ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbast33b01 |
|---|---|
| Clone Library Name | barley_pub |
>emb|BX005150.5| Zebrafish DNA sequence from clone CH211-105J21 in linkage group 6, complete sequence Length = 167946 Score = 42.1 bits (21), Expect = 1.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 52 caaccccaattaaacacgcat 72 ||||||||||||||||||||| Sbjct: 149838 caaccccaattaaacacgcat 149818
>gb|AC146484.3| Pan troglodytes BAC clone CH251-454A18 from Y, complete sequence Length = 205077 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 8 tgcagttccaagagcatgga 27 |||||||||||||||||||| Sbjct: 52856 tgcagttccaagagcatgga 52837
>gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome Length = 5373180 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 ccaagagcatggaaccatga 34 |||||||||||||||||||| Sbjct: 1225049 ccaagagcatggaaccatga 1225068
>emb|AL591382.3| Zebrafish DNA sequence from clone BUSM1-105L16 in linkage group 7 Contains the nitr2d_1 gene for novel immune-type receptor 2d, allele 1, the nitr1o_3 gene for novel immune-type receptor 1o, allele 3, the nitr1m_2 gene for novel immune-type receptor 1m, allele 2, the nitr1l_2 gene for novel immune-type receptor 1l, allele 2, a novel immune-type receptor 1 pseudogene, the nitr5_4 gene for novel immune-type receptor 5, allele 4, the nitr4a_2 gene for novel immune-type receptor 4a, allele 2, the nitr1i_2 gene for novel immune-type receptor 1i, allele 2, the nitr1j_1 gene for novel immune-type receptor 1j, allele 1, the nitr1g_1 gene for novel immune-type receptor 1g, allele 1, a novel immune-type receptor 4b pseudogene, a novel gene, the nitr1k_3 gene for novel immune-type receptor 1k, allele 3 and a CpG island, complete sequence Length = 98934 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 230 tgctctgtataattttgcat 249 |||||||||||||||||||| Sbjct: 83757 tgctctgtataattttgcat 83738
>emb|AL591497.2| Zebrafish DNA sequence from clone BUSM1-173M20 in linkage group 7 Contains the nitr1.14, nitr1.17, nitr1.18, nitr2.4, nitr2.6, nitr3r.2, nitr1.13, nitr1.15, nitr1.16, nitr2.5, nitr3.4 and nitr3r.1 genes for novel immune-type receptors and a nitr pseudogene, complete sequence Length = 127998 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 230 tgctctgtataattttgcat 249 |||||||||||||||||||| Sbjct: 14686 tgctctgtataattttgcat 14667
>dbj|BS000561.1| Pan troglodytes chromosome Y clone:PTB-495J17, complete sequences Length = 130326 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 8 tgcagttccaagagcatgga 27 |||||||||||||||||||| Sbjct: 43257 tgcagttccaagagcatgga 43276
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence Length = 23952694 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 8 tgcagttccaagagcatgga 27 |||||||||||||||||||| Sbjct: 23079836 tgcagttccaagagcatgga 23079817
>gb|AC069019.8|AC069019 Mus musculus BAC RP23-455N13 (Roswell Park Cancer Institute Mouse BAC Library) complete sequence Length = 196175 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 gtttatttgttgctctgtat 239 |||||||||||||||||||| Sbjct: 97285 gtttatttgttgctctgtat 97266
>gb|AC012068.5|AC012068 Homo sapiens BAC clone RP11-196J6 from Y, complete sequence Length = 166516 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 8 tgcagttccaagagcatgga 27 |||||||||||||||||||| Sbjct: 97359 tgcagttccaagagcatgga 97378
>emb|AL591418.11| Zebrafish DNA sequence from clone BUSM1-139E19 in linkage group 7, complete sequence Length = 112025 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 230 tgctctgtataattttgcat 249 |||||||||||||||||||| Sbjct: 101774 tgctctgtataattttgcat 101793
>emb|BX284626.3| Mouse DNA sequence from clone RP23-76P19 on chromosome 11, complete sequence Length = 182810 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 gtttatttgttgctctgtat 239 |||||||||||||||||||| Sbjct: 117813 gtttatttgttgctctgtat 117832 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,587,620 Number of Sequences: 3902068 Number of extensions: 2587620 Number of successful extensions: 50315 Number of sequences better than 10.0: 11 Number of HSP's better than 10.0 without gapping: 11 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 50255 Number of HSP's gapped (non-prelim): 60 length of query: 308 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 286 effective length of database: 17,147,199,772 effective search space: 4904099134792 effective search space used: 4904099134792 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
