| Clone Name | rbast27e10 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X95256.1|HVXYLISOG H.vulgare xylose isomerase gene Length = 4473 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 37 tactccctccgatccatattaattgt 62 |||||||||||||||||||||||||| Sbjct: 1552 tactccctccgatccatattaattgt 1577 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 36 gtactccctccgatccatattaattgtagcccatttagta 75 ||||||||||||| |||||||||||| || |||||||| Sbjct: 1625 gtactccctccgagtcatattaattgtcgctgatttagta 1586
>ref|XM_683501.1| PREDICTED: Danio rerio similar to Kruppel-like factor 12 isoform a (LOC560110), mRNA Length = 1497 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||||||||||||||||||||| Sbjct: 664 tcctcttcttcatcatcttcatcctc 689
>gb|AC160527.9| Mus musculus chromosome 7, clone RP24-269P21, complete sequence Length = 161504 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||||||||| |||||||||||| Sbjct: 38490 cctcctcttcttcatcctcttcatcctcc 38518
>ref|XM_987483.1| PREDICTED: Mus musculus similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30) (LOC671507), mRNA Length = 1254 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||||||||| |||||||||||| Sbjct: 700 cctcctcttcttcatcctcttcatcctcc 672
>ref|XM_986380.1| PREDICTED: Mus musculus similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30) (LOC666836), mRNA Length = 1254 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||||||||| |||||||||||| Sbjct: 700 cctcctcttcttcatcctcttcatcctcc 672
>ref|XM_846313.1| PREDICTED: Canis familiaris similar to Major centromere autoantigen B (Centromere protein B) (CENP-B) (LOC485791), mRNA Length = 2712 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||| ||||||||||||||||||||| Sbjct: 1687 cctcctcatcttcatcatcttcatcctcc 1659
>ref|XM_719825.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY04596) partial mRNA Length = 3090 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||||||||| |||||||||||| Sbjct: 1825 cctcctcttcttcatcttcttcatcctcc 1797
>gb|AC102102.7| Mus musculus chromosome 16, clone RP23-79F12, complete sequence Length = 194828 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||||||||||||||||||||| Sbjct: 142481 cctcctcttcttcatcatcttcatc 142505
>gb|AC154182.2| Mus musculus BAC clone RP23-471C19 from chromosome 16, complete sequence Length = 180782 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||||||||||||||||||||| Sbjct: 180145 cctcctcttcttcatcatcttcatc 180121
>gb|DQ176000.1| Xenopus laevis RPGR ORF15 isoform mRNA, partial cds Length = 1845 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||||||||||||||| ||||||||| Sbjct: 1492 cctcctcttcttcatcatcctcatcctcc 1464 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||||||||| ||| |||||||| Sbjct: 901 cctcctcttcttcatcctctccatcctcc 873
>ref|XM_639965.1| Dictyostelium discoideum hypothetical protein (DDB0217102), partial mRNA Length = 1344 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctc 400 ||||||||||||||||||| |||||||| Sbjct: 839 cctcctcttcttcatcatcatcatcctc 866
>ref|XM_639265.1| Dictyostelium discoideum hypothetical protein (DDB0217411), partial mRNA Length = 1344 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctc 400 ||||||||||||||||||| |||||||| Sbjct: 839 cctcctcttcttcatcatcatcatcctc 866
>gb|AF047659.1| Caenorhabditis elegans cosmid K07H8, complete sequence Length = 37923 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctc 400 ||||||||||||| |||||||||||||| Sbjct: 28682 cctcctcttcttcttcatcttcatcctc 28709
>gb|AC122397.2| Mus musculus BAC clone RP24-90D21 from chromosome 15, complete sequence Length = 181742 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctc 400 |||||||||||||||| ||||||||||| Sbjct: 41786 cctcctcttcttcatcctcttcatcctc 41813
>emb|CR616535.1| full-length cDNA clone CS0DI034YC12 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1297 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 374 ctcctcttcttcatcatcttcatcctcc 401 ||||||||||||| |||||||||||||| Sbjct: 746 ctcctcttcttcaccatcttcatcctcc 719
>ref|NM_068990.2| Caenorhabditis elegans K07H8.10 (K07H8.10) mRNA, complete cds Length = 2694 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctc 400 ||||||||||||| |||||||||||||| Sbjct: 1331 cctcctcttcttcttcatcttcatcctc 1304
>gb|AC116984.2| Dictyostelium discoideum chromosome 2 map 2567470-3108875 strain AX4, complete sequence Length = 541399 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctc 400 ||||||||||||||||||| |||||||| Sbjct: 118905 cctcctcttcttcatcatcatcatcctc 118878
>gb|AC068338.14| Homo sapiens chromosome 15, clone RP11-817O13, complete sequence Length = 174192 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 374 ctcctcttcttcatcatcttcatcctcc 401 ||||||||||||| |||||||||||||| Sbjct: 53796 ctcctcttcttcaccatcttcatcctcc 53769
>gb|AC105137.17| Homo sapiens chromosome 15, clone CTD-2562G15, complete sequence Length = 178059 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Plus Query: 374 ctcctcttcttcatcatcttcatcctcc 401 ||||||||||||| |||||||||||||| Sbjct: 18580 ctcctcttcttcaccatcttcatcctcc 18607
>emb|BX914207.15| Zebrafish DNA sequence from clone DKEY-158P11 in linkage group 4, complete sequence Length = 92140 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Plus Query: 374 ctcctcttcttcatcatcttcatcctcc 401 ||||||||||||||| |||||||||||| Sbjct: 41924 ctcctcttcttcatcctcttcatcctcc 41951
>gb|U00176.1|U00176 Dictyostelium mucoroides DMUC2 clone p288m2 G1-like and G5-like ORFs' proteins, complete cds Length = 6019 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctc 400 |||||||||| ||||||||||||||||| Sbjct: 4085 cctcctcttcatcatcatcttcatcctc 4058
>ref|NM_118147.3| Arabidopsis thaliana transcription factor/ transcription initiation factor AT4G20280 mRNA, complete cds Length = 1109 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatc 397 ||||||||||||||||||||||| Sbjct: 415 tcctcttcttcatcatcttcatc 393
>gb|AY517523.1| Holosticha sp. HL-2004 eukaryotic release factor 1 (eRF1) gene, complete cds; macronuclear Length = 3320 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Plus Query: 367 ttggagcctcctcttcttcatcatcttcatc 397 ||||||| |||||||| |||||||||||||| Sbjct: 525 ttggagcatcctcttcatcatcatcttcatc 555
>ref|XM_633046.1| Dictyostelium discoideum hypothetical protein (DDB0186583), partial mRNA Length = 3645 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 378 tcttcttcatcatcttcatcctc 400 ||||||||||||||||||||||| Sbjct: 3121 tcttcttcatcatcttcatcctc 3143 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcat 396 |||| ||||||||||||||||||| Sbjct: 3140 cctcatcttcttcatcatcttcat 3163
>ref|XM_630416.1| Dictyostelium discoideum hypothetical protein (DDB0189129), partial mRNA Length = 2475 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatc 397 ||||||||||||||||||||||| Sbjct: 2372 tcctcttcttcatcatcttcatc 2350 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 378 tcttcttcatcatcttcatc 397 |||||||||||||||||||| Sbjct: 2276 tcttcttcatcatcttcatc 2257
>ref|XM_509847.1| PREDICTED: Pan troglodytes apoptotic chromatin condensation inducer 1 (LOC452792), mRNA Length = 3903 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctcc 401 |||||||||||||||||||| |||||| Sbjct: 1001 tcctcttcttcatcatcttcttcctcc 975
>ref|XM_415994.1| PREDICTED: Gallus gallus similar to Wiskott-Aldrich syndrome gene-like protein; neural Wiskott-Aldrich syndrome protein; Wiskott-Aldrich syndrome gene-like (LOC417750), mRNA Length = 2616 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 378 tcttcttcatcatcttcatcctc 400 ||||||||||||||||||||||| Sbjct: 1649 tcttcttcatcatcttcatcctc 1627
>gb|AC116595.4| Mus musculus BAC clone RP24-127G9 from chromosome 18, complete sequence Length = 158788 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Plus Query: 396 tcctccgctgccttcctcctcttcttg 422 |||||| |||||||||||||||||||| Sbjct: 27289 tcctccactgccttcctcctcttcttg 27315
>ref|XM_601209.2| PREDICTED: Bos taurus similar to two AAA domain containing protein, transcript variant 1 (LOC522920), mRNA Length = 5241 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatc 397 ||||||||||||||||||||||| Sbjct: 782 tcctcttcttcatcatcttcatc 760
>ref|XM_864276.1| PREDICTED: Bos taurus similar to two AAA domain containing protein, transcript variant 2 (LOC522920), mRNA Length = 5619 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatc 397 ||||||||||||||||||||||| Sbjct: 782 tcctcttcttcatcatcttcatc 760
>gb|AY463612.1| Arabidopsis thaliana TAF11 (TAF11) mRNA, partial cds Length = 630 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatc 397 ||||||||||||||||||||||| Sbjct: 248 tcctcttcttcatcatcttcatc 226
>ref|XM_854177.1| PREDICTED: Canis familiaris similar to Wiskott-Aldrich syndrome gene-like protein, transcript variant 3 (LOC475213), mRNA Length = 4314 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 378 tcttcttcatcatcttcatcctc 400 ||||||||||||||||||||||| Sbjct: 1725 tcttcttcatcatcttcatcctc 1703
>ref|XM_532445.2| PREDICTED: Canis familiaris similar to Wiskott-Aldrich syndrome gene-like protein, transcript variant 1 (LOC475213), mRNA Length = 4311 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 378 tcttcttcatcatcttcatcctc 400 ||||||||||||||||||||||| Sbjct: 1722 tcttcttcatcatcttcatcctc 1700
>ref|XM_721035.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY05640) partial mRNA Length = 708 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 378 tcttcttcatcatcttcatcctc 400 ||||||||||||||||||||||| Sbjct: 638 tcttcttcatcatcttcatcctc 616 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 381 tcttcatcatcttcatcctc 400 |||||||||||||||||||| Sbjct: 611 tcttcatcatcttcatcctc 592
>ref|XM_661097.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.50054) partial mRNA Length = 1335 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 375 tcctcttcttcatcatcttcatc 397 ||||||||||||||||||||||| Sbjct: 1063 tcctcttcttcatcatcttcatc 1085
>emb|Y00354.1|XLVIT2A Xenopus laevis gene encoding vitellogenin A2 Length = 18488 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 378 tcttcttcatcatcttcatcctc 400 ||||||||||||||||||||||| Sbjct: 11373 tcttcttcatcatcttcatcctc 11395 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 378 tcttcttcatcatcttcatcctc 400 ||||||||||||||||||||||| Sbjct: 11343 tcttcttcatcatcttcatcctc 11365
>gb|AY051084.1| Arabidopsis thaliana unknown protein (At4g20280) mRNA, complete cds Length = 664 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatc 397 ||||||||||||||||||||||| Sbjct: 248 tcctcttcttcatcatcttcatc 226
>gb|AF370141.1| Arabidopsis thaliana unknown protein (At4g20280) mRNA, complete cds Length = 1089 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatc 397 ||||||||||||||||||||||| Sbjct: 415 tcctcttcttcatcatcttcatc 393
>gb|AC153155.6| Mus musculus BAC clone RP23-25J23 from chromosome 18, complete sequence Length = 227880 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 396 tcctccgctgccttcctcctcttcttg 422 |||||| |||||||||||||||||||| Sbjct: 31523 tcctccactgccttcctcctcttcttg 31497
>emb|AL161552.2|ATCHRIV52 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 52 Length = 198427 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatc 397 ||||||||||||||||||||||| Sbjct: 151610 tcctcttcttcatcatcttcatc 151588
>emb|AL022224.1|ATF1C12 Arabidopsis thaliana DNA chromosome 4, BAC clone F1C12 (ESSA project) Length = 111945 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatc 397 ||||||||||||||||||||||| Sbjct: 84187 tcctcttcttcatcatcttcatc 84165
>emb|AJ238444.1|BMA238444 Brugia malayi mRNA for TBP-like factor, partial Length = 1467 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatc 397 ||||||||||||||||||||||| Sbjct: 866 tcctcttcttcatcatcttcatc 844
>emb|BX827804.1|CNS0A2XM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH23ZC05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1031 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatc 397 ||||||||||||||||||||||| Sbjct: 342 tcctcttcttcatcatcttcatc 320
>emb|BX828535.1|CNS0A2L4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL14ZD08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1017 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatc 397 ||||||||||||||||||||||| Sbjct: 367 tcctcttcttcatcatcttcatc 345
>gb|AF238326.1|AF238326 Arabidopsis thaliana putative TATA binding protein associated factor 24kDa subunit mRNA, complete cds Length = 633 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatc 397 ||||||||||||||||||||||| Sbjct: 248 tcctcttcttcatcatcttcatc 226
>gb|AF124726.1|AF124726 Homo sapiens acinusL mRNA, complete cds Length = 4935 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctcc 401 |||||||||||||||||||| |||||| Sbjct: 1187 tcctcttcttcatcatcttcttcctcc 1161
>emb|AL132780.5|CNS01DTK Human chromosome 14 DNA sequence BAC R-298I3 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 191946 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Plus Query: 375 tcctcttcttcatcatcttcatcctcc 401 |||||||||||||||||||| |||||| Sbjct: 184446 tcctcttcttcatcatcttcttcctcc 184472
>dbj|AB014570.2| Homo sapiens mRNA for KIAA0670 protein, partial cds Length = 4444 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctcc 401 |||||||||||||||||||| |||||| Sbjct: 697 tcctcttcttcatcatcttcttcctcc 671
>ref|NM_014977.1| Homo sapiens apoptotic chromatin condensation inducer 1 (ACIN1), mRNA Length = 4935 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctcc 401 |||||||||||||||||||| |||||| Sbjct: 1187 tcctcttcttcatcatcttcttcctcc 1161
>gb|M18061.1|XELVITC Xenopus laevis vitelloginin gene, complete cds Length = 5618 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 378 tcttcttcatcatcttcatcctc 400 ||||||||||||||||||||||| Sbjct: 3443 tcttcttcatcatcttcatcctc 3465 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 378 tcttcttcatcatcttcatcctc 400 ||||||||||||||||||||||| Sbjct: 3413 tcttcttcatcatcttcatcctc 3435
>ref|XM_641716.1| Dictyostelium discoideum nucleomorphin (DDB0231257), partial mRNA Length = 1023 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||||||||| ||||||||||| Sbjct: 413 tcctcttcttcatcttcttcatcctc 388
>gb|AE014834.1| Plasmodium falciparum 3D7 chromosome 10 section 6 of 7 of the complete sequence Length = 253001 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 378 tcttcttcatcatcttcatcct 399 |||||||||||||||||||||| Sbjct: 150417 tcttcttcatcatcttcatcct 150396
>ref|XM_457821.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0C03707g) partial mRNA Length = 735 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttc 394 |||||||||||||||||||||| Sbjct: 706 cctcctcttcttcatcatcttc 685
>ref|NM_010880.3| Mus musculus nucleolin (Ncl), mRNA Length = 8257 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 732 tcctcttcctcatcatcttcatcctc 707
>gb|AF140042.2| Dictyostelium discoideum putative calmodulin-binding protein CaM-BP38 mRNA, complete cds Length = 1557 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||||||||| ||||||||||| Sbjct: 899 tcctcttcttcatcttcttcatcctc 874
>gb|AC150896.6| Mus musculus BAC clone RP23-414N3 from chromosome 1, complete sequence Length = 207503 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttc 394 |||||||||||||||||||||| Sbjct: 197913 cctcctcttcttcatcatcttc 197892
>gb|BC014285.1| Mus musculus nucleolin, mRNA (cDNA clone IMAGE:3667173), with apparent retained intron Length = 1231 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 575 tcctcttcctcatcatcttcatcctc 550
>gb|BC012657.1| Mus musculus nucleolin, mRNA (cDNA clone IMAGE:3983668), with apparent retained intron Length = 1231 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 575 tcctcttcctcatcatcttcatcctc 550
>emb|Z82286.1|CEW02A2 Caenorhabditis elegans Cosmid W02A2, complete sequence Length = 35879 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Plus Query: 375 tcctcttcttcatcatcttcatcctc 400 ||||||||||| |||||||||||||| Sbjct: 27959 tcctcttcttcctcatcttcatcctc 27984
>ref|XM_725583.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY02756) partial mRNA Length = 3783 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcc 398 |||||||||| ||||||||||||||| Sbjct: 319 cctcctcttcatcatcatcttcatcc 294
>emb|CR684959.2|CNS0FRGR Tetraodon nigroviridis full-length cDNA Length = 1856 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Plus Query: 372 gcctcctcttcttcatcatcttcatc 397 |||||||||||||||||||| ||||| Sbjct: 398 gcctcctcttcttcatcatcgtcatc 423
>ref|XM_732656.1| Plasmodium chabaudi chabaudi hypothetical protein (PC402676.00.0) partial mRNA Length = 1028 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||||||||||||||| ||||| Sbjct: 964 tcctcttcttcatcatcttcgtcctc 939
>gb|BC023742.1| Mus musculus cDNA clone MGC:38531 IMAGE:5353453, complete cds Length = 2433 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttc 394 |||||||||||||||||||||| Sbjct: 619 cctcctcttcttcatcatcttc 598
>gb|BC023708.1| Mus musculus cDNA clone MGC:38398 IMAGE:5345780, complete cds Length = 2433 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttc 394 |||||||||||||||||||||| Sbjct: 619 cctcctcttcttcatcatcttc 598
>ref|XM_739910.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000794.04.0) partial mRNA Length = 1176 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||||||||||||||| ||||| Sbjct: 257 tcctcttcttcatcatcttcttcctc 232
>gb|AC136953.17| Medicago truncatula clone mth2-20h6, complete sequence Length = 94019 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 ||||||||||||||||||||| |||| Sbjct: 63474 tcctcttcttcatcatcttcagcctc 63449
>gb|AC152068.17| Medicago truncatula clone mth2-29p8, complete sequence Length = 118589 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Plus Query: 375 tcctcttcttcatcatcttcatcctc 400 ||||||||||||||||||||| |||| Sbjct: 90506 tcctcttcttcatcatcttcagcctc 90531
>gb|AC155341.1| Brassica rapa subsp. pekinensis chromosome 6 clone KBrH004D11, complete sequence Length = 106476 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 372 gcctcctcttcttcatcatctt 393 |||||||||||||||||||||| Sbjct: 50444 gcctcctcttcttcatcatctt 50465
>gb|AC102609.7| Mus musculus, clone RP23-403I3, complete sequence Length = 208575 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 143668 tcctcttcctcatcatcttcatcctc 143643
>gb|AY129950.1| Homo sapiens cAMP-specific phosphodiesterase 8B (PDE8B) gene, alternatively spliced, complete cds Length = 216589 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttc 394 |||||||||||||||||||||| Sbjct: 85311 cctcctcttcttcatcatcttc 85332
>emb|Z15116.1|HVPAZXG H.vulgare pazx gene encoding protein zx Length = 3283 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 37 tactccctccgatccatattaa 58 |||||||||||||||||||||| Sbjct: 1410 tactccctccgatccatattaa 1431
>emb|X07699.1|MMNUCLEO Mouse nucleolin gene Length = 11478 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 4161 tcctcttcctcatcatcttcatcctc 4136
>emb|CR382135.1| Debaryomyces hansenii chromosome C of strain CBS767 of Debaryomyces hansenii Length = 1592360 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttc 394 |||||||||||||||||||||| Sbjct: 301756 cctcctcttcttcatcatcttc 301735
>emb|AL646001.7| Mouse DNA sequence from clone RP23-10B17 on chromosome 11 Contains the 5' end of a variant of the Odz2 gene for odd Oz/ten-m homolog 2 (Drosophila), complete sequence Length = 194171 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttc 394 |||||||||||||||||||||| Sbjct: 20571 cctcctcttcttcatcatcttc 20592
>gb|BC005460.1| Mus musculus nucleolin, mRNA (cDNA clone MGC:6363 IMAGE:3495665), complete cds Length = 3005 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 663 tcctcttcctcatcatcttcatcctc 638 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 552 tcctcttcctcatcatcttcatcctc 527
>gb|AC129928.3| Homo sapiens chromosome 8, clone RP11-1112C19, complete sequence Length = 141478 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Plus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||||||||||||||| ||||| Sbjct: 50303 tcctcttcttcatcatcttcttcctc 50328
>emb|AJ438614.1|NTA438614 Nicotiana tabacum mRNA for nucleosome assembly protein 1 - like protein 2 Length = 1475 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 1003 tcctcttcatcatcatcttcatcctc 978
>dbj|AK144894.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched library, clone:G730049H03 product:nucleolin, full insert sequence Length = 5362 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 642 tcctcttcctcatcatcttcatcctc 617
>dbj|AK166681.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0002A07 product:nucleolin, full insert sequence Length = 2401 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 642 tcctcttcctcatcatcttcatcctc 617
>dbj|AK163275.1| Mus musculus 2 cells egg cDNA, RIKEN full-length enriched library, clone:B020008K19 product:nucleolin, full insert sequence Length = 2521 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 643 tcctcttcctcatcatcttcatcctc 618
>gb|AC022422.5| Homo sapiens chromosome 5 clone CTD-2199L4, complete sequence Length = 245697 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttc 394 |||||||||||||||||||||| Sbjct: 42467 cctcctcttcttcatcatcttc 42488
>dbj|AK168623.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched library, clone:I920039B08 product:nucleolin, full insert sequence Length = 2390 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 642 tcctcttcctcatcatcttcatcctc 617
>dbj|AK161706.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length enriched library, clone:5730589I21 product:nucleolin, full insert sequence Length = 2929 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 652 tcctcttcctcatcatcttcatcctc 627
>dbj|AK165167.1| Mus musculus 8 cells embryo 8 cells cDNA, RIKEN full-length enriched library, clone:E860016D17 product:nucleolin, full insert sequence Length = 3073 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 642 tcctcttcctcatcatcttcatcctc 617
>dbj|AK168579.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched library, clone:I920036J10 product:nucleolin, full insert sequence Length = 2390 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 642 tcctcttcctcatcatcttcatcctc 617
>dbj|AK161597.1| Mus musculus 6 days neonate head cDNA, RIKEN full-length enriched library, clone:5430406C13 product:nucleolin, full insert sequence Length = 2391 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 642 tcctcttcctcatcatcttcatcctc 617
>gb|AY244513.1| Triticum monococcum cultivar G2528 tousled-like kinase (MTK4) gene, partial cds Length = 1053 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Plus Query: 37 tactccctccgatccatattaattgt 62 ||||||||||||||||||||| |||| Sbjct: 788 tactccctccgatccatattacttgt 813
>gb|AC148340.3| Medicago truncatula chromosome 2 BAC clone mth2-22d10, complete sequence Length = 105618 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Plus Query: 375 tcctcttcttcatcatcttcatcctc 400 ||||||||||||||||||||| |||| Sbjct: 14184 tcctcttcttcatcatcttcaacctc 14209
>dbj|AK088402.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430014O05 product:nucleolin, full insert sequence Length = 2390 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 642 tcctcttcctcatcatcttcatcctc 617
>dbj|AK029128.1| Mus musculus 10 days neonate skin cDNA, RIKEN full-length enriched library, clone:4732495B18 product:nucleolin, full insert sequence Length = 3255 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 642 tcctcttcctcatcatcttcatcctc 617
>dbj|AK050958.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length enriched library, clone:D030044N17 product:nucleolin, full insert sequence Length = 2327 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 29 tcctcttcctcatcatcttcatcctc 4
>dbj|AK028681.1| Mus musculus 10 days neonate skin cDNA, RIKEN full-length enriched library, clone:4732433L19 product:nucleolin, full insert sequence Length = 2388 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 642 tcctcttcctcatcatcttcatcctc 617
>dbj|AK031606.1| Mus musculus 13 days embryo male testis cDNA, RIKEN full-length enriched library, clone:6030459G24 product:nucleolin, full insert sequence Length = 3274 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 678 tcctcttcctcatcatcttcatcctc 653
>dbj|AK083307.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:C920001J17 product:nucleolin, full insert sequence Length = 2399 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 652 tcctcttcctcatcatcttcatcctc 627
>ref|NM_070164.2| Caenorhabditis elegans abnormal RECombination family member (rec-8) (rec-8) mRNA, complete cds Length = 2439 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 ||||||||||| |||||||||||||| Sbjct: 1601 tcctcttcttcctcatcttcatcctc 1576
>gb|AF318184.1|AF318184 Mus musculus nucleolin mRNA, complete cds Length = 2412 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||| ||||||||||||||||| Sbjct: 644 tcctcttcctcatcatcttcatcctc 619
>gb|BC027405.1| Mus musculus, clone IMAGE:4952946, mRNA Length = 2422 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttc 394 |||||||||||||||||||||| Sbjct: 608 cctcctcttcttcatcatcttc 587
>gb|BC021515.1| Mus musculus, clone IMAGE:5352275, mRNA Length = 2433 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttc 394 |||||||||||||||||||||| Sbjct: 619 cctcctcttcttcatcatcttc 598
>gb|AC022414.8| Homo sapiens chromosome 5 clone CTC-316M18, complete sequence Length = 128811 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttc 394 |||||||||||||||||||||| Sbjct: 3786 cctcctcttcttcatcatcttc 3765
>ref|XM_221004.3| PREDICTED: Rattus norvegicus phospholipase C, delta 3 (predicted) (Plcd3_predicted), mRNA Length = 2953 Score = 44.1 bits (22), Expect = 0.41 Identities = 28/30 (93%) Strand = Plus / Minus Query: 372 gcctcctcttcttcatcatcttcatcctcc 401 ||||||||||| || ||||||||||||||| Sbjct: 2102 gcctcctcttcatcttcatcttcatcctcc 2073
>emb|AJ011926.1|HVU011926 Hordeum vulgare mRNA for Mg-protoporphyrin IX, partial Length = 1454 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 37 tactccctccgatccatattaa 58 |||||||||||||||||||||| Sbjct: 1398 tactccctccgatccatattaa 1419
>gb|AY631855.1| Dictyostelium discoideum nucleomorphin B (numB) mRNA, complete cds Length = 2318 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||||||||| ||||||||||| Sbjct: 1661 tcctcttcttcatcttcttcatcctc 1636
>emb|BX005358.16| Zebrafish DNA sequence from clone DKEY-161F12 in linkage group 20, complete sequence Length = 181198 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||||||||||||||| ||||| Sbjct: 117471 tcctcttcttcatcatcttcttcctc 117446
>gb|AC138328.3| Mus musculus BAC clone RP23-378F20 from 1, complete sequence Length = 153109 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttc 394 |||||||||||||||||||||| Sbjct: 13776 cctcctcttcttcatcatcttc 13755
>gb|AY583215.1| Danio rerio clone B32 N-myc-like protein mRNA, complete cds Length = 2391 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||||||||||||||| ||||| Sbjct: 754 tcctcttcttcatcatcttcttcctc 729
>dbj|AP005362.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1574E2, complete sequence Length = 219049 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||||||||||||||| ||||| Sbjct: 203600 tcctcttcttcatcatcttcttcctc 203575
>dbj|AP003694.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1931E2, complete sequence Length = 159287 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctc 400 |||||||||||||||||||| ||||| Sbjct: 16666 tcctcttcttcatcatcttcttcctc 16641
>ref|XM_632556.1| Dictyostelium discoideum homeodomain (HOX) containing protein (DDB0220477), partial mRNA Length = 2541 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||||||||||||||| ||||| Sbjct: 1615 cctcctcttcttcatcatcatcatc 1591
>ref|XM_641540.1| Dictyostelium discoideum putative GATA-binding transcription factor (DDB0220467), partial mRNA Length = 3021 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||||||||| ||||||||||| Sbjct: 2807 cctcctcttcttcctcatcttcatc 2831
>gb|AC107704.8| Mus musculus chromosome 7, clone RP24-121L4, complete sequence Length = 194458 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 16793 cctcctcttcctcatcctcttcatcctcc 16765
>ref|XM_637656.1| Dictyostelium discoideum hypothetical protein (DDB0217946), partial mRNA Length = 2715 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 381 tcttcatcatcttcatcctcc 401 ||||||||||||||||||||| Sbjct: 1706 tcttcatcatcttcatcctcc 1686
>gb|AC170189.2| Mus musculus BAC clone RP23-103L12 from chromosome 3, complete sequence Length = 204731 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||| |||||||||||||| |||||| Sbjct: 15788 cctcctcatcttcatcatcttcctcctcc 15816
>gb|AC167972.3| Mus musculus BAC clone RP24-73H24 from chromosome 13, complete sequence Length = 224330 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||| ||||||||||||||||| Sbjct: 146112 cctcctcatcttcatcatcttcatc 146136
>ref|XM_508009.1| PREDICTED: Pan troglodytes 5'-nucleotidase, cytosolic II (LOC450706), mRNA Length = 1551 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatc 397 |||||||||| |||||||||||||| Sbjct: 1540 cctcctcttcatcatcatcttcatc 1516
>ref|XM_507879.1| PREDICTED: Pan troglodytes similar to Pro-neuregulin-3 precursor (Pro-NRG3) (LOC450561), mRNA Length = 654 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 372 gcctcctcttcttcatcatcttcatcctccgct 404 |||||||||||||| || ||||| ||||||||| Sbjct: 358 gcctcctcttcttcctcttcttcctcctccgct 390
>ref|NM_190784.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 807 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||||||||| |||||| ||||| Sbjct: 408 cctcctcttcttcatcctcttcaccctcc 436
>gb|BC083067.1| Mus musculus high mobility group box 1, mRNA (cDNA clone MGC:103168 IMAGE:5372544), complete cds Length = 1252 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 676 cctcctcttcctcatcctcttcatcctcc 648
>gb|BC085090.1| Mus musculus high mobility group box 1, mRNA (cDNA clone MGC:103169 IMAGE:6485915), complete cds Length = 1283 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 709 cctcctcttcctcatcctcttcatcctcc 681
>gb|AC109149.15| Mus musculus chromosome 19, clone RP24-178F17, complete sequence Length = 176668 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || ||||||||||||||| Sbjct: 26939 cctcctcttcttcctcctcttcttcctcctct-tcttcctcctcttctt 26986 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || ||||||||||||||| Sbjct: 26927 cctcctcttcttcctcctcttcttcctcctct-tcttcctcctcttctt 26974 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || ||||||||||||||| Sbjct: 26903 cctcctcttcttcctcttcttcttcctcctct-tcttcctcctcttctt 26950 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || ||||||||||||||| Sbjct: 26867 cctcctcttcttcctcctcttcttcctcctct-tcttcctcctcttctt 26914 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || ||||||||||||||| Sbjct: 26855 cctcctcttcttcctcctcttcttcctcctct-tcttcctcctcttctt 26902 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || ||||||||||||||| Sbjct: 26843 cctcctcttcttcctcctcttcttcctcctct-tcttcctcctcttctt 26890
>gb|AC102923.10| Mus musculus chromosome 1, clone RP24-262J2, complete sequence Length = 159541 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || ||||||||||||||| Sbjct: 31272 cctcctcttcttcctcctcttcttcctcctct-tcttcctcctcttctt 31225 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || ||||||||||||||| Sbjct: 31215 cctcctcttcttcctcctcttcttcctcctct-tcttcctcctcttctt 31168 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || | |||||||||||||| Sbjct: 31203 cctcctcttcttcctcctcttcttcctcctcttc-ttcctcctcttctt 31156
>gb|AE014851.1| Plasmodium falciparum 3D7 chromosome 12, section 8 of 9 of the complete sequence Length = 251762 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||| |||||||||||||| |||||| Sbjct: 236742 cctcctcctcttcatcatcttcctcctcc 236714
>gb|AC119406.6| Trypanosoma brucei chromosome 8 clone RPCI93-28L1, complete sequence Length = 134874 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||||||||| |||||||||| |||| Sbjct: 89826 cctcctcttcttcttcatcttcatactcc 89798
>gb|CP000071.1| Trypanosoma brucei chromosome 8, complete sequence Length = 2481190 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||||||||| |||||||||| |||| Sbjct: 1016833 cctcctcttcttcttcatcttcatactcc 1016805
>gb|AC164622.3| Mus musculus BAC clone CH36-287E13 from chromosome 13, complete sequence Length = 174691 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||| ||||||||||||||||| Sbjct: 117163 cctcctcatcttcatcatcttcatc 117139
>gb|AC152063.5| Mus musculus BAC clone RP23-204I16 from chromosome 12, complete sequence Length = 209416 Score = 42.1 bits (21), Expect = 1.6 Identities = 40/45 (88%), Gaps = 1/45 (2%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctccgctgccttcctcctcttc 419 ||||||||||| |||||||| |||||| || ||||||||||||| Sbjct: 98417 tcctcttcttcctcatcttcctcctcctct-tcttcctcctcttc 98374 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 378 tcttcttcatcatcttcatcctcc 401 ||||||||||||||||| |||||| Sbjct: 98147 tcttcttcatcatcttcctcctcc 98124
>gb|BC081839.1| Rattus norvegicus high mobility group box 1, mRNA (cDNA clone MGC:93599 IMAGE:7132958), complete cds Length = 2256 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 658 cctcctcttcctcatcctcttcatcctcc 630
>gb|BC077321.1| Xenopus laevis MGC80275 protein, mRNA (cDNA clone MGC:80275 IMAGE:5073384), complete cds Length = 2574 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||| ||||||||||| ||||||||| Sbjct: 1063 cctcctcctcttcatcatcatcatcctcc 1035
>gb|AC102714.16| Mus musculus chromosome 5, clone RP24-298D13, complete sequence Length = 165774 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 108562 cctcctcttcctcatcctcttcatcctcc 108590
>gb|AC139062.10| Mus musculus chromosome 17, clone RP23-69L11, complete sequence Length = 136224 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||||||||| ||||| |||||| Sbjct: 14634 cctcctcttcttcatcctcttcttcctcc 14606
>gb|AC118627.6| Mus musculus chromosome 15, clone RP24-91E8, complete sequence Length = 256158 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 134357 cctcctcttcctcatcctcttcatcctcc 134329
>gb|AC133583.13| Mus musculus chromosome 12, clone RP24-444A9, complete sequence Length = 123042 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatc 397 |||||||||| |||||||||||||| Sbjct: 80508 cctcctcttcctcatcatcttcatc 80484
>gb|AC128859.4| Rattus norvegicus 10 BAC CH230-436I22 (Children's Hospital Oakland Research Institute) complete sequence Length = 156078 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||||||||| ||||| |||||| Sbjct: 100329 cctcctcttcttcatcttcttcttcctcc 100357
>gb|AC102509.6| Mus musculus chromosome 7, clone RP24-327G7, complete sequence Length = 186990 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 37807 cctcctcttcctcatcctcttcatcctcc 37835
>ref|NM_010439.2| Mus musculus high mobility group box 1 (Hmgb1), mRNA Length = 2309 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 754 cctcctcttcctcatcctcttcatcctcc 726
>gb|BC061779.1| Rattus norvegicus high mobility group box 1, mRNA (cDNA clone MGC:72533 IMAGE:5623285), complete cds Length = 1214 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 646 cctcctcttcctcatcctcttcatcctcc 618
>gb|BC010854.2| Homo sapiens amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65), transcript variant 2, mRNA (cDNA clone MGC:9072 IMAGE:3905603), complete cds Length = 2646 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||| ||||||||||| ||||||||| Sbjct: 606 cctcctcctcttcatcatcatcatcctcc 578
>gb|AC120006.12| Mus musculus chromosome 19, clone RP24-176M2, complete sequence Length = 181007 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 160455 cctcctcttcctcatcctcttcatcctcc 160483
>ref|NG_005439.2| Mus musculus high mobility group protein 1-like (LOC629372) pseudogene on chromosome 19 Length = 1439 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 803 cctcctcttcctcatcctcttcatcctcc 775
>ref|NG_005430.2| Mus musculus high mobility group box 1 (Hmgb1) pseudogene (LOC654442) on chromosome 11 Length = 836 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 698 cctcctcttcctcatcctcttcatcctcc 670 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 378 tcttcttcatcatcttcatc 397 |||||||||||||||||||| Sbjct: 720 tcttcttcatcatcttcatc 701
>gb|AC135509.2| Mus musculus BAC clone RP24-448I12 from chromosome 17, complete sequence Length = 141307 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 130415 cctcctcttcctcatcctcttcatcctcc 130443
>ref|NM_175229.2| Mus musculus serine/arginine repetitive matrix 2 (Srrm2), mRNA Length = 8548 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||| ||||||||||||||||| Sbjct: 7418 cctcctcctcttcatcatcttcatc 7442
>ref|XM_658726.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN6214.2), mRNA Length = 1491 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 381 tcttcatcatcttcatcctcc 401 ||||||||||||||||||||| Sbjct: 1457 tcttcatcatcttcatcctcc 1437
>ref|NM_020090.1| Rattus norvegicus solute carrier family 24 (sodium/potassium/calcium exchanger), member 1 (Slc24a1), mRNA Length = 3550 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||| |||||||| |||||||||||| Sbjct: 2894 cctcctcctcttcatcctcttcatcctcc 2866
>ref|XM_451900.1| Kluyveromyces lactis NRRL Y-1140, KLLA0B08305g predicted mRNA Length = 2208 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||||||||| ||||| |||||| Sbjct: 1522 cctcctcttcttcatcctcttcttcctcc 1494
>ref|NM_001010848.2| Homo sapiens neuregulin 3 (NRG3), mRNA Length = 2091 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 372 gcctcctcttcttcatcatcttcatcctccgct 404 |||||||||||||| || ||||| ||||||||| Sbjct: 751 gcctcctcttcttcctcttcttcctcctccgct 783
>ref|NM_031206.2| Homo sapiens LAS1-like (S. cerevisiae) (LAS1L), mRNA Length = 2500 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 381 tcttcatcatcttcatcctcc 401 ||||||||||||||||||||| Sbjct: 1871 tcttcatcatcttcatcctcc 1851
>gb|AC120147.8| Mus musculus chromosome 19, clone RP24-223N20, complete sequence Length = 172853 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 97039 cctcctcttcctcatcctcttcatcctcc 97067
>gb|AC128571.4| Rattus norvegicus 6 BAC CH230-424O13 (Children's Hospital Oakland Research Institute) complete sequence Length = 194127 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||||||||| || |||||||||||| Sbjct: 52238 cctcctcttcttcctcctcttcatcctcc 52266
>gb|AC025724.3| Caenorhabditis elegans cosmid Y67D8C, complete sequence Length = 103670 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 381 tcttcatcatcttcatcctcc 401 ||||||||||||||||||||| Sbjct: 8121 tcttcatcatcttcatcctcc 8141
>ref|XM_001005031.1| PREDICTED: Mus musculus similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30) (LOC677578), mRNA Length = 1451 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 709 cctcctcttcctcatcctcttcatcctcc 681
>gb|AC116977.2| Dictyostelium discoideum chromosome 2 map 5515173-5817331 strain AX4, complete sequence Length = 302156 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 381 tcttcatcatcttcatcctcc 401 ||||||||||||||||||||| Sbjct: 172769 tcttcatcatcttcatcctcc 172749
>ref|XM_982299.1| PREDICTED: Mus musculus similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30) (LOC385454), mRNA Length = 570 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 541 cctcctcttcctcatcctcttcatcctcc 513
>ref|XM_984941.1| PREDICTED: Mus musculus similar to melanoma antigen family A, 10 (LOC245440), mRNA Length = 1056 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || ||||||||||||||| Sbjct: 232 cctcctcttcttcctcctcttcttcctcctct-tcttcctcctcttctt 185 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || | |||||||||||||| Sbjct: 220 cctcctcttcttcctcctcttcttcctcctcttc-ttcctcctcttctt 173
>ref|XM_988460.1| PREDICTED: Mus musculus similar to melanoma antigen family A, 10 (LOC245440), mRNA Length = 1314 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || ||||||||||||||| Sbjct: 232 cctcctcttcttcctcctcttcttcctcctct-tcttcctcctcttctt 185 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || | |||||||||||||| Sbjct: 220 cctcctcttcttcctcctcttcttcctcctcttc-ttcctcctcttctt 173
>ref|XM_358238.5| PREDICTED: Mus musculus similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30) (LOC385454), mRNA Length = 567 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 538 cctcctcttcctcatcctcttcatcctcc 510
>ref|XM_910188.2| PREDICTED: Mus musculus similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30) (LOC385454), mRNA Length = 567 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 538 cctcctcttcctcatcctcttcatcctcc 510
>ref|XM_906010.2| PREDICTED: Mus musculus similar to melanoma antigen family A, 10 (LOC245440), mRNA Length = 1314 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || ||||||||||||||| Sbjct: 232 cctcctcttcttcctcctcttcttcctcctct-tcttcctcctcttctt 185 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || | |||||||||||||| Sbjct: 220 cctcctcttcttcctcctcttcttcctcctcttc-ttcctcctcttctt 173
>ref|XR_003222.1| PREDICTED: Mus musculus similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30) (LOC640060), mRNA Length = 1293 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 752 cctcctcttcctcatcctcttcatcctcc 724
>ref|XM_992312.1| PREDICTED: Mus musculus serine/arginine repetitive matrix 2 (Srrm2), mRNA Length = 8486 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||| ||||||||||||||||| Sbjct: 7352 cctcctcctcttcatcatcttcatc 7376
>ref|XM_884320.2| PREDICTED: Mus musculus similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30) (LOC619937), mRNA Length = 1267 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 707 cctcctcttcctcatcctcttcatcctcc 679
>ref|XM_914398.2| PREDICTED: Mus musculus similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30) (LOC638385), mRNA Length = 1260 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 700 cctcctcttcctcatcctcttcatcctcc 672
>ref|XM_907057.2| PREDICTED: Mus musculus similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30) (LOC432959), mRNA Length = 748 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||| ||||| |||||||||||||||||| Sbjct: 710 cctcttcttcctcatcatcttcatcctcc 682
>ref|XM_484474.3| PREDICTED: Mus musculus similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30) (LOC432959), mRNA Length = 748 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||| ||||| |||||||||||||||||| Sbjct: 710 cctcttcttcctcatcatcttcatcctcc 682
>ref|XM_977875.1| PREDICTED: Mus musculus similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30) (LOC669902), mRNA Length = 1269 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 708 cctcctcttcctcatcctcttcatcctcc 680
>ref|XM_976550.1| PREDICTED: Mus musculus similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30) (LOC669692), mRNA Length = 2060 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 709 cctcctcttcctcatcctcttcatcctcc 681
>gb|BC044266.1| Xenopus laevis similar to steroid receptor-interacting SNF2 domain protein, mRNA (cDNA clone IMAGE:5542344), partial cds Length = 1365 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatc 397 |||||||||| |||||||||||||| Sbjct: 188 cctcctcttcatcatcatcttcatc 164
>gb|AC110262.12| Mus musculus chromosome 17, clone RP23-291L10, complete sequence Length = 210850 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||| ||||||||||||||||| Sbjct: 36691 cctcctcctcttcatcatcttcatc 36715
>ref|XR_003080.1| PREDICTED: Mus musculus similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30) (LOC619909), mRNA Length = 635 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||||||||| |||| ||||||| Sbjct: 603 cctcctcttcttcatcctctttatcctcc 575 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 378 tcttcttcatcatcttcatc 397 |||||||||||||||||||| Sbjct: 625 tcttcttcatcatcttcatc 606
>ref|XM_001001990.1| PREDICTED: Mus musculus similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30) (LOC434174), mRNA Length = 1275 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 708 cctcctcttcctcatcctcttcatcctcc 680
>ref|XR_004825.1| PREDICTED: Mus musculus similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30) (LOC619909), mRNA Length = 635 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||||||||| |||| ||||||| Sbjct: 603 cctcctcttcttcatcctctttatcctcc 575 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 378 tcttcttcatcatcttcatc 397 |||||||||||||||||||| Sbjct: 625 tcttcttcatcatcttcatc 606
>ref|XM_485920.3| PREDICTED: Mus musculus similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30) (LOC434174), mRNA Length = 1275 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 708 cctcctcttcctcatcctcttcatcctcc 680
>ref|XM_916659.2| PREDICTED: Mus musculus similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30) (LOC434174), mRNA Length = 1275 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 708 cctcctcttcctcatcctcttcatcctcc 680
>ref|XM_543547.2| PREDICTED: Canis familiaris similar to CDC45-like (LOC486421), mRNA Length = 1761 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 371 agcctcctcttcttcatcatc 391 ||||||||||||||||||||| Sbjct: 477 agcctcctcttcttcatcatc 457
>ref|XR_003871.1| PREDICTED: Mus musculus similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30) (LOC623634), mRNA Length = 835 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 788 cctcctcttcctcatcctcttcatcctcc 760
>gb|AC144640.3| Carollia perspicillata clone 14D2, complete sequence Length = 116172 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||| ||||||||||||||||| Sbjct: 20838 cctcctcatcttcatcatcttcatc 20814
>gb|BC064790.1| Mus musculus high mobility group box 1, mRNA (cDNA clone MGC:76709 IMAGE:30019980), complete cds Length = 1612 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 1038 cctcctcttcctcatcctcttcatcctcc 1010
>ref|XM_851430.1| PREDICTED: Canis familiaris similar to high-mobility group box 2, transcript variant 2 (LOC486068), mRNA Length = 988 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatc 397 |||||||||| |||||||||||||| Sbjct: 593 cctcctcttcctcatcatcttcatc 569
>ref|XM_543194.2| PREDICTED: Canis familiaris similar to high-mobility group box 2, transcript variant 1 (LOC486068), mRNA Length = 1037 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatc 397 |||||||||| |||||||||||||| Sbjct: 642 cctcctcttcctcatcatcttcatc 618
>ref|XM_549501.2| PREDICTED: Canis familiaris similar to leiomodin 3 (fetal) (LOC476558), mRNA Length = 2200 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 376 cctcttcttcatcatcttcatcctc 400 |||||||||| |||||||||||||| Sbjct: 622 cctcttcttcctcatcttcatcctc 598
>emb|AL034488.2|CEY54G11A Caenorhabditis elegans YAC Y54G11A, complete sequence Length = 99415 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatc 397 |||||||||| |||||||||||||| Sbjct: 66809 cctcctcttcatcatcatcttcatc 66785
>ref|XM_820668.1| Trypanosoma brucei TREU927 clone RPCI93-28L1 hypothetical protein (Tb927.8.3410) partial mRNA Length = 4557 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||||||||| |||||||||| |||| Sbjct: 466 cctcctcttcttcttcatcttcatactcc 438
>emb|AJ699408.1| Nipponia nippon microsatellite DNA, locus NnCG3, clone CG03 Length = 334 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||||||||| ||||||||||| Sbjct: 205 cctcctcttcttcttcatcttcatc 229
>emb|AJ246952.1|ARA246952 Ascochyta rabiei microsatellite DNA, clone ArA08T Length = 387 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||||||||||||||| ||||| Sbjct: 218 cctcctcttcttcatcatcatcatc 242
>gb|AC113203.10| Mus musculus chromosome 5, clone RP23-276C23, complete sequence Length = 201674 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || || ||||||||||||| Sbjct: 88869 cctcctcttcttcctcctcttcctcctcctcttcc-tcctcctcttctt 88916
>ref|XM_446788.1| Candida glabrata CBS138, CAGL0G09845g partial mRNA Length = 1503 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 380 ttcttcatcatcttcatcctc 400 ||||||||||||||||||||| Sbjct: 435 ttcttcatcatcttcatcctc 415
>gb|AC124458.5| Mus musculus BAC clone RP24-136E11 from chromosome 12, complete sequence Length = 168181 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || ||||||||||||||| Sbjct: 14375 cctcctcttcttcctcctcttcttcctcctct-tcttcctcctcttctt 14422
>gb|AC124367.4| Mus musculus BAC clone RP24-545D20 from chromosome 18, complete sequence Length = 169912 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || || ||||||||||||| Sbjct: 109521 cctcctcttcttcctcttcttcctcctcctcttcc-tcctcctcttctt 109474
>gb|AC122889.3| Mus musculus BAC clone RP23-93M3 from chromosome 1, complete sequence Length = 125681 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||| ||||||||||||||||| Sbjct: 83740 cctcctcctcttcatcatcttcatc 83716
>gb|AC122821.4| Mus musculus BAC clone RP23-201I4 from chromosome 17, complete sequence Length = 220013 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||| ||||||||||||||||| Sbjct: 41930 cctcctcctcttcatcatcttcatc 41906
>gb|AC110212.12| Mus musculus chromosome 19, clone RP23-183H23, complete sequence Length = 212687 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || ||||||||||||||| Sbjct: 63626 cctcctcttcttcctcctcttcttcctcctct-tcttcctcctcttctt 63579 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || ||||||||||||||| Sbjct: 63602 cctcctcttcttcctcctcttcttcctcctct-tcttcctcctcttctt 63555 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || ||||||||||||||| Sbjct: 63566 cctcctcttcttcctcttcttcttcctcctct-tcttcctcctcttctt 63519 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || ||||||||||||||| Sbjct: 63542 cctcctcttcttcctcctcttcttcctcctct-tcttcctcctcttctt 63495 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || | |||||||||||||| Sbjct: 63530 cctcctcttcttcctcctcttcttcctcctcttc-ttcctcctcttctt 63483
>gb|AC122445.3| Mus musculus BAC clone RP24-233P3 from chromosome 17, complete sequence Length = 173130 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || ||||||||||||||| Sbjct: 168860 cctcctcttcttcttcctcttcttcctcctct-tcttcctcctcttctt 168813 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || ||||||||||||||| Sbjct: 168836 cctcctcttcttcctcctcttcttcctcctct-tcttcctcctcttctt 168789 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || ||||||||||||||| Sbjct: 168812 cctcctcttcttcctcctcttcttcctcctct-tcttcctcctcttctt 168765
>gb|AC124394.4| Mus musculus BAC clone RP24-335M3 from chromosome 19, complete sequence Length = 171122 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 88023 cctcctcttcctcatcctcttcatcctcc 87995
>gb|AC124713.5| Mus musculus BAC clone RP24-116N2 from chromosome 8, complete sequence Length = 184855 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||||||||||| |||||| |||||| Sbjct: 32779 cctcctcttcttcataatcttcctcctcc 32751
>gb|AC098712.3| Mus musculus BAC clone RP23-2A21 from 10, complete sequence Length = 205054 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||||||||| |||||||| |||||| Sbjct: 197245 cctcctcttcttcctcatcttcttcctcc 197217
>gb|AC122864.3| Mus musculus BAC clone RP23-142M19 from 6, complete sequence Length = 210148 Score = 42.1 bits (21), Expect = 1.6 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctccgctgccttcctcctcttctt 421 ||||||||||||| || ||||| |||||| || ||||||||||||||| Sbjct: 4181 cctcctcttcttcctcctcttcttcctcctct-tcttcctcctcttctt 4134
>gb|AC122934.2| Mus musculus BAC clone RP23-19A13 from 3, complete sequence Length = 189627 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||| |||||||||||||| |||||| Sbjct: 123260 cctcctcatcttcatcatcttcctcctcc 123288
>gb|AC098736.4| Mus musculus BAC clone RP23-122B3 from 1, complete sequence Length = 211208 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 25212 cctcctcttcctcatcctcttcatcctcc 25184
>ref|XM_537141.2| PREDICTED: Canis familiaris similar to REST corepressor 3 (LOC480018), mRNA Length = 1918 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 369 ggagcctcctcttcttcatca 389 ||||||||||||||||||||| Sbjct: 1184 ggagcctcctcttcttcatca 1164
>gb|BC043908.1| Xenopus laevis similar to Nucleophosmin, mRNA (cDNA clone MGC:53901 IMAGE:5543517), complete cds Length = 1081 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatc 397 |||||||||| |||||||||||||| Sbjct: 592 cctcctcttcatcatcatcttcatc 568
>ref|XM_762871.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_228_26673_25900) partial mRNA Length = 774 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||||||||| || |||||||||||| Sbjct: 314 cctcctcttcttcgtcttcttcatcctcc 342
>ref|XM_720001.1| Plasmodium yoelii yoelii str. 17XNL chaperonin Cpn60 (PY04757) partial mRNA Length = 1182 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatc 397 |||| |||||||||||||||||||| Sbjct: 1138 cctcatcttcttcatcatcttcatc 1114
>ref|XM_946708.1| Theileria annulata strain Ankara hypothetical protein (TA15820) partial mRNA Length = 2997 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||| ||||||||||||||||| Sbjct: 2425 cctcctcatcttcatcatcttcatc 2401
>gb|AC101527.12| Mus musculus chromosome 15, clone RP23-191D20, complete sequence Length = 193390 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||| ||||| |||||||||||||||||| Sbjct: 55131 cctcttcttcctcatcatcttcatcctcc 55159
>gb|AC147635.4| Mus musculus BAC clone RP23-290C4 from chromosome 3, complete sequence Length = 213637 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||||||||| |||||||| |||||| Sbjct: 41725 cctcctcttcttcctcatcttcctcctcc 41697 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||||||||| |||||||| |||||| Sbjct: 20929 cctcctcttcttcctcatcttcttcctcc 20901
>gb|AC152176.5| Medicago truncatula clone mth2-65c4, complete sequence Length = 161536 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttca 395 ||||||||||||||||||||| Sbjct: 80092 tcctcttcttcatcatcttca 80072 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 375 tcctcttcttcatcatcttca 395 ||||||||||||||||||||| Sbjct: 79183 tcctcttcttcatcatcttca 79203
>gb|AC122168.14| Medicago truncatula clone mth2-4o4, complete sequence Length = 120886 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 375 tcctcttcttcatcatcttca 395 ||||||||||||||||||||| Sbjct: 119388 tcctcttcttcatcatcttca 119408
>emb|Z95126.1|HS30P20 Human DNA sequence from clone RP1-30P20 on chromosome Xq21.1-21.3 Contains a SET translocation (myeloid leukemia-associated) (SET) pseudogene, complete sequence Length = 176939 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||||||||||||||| ||||| Sbjct: 61932 cctcctcttcttcatcatcatcatc 61908
>ref|NM_001164.2| Homo sapiens amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65) (APBB1), transcript variant 1, mRNA Length = 2653 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||| ||||||||||| ||||||||| Sbjct: 611 cctcctcctcttcatcatcatcatcctcc 583
>gb|AC146344.1| Mus musculus strain C57BL/6J clone rp23-74a5, complete sequence Length = 197449 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||| ||||||||||||||||| Sbjct: 159734 cctcctcctcttcatcatcttcatc 159758
>ref|NM_145689.1| Homo sapiens amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65) (APBB1), transcript variant 2, mRNA Length = 2634 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||| ||||||||||| ||||||||| Sbjct: 594 cctcctcctcttcatcatcatcatcctcc 566
>emb|AL159978.14| Human DNA sequence from clone RP11-496O3 on chromosome 13 Contains the 3' end of the WASF3 gene for WAS protein family, member 3 (WASP family Verprolin-homologous protein 3 (SCAR3, Scar3, WAVE3, KIAA0900)), the GPR12 gene for G protein-coupled receptor 12 (GPCR21) and two CpG islands, complete sequence Length = 206442 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 363 cctcttggagcctcctcttcttcat 387 ||||||||||||||| ||||||||| Sbjct: 195171 cctcttggagcctccgcttcttcat 195195
>emb|AL136132.15| Human DNA sequence from clone RP11-141M24 on chromosome 13q33.1-34 Contains part of a novel gene, possible ortholog of rat myosin heavy chain Myr 8 (Loc192253), complete sequence Length = 173738 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 368 tggagcctcctcttcttcatc 388 ||||||||||||||||||||| Sbjct: 93578 tggagcctcctcttcttcatc 93598
>emb|AL096706.10|HSJ684F13 Human DNA sequence from clone RP4-684F13 on chromosome 10 Contains the 5' end of the NRG3 gene for neuregulin 3 and two CpG islands, complete sequence Length = 117230 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 372 gcctcctcttcttcatcatcttcatcctccgct 404 |||||||||||||| || ||||| ||||||||| Sbjct: 105864 gcctcctcttcttcctcttcttcctcctccgct 105896
>emb|AL050306.5|HSDJ475B7 Human DNA sequence from clone RP3-475B7 on chromosome Xq12.1-13 Contains a novel gene, gene FLJ12525 (FLJ40064, FLJ30255, FLJ00158), a novel pseudogene and two CpG islands, complete sequence Length = 78693 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 381 tcttcatcatcttcatcctcc 401 ||||||||||||||||||||| Sbjct: 27952 tcttcatcatcttcatcctcc 27972
>gb|AC158764.4| Mus musculus chromosome 1, clone RP24-248C2, complete sequence Length = 165228 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 74952 cctcctcttcctcatcctcttcatcctcc 74980
>emb|BX066409.1|CNS09NEL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5CH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||||||||||||||| ||||| Sbjct: 856 cctcctcttcttcatcatcatcatc 880
>emb|BX066408.1|CNS09NEK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5CH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 966 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||||||||||||||| ||||| Sbjct: 670 cctcctcttcttcatcatcatcatc 646
>emb|BX052066.1|CNS09CC6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3AA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 778 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||||||||||||||| ||||| Sbjct: 666 cctcctcttcttcatcatcatcatc 642
>emb|BX045413.1|CNS0977D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC19CC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 722 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||||||||||||||| ||||| Sbjct: 622 cctcctcttcttcatcatcatcatc 598
>gb|AC161211.21| Mus musculus chromosome 7, clone RP23-74O12, complete sequence Length = 188863 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 176373 cctcctcttcctcatcctcttcatcctcc 176345
>emb|X17199.1|GGNUCC23 Chicken mRNA for nucleolin C23 Length = 2576 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 381 tcttcatcatcttcatcctcc 401 ||||||||||||||||||||| Sbjct: 813 tcttcatcatcttcatcctcc 793
>emb|X05496.1|XLNO38 Xenopus laevis mRNA for nucleolar protein NO38 Length = 1039 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatc 397 |||||||||| |||||||||||||| Sbjct: 576 cctcctcttcatcatcatcttcatc 552
>emb|CR626927.1| Bacteroides fragilis NCTC 9343, complete genome Length = 5205140 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 377 ctcttcttcatcatcttcatc 397 ||||||||||||||||||||| Sbjct: 2201665 ctcttcttcatcatcttcatc 2201645
>emb|CR382122.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome B of strain NRRL Y-1140 of Kluyveromyces lactis Length = 1320834 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||||||||| ||||| |||||| Sbjct: 739488 cctcctcttcttcatcctcttcttcctcc 739460
>emb|CR380953.1| Candida glabrata strain CBS138 chromosome G complete sequence Length = 992211 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 380 ttcttcatcatcttcatcctc 400 ||||||||||||||||||||| Sbjct: 941032 ttcttcatcatcttcatcctc 941012
>gb|AC162456.3| Mus musculus chromosome 19, clone RP23-406F15, complete sequence Length = 173042 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 124356 cctcctcttcctcatcctcttcatcctcc 124384
>ref|NM_001016983.2| Xenopus tropicalis cell division cycle 2-like 1 (PITSLRE proteins) (cdc2l1), mRNA Length = 2733 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||| ||||||||||| ||||||||| Sbjct: 1078 cctcctcctcttcatcatcatcatcctcc 1050
>emb|AL603889.5| Mouse DNA sequence from clone RP23-407M20 on chromosome 11, complete sequence Length = 145052 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 24852 cctcctcttcctcatcctcttcatcctcc 24880 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 tcttcttcatcatcttcatc 397 |||||||||||||||||||| Sbjct: 24830 tcttcttcatcatcttcatc 24849
>gb|AC164311.4| Mus musculus BAC clone RP23-144H18 from chromosome 8, complete sequence Length = 190693 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||||||||||| |||||| |||||| Sbjct: 123307 cctcctcttcttcataatcttcctcctcc 123279
>gb|AC159330.9| Mus musculus 10 BAC RP23-91L18 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 224664 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 154843 cctcctcttcctcatcctcttcatcctcc 154871
>gb|AC153153.4| Mus musculus BAC clone RP23-79G18 from chromosome 13, complete sequence Length = 222383 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 217044 cctcctcttcctcatcctcttcatcctcc 217072
>emb|AL954336.3| Mouse DNA sequence from clone RP23-223H19 on chromosome 11 Contains a high mobility group box 1 (Hmgb1) pseudogene, a novel gene and two CpG islands, complete sequence Length = 117391 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 35830 cctcctcttcctcatcctcttcatcctcc 35802
>emb|AL731866.8| Mouse DNA sequence from clone RP23-37F22 on chromosome 11 Contains the 5' end of a variant of the Ccl1 gene for chemokine (C-C motif) ligand 1, complete sequence Length = 105085 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||||||||| |||||| Sbjct: 12351 cctcctcttcctcatcatcttcctcctcc 12379
>emb|CR318597.4| Zebrafish DNA sequence from clone CH211-151L13 in linkage group 21, complete sequence Length = 160229 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 376 cctcttcttcatcatcttcatcctc 400 ||||||| ||||||||||||||||| Sbjct: 119092 cctcttcctcatcatcttcatcctc 119116
>gb|AC138664.17| Mus musculus chromosome 3, clone RP24-289J19, complete sequence Length = 151691 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcct 399 ||||||||||| ||||||||||||| Sbjct: 133101 tcctcttcttcctcatcttcatcct 133077
>gb|BC006586.1| Mus musculus high mobility group box 1, mRNA (cDNA clone MGC:8044 IMAGE:3587109), complete cds Length = 1266 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 690 cctcctcttcctcatcctcttcatcctcc 662
>gb|AC127343.3| Mus musculus BAC clone RP23-194I18 from chromosome 10, complete sequence Length = 198624 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 67906 cctcctcttcctcatcctcttcatcctcc 67934
>emb|CR861115.1| Pongo pygmaeus mRNA; cDNA DKFZp459D2114 (from clone DKFZp459D2114) Length = 2493 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 376 cctcttcttcatcatcttcatcctc 400 ||||| ||||||||||||||||||| Sbjct: 232 cctctgcttcatcatcttcatcctc 208
>emb|CR859201.1| Pongo pygmaeus mRNA; cDNA DKFZp459F2431 (from clone DKFZp459F2431) Length = 3422 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatc 397 |||||||||| |||||||||||||| Sbjct: 1748 cctcctcttcatcatcatcttcatc 1724
>gb|BC008565.1| Mus musculus high mobility group box 1, mRNA (cDNA clone MGC:8033 IMAGE:3586745), complete cds Length = 2333 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||| ||||| |||||||||||| Sbjct: 728 cctcctcttcctcatcctcttcatcctcc 700
>emb|BX571714.7| Zebrafish DNA sequence from clone DKEY-16L2 in linkage group 3, complete sequence Length = 240105 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 |||||||||||||||| || ||||||||| Sbjct: 228824 cctcctcttcttcatcctcatcatcctcc 228796
>gb|AC020894.5| Homo sapiens chromosome 5 clone CTC-293A9, complete sequence Length = 166983 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||||||||| |||||||| |||||| Sbjct: 8716 cctcctcttcttcctcatcttcctcctcc 8744
>dbj|AK125760.1| Homo sapiens cDNA FLJ43772 fis, clone TESTI2049576 Length = 1965 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 381 tcttcatcatcttcatcctcc 401 ||||||||||||||||||||| Sbjct: 1364 tcttcatcatcttcatcctcc 1344
>dbj|AK127207.1| Homo sapiens cDNA FLJ45274 fis, clone BRHIP3000626 Length = 3411 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 381 tcttcatcatcttcatcctcc 401 ||||||||||||||||||||| Sbjct: 892 tcttcatcatcttcatcctcc 872
>dbj|AK097383.1| Homo sapiens cDNA FLJ40064 fis, clone TESOP2000312 Length = 2261 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 381 tcttcatcatcttcatcctcc 401 ||||||||||||||||||||| Sbjct: 1660 tcttcatcatcttcatcctcc 1640
>gb|AC148755.6| Medicago truncatula clone mth2-24n16, complete sequence Length = 119876 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttca 395 ||||||||||||||||||||| Sbjct: 77772 tcctcttcttcatcatcttca 77752 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 375 tcctcttcttcatcatcttca 395 ||||||||||||||||||||| Sbjct: 76870 tcctcttcttcatcatcttca 76890
>gb|AC135795.21| Medicago truncatula clone mth2-28g10, complete sequence Length = 110937 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatc 397 ||||||||||||| ||||||||||| Sbjct: 10479 cctcctcttcttcctcatcttcatc 10503
>ref|NM_184109.1| Mus musculus retrotransposon-like 1 (Rtl1), mRNA Length = 5235 Score = 42.1 bits (21), Expect = 1.6 Identities = 40/45 (88%), Gaps = 1/45 (2%) Strand = Plus / Minus Query: 375 tcctcttcttcatcatcttcatcctccgctgccttcctcctcttc 419 ||||||||||| |||||||| |||||| || ||||||||||||| Sbjct: 4286 tcctcttcttcctcatcttcctcctcctct-tcttcctcctcttc 4243 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 378 tcttcttcatcatcttcatcctcc 401 ||||||||||||||||| |||||| Sbjct: 4016 tcttcttcatcatcttcctcctcc 3993
>dbj|AK054817.1| Homo sapiens cDNA FLJ30255 fis, clone BRACE2002444, weakly similar to GLUTAMIC ACID-RICH PROTEIN PRECURSOR Length = 2104 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 381 tcttcatcatcttcatcctcc 401 ||||||||||||||||||||| Sbjct: 1503 tcttcatcatcttcatcctcc 1483
>gb|AC068733.12| Homo sapiens chromosome 11, clone RP11-304C12, complete sequence Length = 191656 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 373 cctcctcttcttcatcatcttcatcctcc 401 ||||||| ||||||||||| ||||||||| Sbjct: 149238 cctcctcctcttcatcatcatcatcctcc 149266 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,291,333 Number of Sequences: 3902068 Number of extensions: 4291333 Number of successful extensions: 134683 Number of sequences better than 10.0: 731 Number of HSP's better than 10.0 without gapping: 709 Number of HSP's successfully gapped in prelim test: 23 Number of HSP's that attempted gapping in prelim test: 132011 Number of HSP's gapped (non-prelim): 2593 length of query: 475 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 453 effective length of database: 17,147,199,772 effective search space: 7767681496716 effective search space used: 7767681496716 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)