ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast34b05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|BX088719.6| Zebrafish DNA sequence from clone CH211-207H2 in... 44 0.36
2emb|BX510925.7| Zebrafish DNA sequence from clone CH211-278B8 in... 42 1.4
3dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 42 1.4
4dbj|AB005238.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 42 1.4
5emb|AL355888.3|CNS05TCZ Human chromosome 14 DNA sequence BAC R-3... 42 1.4
6gb|AC109147.19| Mus musculus chromosome 8, clone RP23-341D16, co... 40 5.6
7gb|AC131912.6| Mus musculus chromosome 9, clone RP24-164A20, com... 40 5.6
8gb|AC147901.2| Xenopus tropicalis clone CH216-57C20, complete se... 40 5.6
9gb|AC129604.3| Mus musculus BAC clone RP23-110O3 from 7, complet... 40 5.6
10gb|AC165265.2| Mus musculus BAC clone RP23-15M14 from chromosome... 40 5.6
11emb|AL354923.12| Human DNA sequence from clone RP11-192E23 on ch... 40 5.6
12gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 40 5.6
13gb|AC025783.10| Oryza sativa chromosome 10 BAC OSJNBa0001O14 gen... 40 5.6
14gb|AC007017.4| Arabidopsis thaliana chromosome 2 clone F11F19 ma... 40 5.6
15gb|AC154518.2| Mus musculus BAC clone RP23-211K12 from chromosom... 40 5.6
16gb|AC090515.2| Homo sapiens chromosome 15 clone RP11-30K9 map 15... 40 5.6
17gb|AC159207.2| Mus musculus BAC clone RP23-150H14 from chromosom... 40 5.6
18dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.6
19gb|AF003529.2| Homo sapiens glypican 3 (GPC3) gene, partial cds ... 40 5.6
20dbj|AB018121.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 5.6
21gb|AC002407.1|AC002407 Human Chromosome X, complete sequence 40 5.6
22gb|AC156563.1| Mus musculus BAC clone RP24-255E14 from 12, compl... 40 5.6
23emb|CT572989.7| Mouse DNA sequence from clone RP24-176J14 on chr... 40 5.6
24emb|CR450838.5| Zebrafish DNA sequence from clone DKEY-283N16 in... 40 5.6
25gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 5.6
26gb|AC154313.2| Mus musculus BAC clone RP23-354M21 from chromosom... 40 5.6
27gb|AC004402.1|AC004402 Homo sapiens Cosmid g5129z061, complete s... 40 5.6
28dbj|AP006385.1| Lotus japonicus genomic DNA, chromosome 1, clone... 40 5.6
29gb|AC167022.4| Mus musculus BAC clone RP23-183A4 from chromosome... 40 5.6
30emb|AJ404295.1|BSC404295 Borelis schlumbergeri 18S rRNA gene, is... 40 5.6

>emb|BX088719.6| Zebrafish DNA sequence from clone CH211-207H2 in linkage group 17,
              complete sequence
          Length = 205685

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 137    aaacacaaattacaatttagaa 158
              ||||||||||||||||||||||
Sbjct: 150268 aaacacaaattacaatttagaa 150289



to top

>emb|BX510925.7| Zebrafish DNA sequence from clone CH211-278B8 in linkage group 5,
            complete sequence
          Length = 75254

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 71   ctttgaagttcacataaattctgtt 95
            ||||||| |||||||||||||||||
Sbjct: 8252 ctttgaaattcacataaattctgtt 8276



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 297     cgcgtgggccttctcgacctc 317
               |||||||||||||||||||||
Sbjct: 3196175 cgcgtgggccttctcgacctc 3196155



to top

>dbj|AB005238.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MKP11
          Length = 75188

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 59    accttccacaatctttgaagt 79
             |||||||||||||||||||||
Sbjct: 10361 accttccacaatctttgaagt 10381



to top

>emb|AL355888.3|CNS05TCZ Human chromosome 14 DNA sequence BAC R-322L17 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 214852

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 137    aaacacaaattacaatttagaaata 161
              ||||||||||||||| |||||||||
Sbjct: 137573 aaacacaaattacaaattagaaata 137549



to top

>gb|AC109147.19| Mus musculus chromosome 8, clone RP23-341D16, complete sequence
          Length = 184600

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 221   tacttgtagctacatatttt 240
             ||||||||||||||||||||
Sbjct: 88321 tacttgtagctacatatttt 88340



to top

>gb|AC131912.6| Mus musculus chromosome 9, clone RP24-164A20, complete sequence
          Length = 204724

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 11    ctttacttcctttggattat 30
             ||||||||||||||||||||
Sbjct: 15397 ctttacttcctttggattat 15416



to top

>gb|AC147901.2| Xenopus tropicalis clone CH216-57C20, complete sequence
          Length = 151523

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 136 taaacacaaattacaatttagaaa 159
           |||||| |||||||||||||||||
Sbjct: 459 taaacataaattacaatttagaaa 436



to top

>gb|AC129604.3| Mus musculus BAC clone RP23-110O3 from 7, complete sequence
          Length = 189634

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 29    atcaaaatacacaataaatg 48
             ||||||||||||||||||||
Sbjct: 29194 atcaaaatacacaataaatg 29213



to top

>gb|AC165265.2| Mus musculus BAC clone RP23-15M14 from chromosome 13, complete sequence
          Length = 237830

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 161    acaactcagttctgagaaat 180
              ||||||||||||||||||||
Sbjct: 221625 acaactcagttctgagaaat 221606



to top

>emb|AL354923.12| Human DNA sequence from clone RP11-192E23 on chromosome 9 Contains the
             3' end of the COL15A1 gene for collagen type XV and a CpG
             island, complete sequence
          Length = 134965

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   caaattacaatttagaaata 161
             ||||||||||||||||||||
Sbjct: 98510 caaattacaatttagaaata 98529



to top

>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 300     gtgggccttctcgacctcat 319
               ||||||||||||||||||||
Sbjct: 2920753 gtgggccttctcgacctcat 2920772



to top

>gb|AC025783.10| Oryza sativa chromosome 10 BAC OSJNBa0001O14 genomic sequence, complete
             sequence
          Length = 178022

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 20    ctttggattatcaaaataca 39
             ||||||||||||||||||||
Sbjct: 43501 ctttggattatcaaaataca 43482



to top

>gb|AC007017.4| Arabidopsis thaliana chromosome 2 clone F11F19 map g6825, complete
             sequence
          Length = 120938

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 143   aaattacaatttagaaatac 162
             ||||||||||||||||||||
Sbjct: 17720 aaattacaatttagaaatac 17701



to top

>gb|AC154518.2| Mus musculus BAC clone RP23-211K12 from chromosome 16, complete sequence
          Length = 177189

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 136    taaacacaaattacaatttagaaa 159
              |||| |||||||||||||||||||
Sbjct: 148754 taaatacaaattacaatttagaaa 148777



to top

>gb|AC090515.2| Homo sapiens chromosome 15 clone RP11-30K9 map 15q21.3, complete
             sequence
          Length = 181597

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 17    ttcctttggattatcaaaat 36
             ||||||||||||||||||||
Sbjct: 75599 ttcctttggattatcaaaat 75618



to top

>gb|AC159207.2| Mus musculus BAC clone RP23-150H14 from chromosome 13, complete sequence
          Length = 191824

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 161    acaactcagttctgagaaat 180
              ||||||||||||||||||||
Sbjct: 100738 acaactcagttctgagaaat 100757



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 20       ctttggattatcaaaataca 39
                ||||||||||||||||||||
Sbjct: 20781102 ctttggattatcaaaataca 20781083



to top

>gb|AF003529.2| Homo sapiens glypican 3 (GPC3) gene, partial cds and flanking repeat
              regions
          Length = 165658

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 159    atacaactcagttctgagaa 178
              ||||||||||||||||||||
Sbjct: 159935 atacaactcagttctgagaa 159916



to top

>dbj|AB018121.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXE2
          Length = 86854

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 138   aacacaaattacaatttaga 157
             ||||||||||||||||||||
Sbjct: 20423 aacacaaattacaatttaga 20442



to top

>gb|AC002407.1|AC002407 Human Chromosome X, complete sequence
          Length = 95506

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 159   atacaactcagttctgagaa 178
             ||||||||||||||||||||
Sbjct: 20063 atacaactcagttctgagaa 20044



to top

>gb|AC156563.1| Mus musculus BAC clone RP24-255E14 from 12, complete sequence
          Length = 175641

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 256    tgttgcaatgaatgtttctt 275
              ||||||||||||||||||||
Sbjct: 117017 tgttgcaatgaatgtttctt 117036



to top

>emb|CT572989.7| Mouse DNA sequence from clone RP24-176J14 on chromosome 9, complete
             sequence
          Length = 168760

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 11    ctttacttcctttggattat 30
             ||||||||||||||||||||
Sbjct: 80295 ctttacttcctttggattat 80314



to top

>emb|CR450838.5| Zebrafish DNA sequence from clone DKEY-283N16 in linkage group 18,
             complete sequence
          Length = 145250

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 141   acaaattacaatttagaaatacaa 164
             |||||||||||| |||||||||||
Sbjct: 25243 acaaattacaatctagaaatacaa 25266



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 20       ctttggattatcaaaataca 39
                ||||||||||||||||||||
Sbjct: 20792366 ctttggattatcaaaataca 20792347



to top

>gb|AC154313.2| Mus musculus BAC clone RP23-354M21 from chromosome 12, complete sequence
          Length = 220909

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 232    acatattttgccactgatca 251
              ||||||||||||||||||||
Sbjct: 134367 acatattttgccactgatca 134386



to top

>gb|AC004402.1|AC004402 Homo sapiens Cosmid g5129z061, complete sequence
          Length = 37539

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 92   tgttgaatcactttctaagt 111
            ||||||||||||||||||||
Sbjct: 9812 tgttgaatcactttctaagt 9831



to top

>dbj|AP006385.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT39K18, TM0252a,
             complete sequence
          Length = 42219

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 20    ctttggattatcaaaataca 39
             ||||||||||||||||||||
Sbjct: 14673 ctttggattatcaaaataca 14654



to top

>gb|AC167022.4| Mus musculus BAC clone RP23-183A4 from chromosome 8, complete sequence
          Length = 224462

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 221   tacttgtagctacatatttt 240
             ||||||||||||||||||||
Sbjct: 27900 tacttgtagctacatatttt 27881



to top

>emb|AJ404295.1|BSC404295 Borelis schlumbergeri 18S rRNA gene, isolate 191
          Length = 2744

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 249 tcaatcatgttgcaatgaat 268
           ||||||||||||||||||||
Sbjct: 231 tcaatcatgttgcaatgaat 212


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,860,140
Number of Sequences: 3902068
Number of extensions: 3860140
Number of successful extensions: 77572
Number of sequences better than 10.0: 30
Number of HSP's better than 10.0 without gapping: 30
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 77473
Number of HSP's gapped (non-prelim): 99
length of query: 416
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 394
effective length of database: 17,147,199,772
effective search space: 6755996710168
effective search space used: 6755996710168
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top