||||||
Sbjct: 675 gcgcagaggttggtgtcctcaaagagccccaccaggtaggcctcgctggcctcctgcag 617



to top

>emb|Z46261.1|HSHISH3A H.sapiens DNA for histone H3a
          Length = 969

 Score =  133 bits (67), Expect = 4e-28
 Identities = 115/131 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 gccctctctccacggatgcggcgagcgagctggatgtccttgggcatgatggtgaccccc 243
           |||||||| || ||||||||||| |||||||||||||||||||||||||| ||||| | |
Sbjct: 714 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 655

                                                                       
Query: 244 ttggcgtggatggcgcaaaggttggtgtcctcaaacagcccgacgaggtaggactcggcg 303
           ||||||||||||||||| ||||| ||||||||||| ||||| || | ||||| ||||   
Sbjct: 654 ttggcgtggatggcgcacaggttagtgtcctcaaatagccctaccaagtaggcctcgcac 595

                      
Query: 304 gcctcctgcag 314
           |||||||||||
Sbjct: 594 gcctcctgcag 584


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,074,432
Number of Sequences: 3902068
Number of extensions: 3074432
Number of successful extensions: 70438
Number of sequences better than 10.0: 3129
Number of HSP's better than 10.0 without gapping: 3121
Number of HSP's successfully gapped in prelim test: 9
Number of HSP's that attempted gapping in prelim test: 64916
Number of HSP's gapped (non-prelim): 4521
length of query: 357
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 335
effective length of database: 17,147,199,772
effective search space: 5744311923620
effective search space used: 5744311923620
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top