| Clone Name | rbast28b03 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY103738.1| Zea mays PCO146589 mRNA sequence Length = 1787 Score = 131 bits (66), Expect = 2e-27 Identities = 108/122 (88%) Strand = Plus / Minus Query: 306 gtgccttgcgtgaacttggggtcctcgcacctgtacttgccgtcagggccgatgccaaag 365 |||||||| ||||||||||| ||||||||||||||||| || || |||||||| |||||| Sbjct: 1523 gtgccttgggtgaacttgggatcctcgcacctgtacttaccatcggggccgataccaaag 1464 Query: 366 cccttgggatcggcaaacacgttctccagcagctggcttcgtggggggagcgggctcgcg 425 || ||||| ||||||||||||||||||| ||||||||| || || || ||||||||||| Sbjct: 1463 cctttggggtcggcaaacacgttctccaacagctggctgcgcggcggatgcgggctcgcg 1404 Query: 426 tc 427 || Sbjct: 1403 tc 1402
>ref|XM_471066.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1278 Score = 115 bits (58), Expect = 1e-22 Identities = 112/130 (86%) Strand = Plus / Minus Query: 303 gccgtgccttgcgtgaacttggggtcctcgcacctgtacttgccgtcagggccgatgcca 362 |||||||||||||||||| ||| ||||| |||| |||||| ||||||||||| || ||| Sbjct: 1268 gccgtgccttgcgtgaacaagggatcctcacaccggtacttcccgtcagggccaattcca 1209 Query: 363 aagcccttgggatcggcaaacacgttctccagcagctggcttcgtggggggagcgggctc 422 |||||||||||||| | |||||||| ||||| |||||||| || || ||||||||||| Sbjct: 1208 aagcccttgggatctgagaacacgttttccagaagctggctccggggagggagcgggctt 1149 Query: 423 gcgtcggcga 432 ||||| |||| Sbjct: 1148 gcgtcagcga 1139
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 115 bits (58), Expect = 1e-22 Identities = 112/130 (86%) Strand = Plus / Minus Query: 303 gccgtgccttgcgtgaacttggggtcctcgcacctgtacttgccgtcagggccgatgcca 362 |||||||||||||||||| ||| ||||| |||| |||||| ||||||||||| || ||| Sbjct: 1126393 gccgtgccttgcgtgaacaagggatcctcacaccggtacttcccgtcagggccaattcca 1126334 Query: 363 aagcccttgggatcggcaaacacgttctccagcagctggcttcgtggggggagcgggctc 422 |||||||||||||| | |||||||| ||||| |||||||| || || ||||||||||| Sbjct: 1126333 aagcccttgggatctgagaacacgttttccagaagctggctccggggagggagcgggctt 1126274 Query: 423 gcgtcggcga 432 ||||| |||| Sbjct: 1126273 gcgtcagcga 1126264 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 95 catttcttgggtaaaaaactg 115 ||||||||||||||||||||| Sbjct: 30276636 catttcttgggtaaaaaactg 30276656
>dbj|AK069299.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023012M21, full insert sequence Length = 1736 Score = 115 bits (58), Expect = 1e-22 Identities = 112/130 (86%) Strand = Plus / Minus Query: 303 gccgtgccttgcgtgaacttggggtcctcgcacctgtacttgccgtcagggccgatgcca 362 |||||||||||||||||| ||| ||||| |||| |||||| ||||||||||| || ||| Sbjct: 1408 gccgtgccttgcgtgaacaagggatcctcacaccggtacttcccgtcagggccaattcca 1349 Query: 363 aagcccttgggatcggcaaacacgttctccagcagctggcttcgtggggggagcgggctc 422 |||||||||||||| | |||||||| ||||| |||||||| || || ||||||||||| Sbjct: 1348 aagcccttgggatctgagaacacgttttccagaagctggctccggggagggagcgggctt 1289 Query: 423 gcgtcggcga 432 ||||| |||| Sbjct: 1288 gcgtcagcga 1279
>emb|AL606450.3|OSJN00001 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0020P07, complete sequence Length = 167895 Score = 115 bits (58), Expect = 1e-22 Identities = 112/130 (86%) Strand = Plus / Minus Query: 303 gccgtgccttgcgtgaacttggggtcctcgcacctgtacttgccgtcagggccgatgcca 362 |||||||||||||||||| ||| ||||| |||| |||||| ||||||||||| || ||| Sbjct: 68775 gccgtgccttgcgtgaacaagggatcctcacaccggtacttcccgtcagggccaattcca 68716 Query: 363 aagcccttgggatcggcaaacacgttctccagcagctggcttcgtggggggagcgggctc 422 |||||||||||||| | |||||||| ||||| |||||||| || || ||||||||||| Sbjct: 68715 aagcccttgggatctgagaacacgttttccagaagctggctccggggagggagcgggctt 68656 Query: 423 gcgtcggcga 432 ||||| |||| Sbjct: 68655 gcgtcagcga 68646
>gb|BT018932.1| Zea mays clone Contig65.F mRNA sequence Length = 851 Score = 111 bits (56), Expect = 2e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 308 gccttgcgtgaacttggggtcctcgcacctgtacttgccgtcagggccgatgccaaagcc 367 |||||| | ||||||||| ||||| ||||||||||| || || ||||| || |||||||| Sbjct: 599 gccttgggggaacttgggatcctcccacctgtacttaccatcggggccaataccaaagcc 540 Query: 368 cttgggatcggcaaacacgttctccagcagctggcttcgtggggggagcgggctcgcgtc 427 ||||| ||||||||||||||||||| ||||||||| || ||||| || ||||||||||| Sbjct: 539 tttggggtcggcaaacacgttctccaacagctggctgcgcgggggaagggggctcgcgtc 480
>gb|BT012988.1| Lycopersicon esculentum clone 114208R, mRNA sequence Length = 1692 Score = 83.8 bits (42), Expect = 4e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 306 gtgccttgcgtgaacttggggtcctcgcacctgtacttgccgtcagggccgatgccaaag 365 ||||||| ||||||||||| || || || |||||| | || ||||| || ||||||||| Sbjct: 1423 gtgccttcggtgaacttgggatcttcacatctgtaccttccatcaggcccaatgccaaag 1364 Query: 366 cccttgggatcggcaaacacgttctccagcagctggct 403 ||||| ||||| |||||||||||||| ||||||||||| Sbjct: 1363 ccctttggatcagcaaacacgttctcgagcagctggct 1326
>dbj|AP002004.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-693N9, complete sequence Length = 172081 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 155 attacacagtgatatatgacct 176 |||||||||||||||||||||| Sbjct: 148689 attacacagtgatatatgacct 148710
>gb|AC102873.10| Mus musculus chromosome 17, clone RP24-536C15, complete sequence Length = 155210 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 caacataaattctgtaccaat 38 ||||||||||||||||||||| Sbjct: 150796 caacataaattctgtaccaat 150776
>gb|AC019129.8| Homo sapiens BAC clone RP11-559M23 from 2, complete sequence Length = 172611 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 agcaatgaattacacagtgat 167 ||||||||||||||||||||| Sbjct: 121429 agcaatgaattacacagtgat 121409
>emb|CT571242.10| Mouse DNA sequence from clone RP24-82P13 on chromosome 17, complete sequence Length = 236078 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 caacataaattctgtaccaat 38 ||||||||||||||||||||| Sbjct: 61301 caacataaattctgtaccaat 61321
>emb|AL607004.4|OSJN00129 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNba0093F12, complete sequence Length = 186142 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 95 catttcttgggtaaaaaactg 115 ||||||||||||||||||||| Sbjct: 172949 catttcttgggtaaaaaactg 172969
>emb|AL606683.3|OSJN00089 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0083N12, complete sequence Length = 160989 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 95 catttcttgggtaaaaaactg 115 ||||||||||||||||||||| Sbjct: 26532 catttcttgggtaaaaaactg 26552
>ref|XM_593790.2| PREDICTED: Bos taurus vav 2 protein (LOC515718), partial mRNA Length = 1451 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 400 ggcttcgtggggggagcggg 419 |||||||||||||||||||| Sbjct: 286 ggcttcgtggggggagcggg 267
>gb|AC022062.10| Mus musculus chromosome 5, clone RP23-57P23, complete sequence Length = 235363 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 83 tgaactggagaacatttctt 102 |||||||||||||||||||| Sbjct: 123197 tgaactggagaacatttctt 123178
>gb|AC129598.4| Mus musculus BAC clone RP23-283O5 from chromosome 18, complete sequence Length = 213381 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 aacataaattctgtaccaat 38 |||||||||||||||||||| Sbjct: 142065 aacataaattctgtaccaat 142084
>gb|AC107756.9| Mus musculus chromosome 18, clone RP23-214K19, complete sequence Length = 216911 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 aacataaattctgtaccaat 38 |||||||||||||||||||| Sbjct: 158030 aacataaattctgtaccaat 158011
>gb|DQ125495.1| Bos taurus vav 2 protein mRNA, partial cds Length = 320 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 400 ggcttcgtggggggagcggg 419 |||||||||||||||||||| Sbjct: 41 ggcttcgtggggggagcggg 22
>gb|AF204951.2|AF204951 Ectocarpus siliculosus virus, complete genome Length = 335593 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 369 ttgggatcggcaaacacgtt 388 |||||||||||||||||||| Sbjct: 178294 ttgggatcggcaaacacgtt 178313
>gb|AC154320.2| Mus musculus BAC clone RP23-308E16 from chromosome 13, complete sequence Length = 202134 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 52 atacatgtagagtttactgtagaa 75 |||||||||||| ||||||||||| Sbjct: 22199 atacatgtagagattactgtagaa 22222
>emb|CT009700.8| Mouse DNA sequence from clone RP23-114M15 on chromosome 13, complete sequence Length = 184143 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 52 atacatgtagagtttactgtagaa 75 |||||||||||| ||||||||||| Sbjct: 174998 atacatgtagagattactgtagaa 175021 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,396,520 Number of Sequences: 3902068 Number of extensions: 3396520 Number of successful extensions: 59845 Number of sequences better than 10.0: 21 Number of HSP's better than 10.0 without gapping: 22 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 59776 Number of HSP's gapped (non-prelim): 69 length of query: 432 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 410 effective length of database: 17,147,199,772 effective search space: 7030351906520 effective search space used: 7030351906520 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)