ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast27e01
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC151599.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.10
2gb|AC128706.4| Oryza sativa (japonica cultivar-group) chromosome... 44 0.10
3gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 44 0.10
4gb|AC147572.4| Pan troglodytes BAC clone CH251-412D24 from Y, co... 42 0.41
5gb|AC147711.2| Pan troglodytes BAC clone CH251-503O1 from Y, com... 42 0.41
6gb|AC147608.1| Pan troglodytes BAC clone CH251-506P22 from Y, co... 42 0.41
7gb|AC147114.2| Pan troglodytes BAC clone CH251-548O14 from Y, co... 42 0.41
8gb|AC146515.2| Pan troglodytes BAC clone CH251-113M4 from Y, com... 42 0.41
9gb|AC142348.1| Pan troglodytes BAC clone RP43-5I10 from Y, compl... 42 0.41
10dbj|BS000677.1| Pan troglodytes chromosome Y clone: PTB-391J06, ... 42 0.41
11gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 42 0.41
12gb|AC153362.4| Mus musculus BAC clone RP23-92N20 from chromosome... 42 0.41
13gb|AC022486.4|AC022486 Homo sapiens BAC clone RP11-569J3 from Y,... 42 0.41
14gb|AC151800.2| Pan troglodytes BAC clone CH251-261E10 from chrom... 42 0.41
15gb|AC148933.3| Pan troglodytes BAC clone CH251-571K7 from chromo... 42 0.41
16gb|AC026767.30|AC026767 Mus musculus 7 BAC RP23-328L8 (Roswell P... 42 0.41
17gb|AC007359.3|AC007359 Homo sapiens BAC clone RP11-66M18 from Y,... 42 0.41
18gb|AC016752.2|AC016752 Homo sapiens BAC clone RP11-506M9 from Y,... 42 0.41
19gb|AC008175.2|AC008175 Homo sapiens BAC clone RP11-427G18 from Y... 42 0.41
20gb|AC007965.3|AC007965 Homo sapiens BAC clone RP11-245K4 from Y,... 42 0.41
21gb|AC007379.2|AC007379 Homo sapiens BAC clone RP11-143C1 from Y,... 42 0.41
22ref|NG_004755.1| Homo sapiens chromosome Y palindromes P1, P2, P... 42 0.41
23ref|NG_004636.1| Homo sapiens chromosome Y palindromes P4 and P5... 42 0.41
24gb|AC142105.7| Mus musculus BAC clone RP24-240E7 from chromosome... 42 0.41
25gb|AC009298.3| Homo sapiens BAC clone RP11-17I6 from 2, complete... 40 1.6
26gb|AC134429.3| Mus musculus BAC clone RP24-344D20 from chromosom... 38 6.4
27gb|AC145076.8| Mus musculus chromosome 10, clone RP24-528G5, com... 38 6.4
28gb|AC092634.3| Homo sapiens BAC clone RP11-340I6 from 7, complet... 38 6.4
29gb|AC133571.47| Medicago truncatula clone mth2-10h12, complete s... 38 6.4
30emb|AL607026.11| Human DNA sequence from clone RP11-498G22 on ch... 38 6.4
31emb|AL390318.20| Human DNA sequence from clone RP11-142L16 on ch... 38 6.4
32emb|CR853297.8| Zebrafish DNA sequence from clone DKEYP-118B3 in... 38 6.4
33gb|AC112505.5| Homo sapiens 3 BAC RP11-282M5 (Roswell Park Cance... 38 6.4
34gb|AC009560.10| Homo sapiens chromosome 15, clone RP11-219B17, c... 38 6.4
35gb|AC011415.3| Homo sapiens chromosome 5 clone CTB-87P21, comple... 38 6.4
36gb|AC024072.5| Homo sapiens chromosome 10 clone RP11-267O2, comp... 38 6.4
37emb|BX571960.6| Zebrafish DNA sequence from clone DKEY-165I8 in ... 38 6.4
38gb|AC110527.13| Mus musculus chromosome 1, clone RP23-204H10, co... 38 6.4
39emb|BX005141.5| Zebrafish DNA sequence from clone CH211-13K16, c... 38 6.4
40ref|NG_001019.4| Homo sapiens immunoglobulin heavy locus (IGH@) ... 38 6.4
41emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 38 6.4
42gb|M99657.1|HUMIGH320X Human immunoglobulin heavy chain variable... 38 6.4
43dbj|AB019440.1| Homo sapiens DNA for immunoglobulin heavy-chain ... 38 6.4 
>gb|AC151599.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0018H03, complete sequence
          Length = 93081

 Score = 44.1 bits (22), Expect = 0.10
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 65    aatttgatccatgaatcacctt 86
             ||||||||||||||||||||||
Sbjct: 44093 aatttgatccatgaatcacctt 44114
to top
>gb|AC128706.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
            OSJNBa0063F24, complete sequence
          Length = 152738

 Score = 44.1 bits (22), Expect = 0.10
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 65   aatttgatccatgaatcacctt 86
            ||||||||||||||||||||||
Sbjct: 1613 aatttgatccatgaatcacctt 1634
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 44.1 bits (22), Expect = 0.10
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 65       aatttgatccatgaatcacctt 86
                ||||||||||||||||||||||
Sbjct: 19779152 aatttgatccatgaatcacctt 19779173
to top
>gb|AC147572.4| Pan troglodytes BAC clone CH251-412D24 from Y, complete sequence
          Length = 166356

 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 1     aaaattaacttctgctatctcttta 25
             |||||||||||||||| ||||||||
Sbjct: 78858 aaaattaacttctgctttctcttta 78882
to top
>gb|AC147711.2| Pan troglodytes BAC clone CH251-503O1 from Y, complete sequence
          Length = 154081

 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 1      aaaattaacttctgctatctcttta 25
              |||||||||||||||| ||||||||
Sbjct: 143799 aaaattaacttctgctttctcttta 143823
to top
>gb|AC147608.1| Pan troglodytes BAC clone CH251-506P22 from Y, complete sequence
          Length = 195158

 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 1     aaaattaacttctgctatctcttta 25
             |||||||||||||||| ||||||||
Sbjct: 73602 aaaattaacttctgctttctcttta 73578
to top
>gb|AC147114.2| Pan troglodytes BAC clone CH251-548O14 from Y, complete sequence
          Length = 229006

 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 1     aaaattaacttctgctatctcttta 25
             |||||||||||||||| ||||||||
Sbjct: 14863 aaaattaacttctgctttctcttta 14887
to top
>gb|AC146515.2| Pan troglodytes BAC clone CH251-113M4 from Y, complete sequence
          Length = 183460

 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 1      aaaattaacttctgctatctcttta 25
              |||||||||||||||| ||||||||
Sbjct: 125323 aaaattaacttctgctttctcttta 125299
to top
>gb|AC142348.1| Pan troglodytes BAC clone RP43-5I10 from Y, complete sequence
          Length = 183293

 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 1      aaaattaacttctgctatctcttta 25
              |||||||||||||||| ||||||||
Sbjct: 121880 aaaattaacttctgctttctcttta 121904
to top
>dbj|BS000677.1| Pan troglodytes chromosome Y clone: PTB-391J06, complete sequence
          Length = 171013

 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 1      aaaattaacttctgctatctcttta 25
              |||||||||||||||| ||||||||
Sbjct: 115098 aaaattaacttctgctttctcttta 115074
to top
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 1        aaaattaacttctgctatctcttta 25
                |||||||||||||||| ||||||||
Sbjct: 11543106 aaaattaacttctgctttctcttta 11543082



 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 1        aaaattaacttctgctatctcttta 25
                |||||||||||||||| ||||||||
Sbjct: 10642343 aaaattaacttctgctttctcttta 10642367



 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 1       aaaattaacttctgctatctcttta 25
               |||||||||||||||| ||||||||
Sbjct: 3644645 aaaattaacttctgctttctcttta 3644621



 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 1       aaaattaacttctgctatctcttta 25
               |||||||||||||||| ||||||||
Sbjct: 2673589 aaaattaacttctgctttctcttta 2673613
to top
>gb|AC153362.4| Mus musculus BAC clone RP23-92N20 from chromosome 10, complete sequence
          Length = 214898

 Score = 42.1 bits (21), Expect = 0.41
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 92     acactctatgtttctcatagt 112
              |||||||||||||||||||||
Sbjct: 178892 acactctatgtttctcatagt 178872
to top
>gb|AC022486.4|AC022486 Homo sapiens BAC clone RP11-569J3 from Y, complete sequence
          Length = 156357

 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 1     aaaattaacttctgctatctcttta 25
             |||||||||||||||| ||||||||
Sbjct: 28252 aaaattaacttctgctttctcttta 28276
to top
>gb|AC151800.2| Pan troglodytes BAC clone CH251-261E10 from chromosome y, complete
             sequence
          Length = 149719

 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 1     aaaattaacttctgctatctcttta 25
             |||||||||||||||| ||||||||
Sbjct: 23521 aaaattaacttctgctttctcttta 23497
to top
>gb|AC148933.3| Pan troglodytes BAC clone CH251-571K7 from chromosome y, complete
              sequence
          Length = 171231

 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 1      aaaattaacttctgctatctcttta 25
              |||||||||||||||| ||||||||
Sbjct: 122483 aaaattaacttctgctttctcttta 122507
to top
>gb|AC026767.30|AC026767 Mus musculus 7 BAC RP23-328L8 (Roswell Park Cancer Institute Mouse BAC)
              complete sequence
          Length = 193167

 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 17     atctctttataactctcattcaaat 41
              |||||||||||| ||||||||||||
Sbjct: 108018 atctctttataaatctcattcaaat 107994
to top
>gb|AC007359.3|AC007359 Homo sapiens BAC clone RP11-66M18 from Y, complete sequence
          Length = 100627

 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 1     aaaattaacttctgctatctcttta 25
             |||||||||||||||| ||||||||
Sbjct: 19330 aaaattaacttctgctttctcttta 19306
to top
>gb|AC016752.2|AC016752 Homo sapiens BAC clone RP11-506M9 from Y, complete sequence
          Length = 166436

 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 1     aaaattaacttctgctatctcttta 25
             |||||||||||||||| ||||||||
Sbjct: 58839 aaaattaacttctgctttctcttta 58815
to top
>gb|AC008175.2|AC008175 Homo sapiens BAC clone RP11-427G18 from Y, complete sequence
          Length = 205237

 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 1     aaaattaacttctgctatctcttta 25
             |||||||||||||||| ||||||||
Sbjct: 84987 aaaattaacttctgctttctcttta 85011
to top
>gb|AC007965.3|AC007965 Homo sapiens BAC clone RP11-245K4 from Y, complete sequence
          Length = 182083

 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 1      aaaattaacttctgctatctcttta 25
              |||||||||||||||| ||||||||
Sbjct: 121158 aaaattaacttctgctttctcttta 121182
to top
>gb|AC007379.2|AC007379 Homo sapiens BAC clone RP11-143C1 from Y, complete sequence
          Length = 174082

 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 1      aaaattaacttctgctatctcttta 25
              |||||||||||||||| ||||||||
Sbjct: 110120 aaaattaacttctgctttctcttta 110096
to top
>ref|NG_004755.1| Homo sapiens chromosome Y palindromes P1, P2, P3 and inverted repeat IR2
               (P1-P2-P3-IR2@) on chromosome Y
          Length = 4538292

 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 1       aaaattaacttctgctatctcttta 25
               |||||||||||||||| ||||||||
Sbjct: 4198053 aaaattaacttctgctttctcttta 4198077



 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 1       aaaattaacttctgctatctcttta 25
               |||||||||||||||| ||||||||
Sbjct: 1850251 aaaattaacttctgctttctcttta 1850227



 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 1      aaaattaacttctgctatctcttta 25
              |||||||||||||||| ||||||||
Sbjct: 724082 aaaattaacttctgctttctcttta 724106



 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 1      aaaattaacttctgctatctcttta 25
              |||||||||||||||| ||||||||
Sbjct: 240540 aaaattaacttctgctttctcttta 240516
to top
>ref|NG_004636.1| Homo sapiens chromosome Y palindromes P4 and P5 (P4-P5@) on chromosome Y
          Length = 1351786

 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 1       aaaattaacttctgctatctcttta 25
               |||||||||||||||| ||||||||
Sbjct: 1263121 aaaattaacttctgctttctcttta 1263097



 Score = 42.1 bits (21), Expect = 0.41
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 1       aaaattaacttctgctatctcttta 25
               |||||||||||||||| ||||||||
Sbjct: 1025096 aaaattaacttctgctttctcttta 1025120
to top
>gb|AC142105.7| Mus musculus BAC clone RP24-240E7 from chromosome 10, complete sequence
          Length = 163869

 Score = 42.1 bits (21), Expect = 0.41
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 92    acactctatgtttctcatagt 112
             |||||||||||||||||||||
Sbjct: 23046 acactctatgtttctcatagt 23026
to top
>gb|AC009298.3| Homo sapiens BAC clone RP11-17I6 from 2, complete sequence
          Length = 165242

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 19    ctctttataactctcattca 38
             ||||||||||||||||||||
Sbjct: 87564 ctctttataactctcattca 87583
to top
>gb|AC134429.3| Mus musculus BAC clone RP24-344D20 from chromosome 9, complete sequence
          Length = 180602

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 1      aaaattaacttctgctatctctt 23
              |||| ||||||||||||||||||
Sbjct: 118936 aaaactaacttctgctatctctt 118914
to top
>gb|AC145076.8| Mus musculus chromosome 10, clone RP24-528G5, complete sequence
          Length = 224534

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 93    cactctatgtttctcatag 111
             |||||||||||||||||||
Sbjct: 97297 cactctatgtttctcatag 97279
to top
>gb|AC092634.3| Homo sapiens BAC clone RP11-340I6 from 7, complete sequence
          Length = 194142

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 45     acagtgtctgacagtgcagaaat 67
              ||||||||||||| |||||||||
Sbjct: 111309 acagtgtctgacaatgcagaaat 111287
to top
>gb|AC133571.47| Medicago truncatula clone mth2-10h12, complete sequence
          Length = 85905

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 18    tctctttataactctcatt 36
             |||||||||||||||||||
Sbjct: 80133 tctctttataactctcatt 80151
to top
>emb|AL607026.11| Human DNA sequence from clone RP11-498G22 on chromosome 10, complete
              sequence
          Length = 172911

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 32     tcattcaaattgtacagtg 50
              |||||||||||||||||||
Sbjct: 103101 tcattcaaattgtacagtg 103083
to top
>emb|AL390318.20| Human DNA sequence from clone RP11-142L16 on chromosome 10 Contains the
              5' end of the PIP5K2A gene for
              phosphatidylinositol-4-phosphate 5-kinase type II alpha and
              one CpG island, complete sequence
          Length = 164955

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 20     tctttataactctcattca 38
              |||||||||||||||||||
Sbjct: 122671 tctttataactctcattca 122689
to top
>emb|CR853297.8| Zebrafish DNA sequence from clone DKEYP-118B3 in linkage group 15,
             complete sequence
          Length = 182283

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 49    tgtctgacagtgcagaaat 67
             |||||||||||||||||||
Sbjct: 22381 tgtctgacagtgcagaaat 22363
to top
>gb|AC112505.5| Homo sapiens 3 BAC RP11-282M5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 55860

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 19    ctctttataactctcattc 37
             |||||||||||||||||||
Sbjct: 36259 ctctttataactctcattc 36277
to top
>gb|AC009560.10| Homo sapiens chromosome 15, clone RP11-219B17, complete sequence
          Length = 177308

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 78    aatcaccttcacctacact 96
             |||||||||||||||||||
Sbjct: 47871 aatcaccttcacctacact 47853
to top
>gb|AC011415.3| Homo sapiens chromosome 5 clone CTB-87P21, complete sequence
          Length = 116976

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 21    ctttataactctcattcaa 39
             |||||||||||||||||||
Sbjct: 90417 ctttataactctcattcaa 90399
to top
>gb|AC024072.5| Homo sapiens chromosome 10 clone RP11-267O2, complete sequence
          Length = 150165

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 32    tcattcaaattgtacagtg 50
             |||||||||||||||||||
Sbjct: 26887 tcattcaaattgtacagtg 26905
to top
>emb|BX571960.6| Zebrafish DNA sequence from clone DKEY-165I8 in linkage group 3,
             complete sequence
          Length = 192501

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 59    tgcagaaatttgatccatg 77
             |||||||||||||||||||
Sbjct: 43120 tgcagaaatttgatccatg 43102
to top
>gb|AC110527.13| Mus musculus chromosome 1, clone RP23-204H10, complete sequence
          Length = 173497

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 5     ttaacttctgctatctctt 23
             |||||||||||||||||||
Sbjct: 78469 ttaacttctgctatctctt 78487
to top
>emb|BX005141.5| Zebrafish DNA sequence from clone CH211-13K16, complete sequence
          Length = 166576

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 49     tgtctgacagtgcagaaat 67
              |||||||||||||||||||
Sbjct: 163749 tgtctgacagtgcagaaat 163767
to top
>ref|NG_001019.4| Homo sapiens immunoglobulin heavy locus (IGH@) on chromosome 14
          Length = 1279711

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 68     ttgatccatgaatcacctt 86
              |||||||||||||||||||
Sbjct: 621569 ttgatccatgaatcacctt 621551
to top
>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica
          Length = 3272609

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 16     tatctctttataactctca 34
              |||||||||||||||||||
Sbjct: 248276 tatctctttataactctca 248258
to top
>gb|M99657.1|HUMIGH320X Human immunoglobulin heavy chain variable region V3-20 (IGHV@)
          gene, exons 1-2
          Length = 514

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 68 ttgatccatgaatcacctt 86
          |||||||||||||||||||
Sbjct: 71 ttgatccatgaatcacctt 53
to top
>dbj|AB019440.1| Homo sapiens DNA for immunoglobulin heavy-chain variable region,
             complete sequence, 4 of 5
          Length = 200000

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 68    ttgatccatgaatcacctt 86
             |||||||||||||||||||
Sbjct: 21569 ttgatccatgaatcacctt 21551


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,141,349
Number of Sequences: 3902068
Number of extensions: 1141349
Number of successful extensions: 75640
Number of sequences better than 10.0: 43
Number of HSP's better than 10.0 without gapping: 44
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 75436
Number of HSP's gapped (non-prelim): 204
length of query: 136
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 115
effective length of database: 17,151,101,840
effective search space: 1972376711600
effective search space used: 1972376711600
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top