ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast26b10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 46 0.064
2gb|AC165426.3| Mus musculus BAC clone RP23-157G2 from chromosome... 42 0.99
3gb|AC131752.3| Mus musculus BAC clone RP23-21D6 from chromosome ... 42 0.99
4emb|CR940309.6| M.truncatula DNA sequence from clone MTH2-10C20 ... 40 3.9
5emb|AL513487.3| Human DNA sequence from clone RP13-63I15 on chro... 40 3.9
6gb|AC011474.6| Homo sapiens chromosome 19 clone CTC-525D6, compl... 40 3.9
7dbj|AK163164.1| Mus musculus 7 days neonate cerebellum cDNA, RIK... 40 3.9
8gb|AC008502.8| Homo sapiens chromosome 5 clone CTC-442G11, compl... 40 3.9
9ref|XM_573292.1| PREDICTED: Rattus norvegicus hematopoietic cell... 40 3.9
10gb|BC079081.1| Rattus norvegicus hematopoietic cell specific Lyn... 40 3.9
11ref|NM_001011898.1| Rattus norvegicus hematopoietic cell specifi... 40 3.9
12emb|AL670660.8| Mouse DNA sequence from clone RP23-265D6 on chro... 40 3.9

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 46.1 bits (23), Expect = 0.064
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 259     gtgccggggcatctggtgctgcg 281
               |||||||||||||||||||||||
Sbjct: 2533373 gtgccggggcatctggtgctgcg 2533395



to top

>gb|AC165426.3| Mus musculus BAC clone RP23-157G2 from chromosome 5, complete sequence
          Length = 245594

 Score = 42.1 bits (21), Expect = 0.99
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 57     acatgatagataaaaatcaat 77
              |||||||||||||||||||||
Sbjct: 206096 acatgatagataaaaatcaat 206116



to top

>gb|AC131752.3| Mus musculus BAC clone RP23-21D6 from chromosome 5, complete sequence
          Length = 203321

 Score = 42.1 bits (21), Expect = 0.99
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 57     acatgatagataaaaatcaat 77
              |||||||||||||||||||||
Sbjct: 140852 acatgatagataaaaatcaat 140872



to top

>emb|CR940309.6| M.truncatula DNA sequence from clone MTH2-10C20 on chromosome 3,
             complete sequence
          Length = 114380

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 112   cacagaagcaaagagtacac 131
             ||||||||||||||||||||
Sbjct: 98409 cacagaagcaaagagtacac 98390



to top

>emb|AL513487.3| Human DNA sequence from clone RP13-63I15 on chromosome Xq24-26.2,
              complete sequence
          Length = 144177

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 62     atagataaaaatcaatctgt 81
              ||||||||||||||||||||
Sbjct: 111260 atagataaaaatcaatctgt 111241



to top

>gb|AC011474.6| Homo sapiens chromosome 19 clone CTC-525D6, complete sequence
          Length = 194718

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 202   gggtgggacagacatgacac 221
             ||||||||||||||||||||
Sbjct: 25887 gggtgggacagacatgacac 25868



to top

>dbj|AK163164.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:A730058C04 product:alpha
           thalassemia/mental retardation syndrome X-linked homolog
           (human), full insert sequence
          Length = 5433

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 111 gcacagaagcaaagagtaca 130
           ||||||||||||||||||||
Sbjct: 532 gcacagaagcaaagagtaca 513



to top

>gb|AC008502.8| Homo sapiens chromosome 5 clone CTC-442G11, complete sequence
          Length = 123495

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 134   aatgatggcaacctttctaa 153
             ||||||||||||||||||||
Sbjct: 29723 aatgatggcaacctttctaa 29704



to top

>ref|XM_573292.1| PREDICTED: Rattus norvegicus hematopoietic cell specific Lyn
           substrate 1 (predicted) (Hcls1_predicted), mRNA
          Length = 1978

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ctggtgctgcgggctcgtcc 290
           ||||||||||||||||||||
Sbjct: 933 ctggtgctgcgggctcgtcc 914



to top

>gb|BC079081.1| Rattus norvegicus hematopoietic cell specific Lyn substrate 1, mRNA
           (cDNA clone MGC:94041 IMAGE:7122756), complete cds
          Length = 1976

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ctggtgctgcgggctcgtcc 290
           ||||||||||||||||||||
Sbjct: 905 ctggtgctgcgggctcgtcc 886



to top

>ref|NM_001011898.1| Rattus norvegicus hematopoietic cell specific Lyn substrate 1
           (Hcls1), mRNA
          Length = 1976

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ctggtgctgcgggctcgtcc 290
           ||||||||||||||||||||
Sbjct: 905 ctggtgctgcgggctcgtcc 886



to top

>emb|AL670660.8| Mouse DNA sequence from clone RP23-265D6 on chromosome X, complete
             sequence
          Length = 181805

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 111   gcacagaagcaaagagtaca 130
             ||||||||||||||||||||
Sbjct: 41141 gcacagaagcaaagagtaca 41160


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,416,895
Number of Sequences: 3902068
Number of extensions: 2416895
Number of successful extensions: 42944
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 42923
Number of HSP's gapped (non-prelim): 21
length of query: 299
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 277
effective length of database: 17,147,199,772
effective search space: 4749774336844
effective search space used: 4749774336844
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top