| Clone Name | rbast24g03 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X07841.1|TARDNAI Wheat rDNA 25S-18S intergenic region EcoRI-BamHI fragment Length = 4642 Score = 56.0 bits (28), Expect = 2e-05 Identities = 31/32 (96%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| |||||||||||||||||||||| Sbjct: 487 acgaatccgtgcgacatggggctggatctcag 456
>emb|X66107.1|TU26S18S T.urartu rDNA for 26S rRNA (partial), external transcribed spacer, and 18S rRNA (partial) Length = 2495 Score = 56.0 bits (28), Expect = 2e-05 Identities = 31/32 (96%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| |||||||||||||||||||||| Sbjct: 80 acgaatccgtgcgacatggggctggatctcag 49
>gb|AF147501.1|AF147501 Hordeum vulgare 26S ribosomal RNA and 18S ribosomal RNA genes, partial sequence; and intergenic region Length = 2609 Score = 56.0 bits (28), Expect = 2e-05 Identities = 31/32 (96%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| |||||||||||||||||||||| Sbjct: 68 acgaatccgtgcgacatggggctggatctcag 37
>gb|M37231.1|RYENORR1 Rye 26S rRNA 3' end and 18S rRNA, 5' end Length = 4507 Score = 56.0 bits (28), Expect = 2e-05 Identities = 31/32 (96%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| |||||||||||||||||||||| Sbjct: 1291 acgaatccgtgcgacatggggctggatctcag 1260
>gb|M37269.1|WHTRGNOR Wheat Nor-D3 locus ribosomal RNA gene Length = 3673 Score = 52.0 bits (26), Expect = 3e-04 Identities = 29/30 (96%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctc 86 ||||||||| |||||||||||||||||||| Sbjct: 399 acgaatccgtgcgacatggggctggatctc 370
>emb|X66109.1|AU26SRRNA Aegilops umbellutata 3'-end of 26S rRNA gene Length = 605 Score = 48.1 bits (24), Expect = 0.004 Identities = 30/32 (93%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 |||| |||| |||||||||||||||||||||| Sbjct: 52 acgattccgtgcgacatggggctggatctcag 21
>gb|AF147500.1|AF147500 Triticum spelta 26S ribosomal RNA and 18S ribosomal RNA genes, partial sequence; and intergenic region Length = 2987 Score = 48.1 bits (24), Expect = 0.004 Identities = 27/28 (96%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatc 84 ||||||||| |||||||||||||||||| Sbjct: 28 acgaatccgtgcgacatggggctggatc 1
>emb|X74820.1|ASRDNAS A.sativa rDNA spacer Length = 4098 Score = 48.1 bits (24), Expect = 0.004 Identities = 30/32 (93%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| ||||| |||||||||||||||| Sbjct: 93 acgaatccgtgcgacgtggggctggatctcag 62
>emb|AL669983.2| Human DNA sequence from clone RP11-220D10 on chromosome 9 Contains a ribosomal protein L35 (RPL35) pseudogene, complete sequence Length = 60725 Score = 42.1 bits (21), Expect = 0.24 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ttcttactgtcctccttttgc 55 ||||||||||||||||||||| Sbjct: 12927 ttcttactgtcctccttttgc 12947
>gb|BT016244.1| Zea mays clone Contig77 mRNA sequence Length = 1121 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| ||||| ||||||||||||||| Sbjct: 1089 acgaatccgtgcgacgcggggctggatctcag 1058
>gb|AY554266.1| Populus tremula var. glandulosa 26S ribosomal RNA gene, partial sequence; 26S-18S intergenic spacer, complete sequence; and 18S ribosomal RNA gene, partial sequence Length = 2909 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||| | |||||||||||||| ||||||| Sbjct: 75 acgaatcggagcgacatggggctgaatctcag 44
>gb|AY554270.1| Populus tremula var. davidiana 26S ribosomal RNA gene, partial sequence; 26S-18S intergenic spacer, complete sequence; and 18S ribosomal RNA gene, partial sequence Length = 2909 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||| | |||||||||||||| ||||||| Sbjct: 75 acgaatcggagcgacatggggctgaatctcag 44
>gb|AY554269.1| Populus tomentosa 26S ribosomal RNA gene, partial sequence; 26S-18S intergenic spacer, complete sequence; and 18S ribosomal RNA gene, partial sequence Length = 2909 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||| | |||||||||||||| ||||||| Sbjct: 75 acgaatcggagcgacatggggctgaatctcag 44
>gb|AY554268.1| Populus alba x Populus tremula var. glandulosa 26S ribosomal RNA gene, partial sequence; 26S-18S intergenic spacer, complete sequence; and 18S ribosomal RNA gene, partial sequence Length = 2909 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||| | |||||||||||||| ||||||| Sbjct: 75 acgaatcggagcgacatggggctgaatctcag 44
>gb|AY554267.1| Populus alba 26S ribosomal RNA gene, partial sequence; 26S-18S intergenic spacer, complete sequence; and 18S ribosomal RNA gene, partial sequence Length = 2911 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||| | |||||||||||||| ||||||| Sbjct: 75 acgaatcggagcgacatggggctgaatctcag 44
>emb|AJ309824.2|ZMA309824 Zea mays 25S rRNA gene and transposon-like sequence Length = 10658 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| ||||| ||||||||||||||| Sbjct: 10622 acgaatccgtgcgacgcggggctggatctcag 10591
>emb|X03990.1|ZMETS1 Maize 26S - 17S rDNA spacer region from Black Mexican Sweet (BMS) suspension cells Length = 3131 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| ||||| ||||||||||||||| Sbjct: 100 acgaatccgtgcgacgcggggctggatctcag 69
>dbj|AP008225.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, fosmid clone:OSJNOa109J19 Length = 30481 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| ||||| ||||||||||||||| Sbjct: 24536 acgaatccgtgcgacgcggggctggatctcag 24505 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| ||||| ||||||||||||||| Sbjct: 16608 acgaatccgtgcgacgcggggctggatctcag 16577 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| ||||| ||||||||||||||| Sbjct: 8680 acgaatccgtgcgacgcggggctggatctcag 8649 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| ||||| ||||||||||||||| Sbjct: 752 acgaatccgtgcgacgcggggctggatctcag 721
>dbj|AB197128.1| Setaria italica genes for 25S rRNA, IGS, 17S rRNA, partial and complete sequence Length = 2646 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| ||||| ||||||||||||||| Sbjct: 486 acgaatccgtgcgacgcggggctggatctcag 455
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| ||||| ||||||||||||||| Sbjct: 28735485 acgaatccgtgcgacgcggggctggatctcag 28735454
>dbj|AP008245.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0013K10 Length = 129118 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| ||||| ||||||||||||||| Sbjct: 32192 acgaatccgtgcgacgcggggctggatctcag 32161 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| ||||| ||||||||||||||| Sbjct: 24264 acgaatccgtgcgacgcggggctggatctcag 24233 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| ||||| ||||||||||||||| Sbjct: 16336 acgaatccgtgcgacgcggggctggatctcag 16305 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| ||||| ||||||||||||||| Sbjct: 8408 acgaatccgtgcgacgcggggctggatctcag 8377 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| ||||| ||||||||||||||| Sbjct: 480 acgaatccgtgcgacgcggggctggatctcag 449
>dbj|AP004778.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0459B01 Length = 163087 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| ||||| ||||||||||||||| Sbjct: 52058 acgaatccgtgcgacgcggggctggatctcag 52027
>emb|X03989.1|ZMRNETS1 Maize external transcribed spacer DNA upstream of 18S rRNA gene Length = 3199 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| ||||| ||||||||||||||| Sbjct: 143 acgaatccgtgcgacgcggggctggatctcag 112
>dbj|AK110461.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-166-F11, full insert sequence Length = 2096 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| ||||| ||||||||||||||| Sbjct: 98 acgaatccgtgcgacgcggggctggatctcag 67
>dbj|AK106912.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-119-A08, full insert sequence Length = 1640 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| ||||| ||||||||||||||| Sbjct: 1252 acgaatccgtgcgacgcggggctggatctcag 1221
>dbj|AK062961.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-109-D06, full insert sequence Length = 628 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| ||||| ||||||||||||||| Sbjct: 93 acgaatccgtgcgacgcggggctggatctcag 62
>gb|AF147502.1|AF147502 Panicum miliaceum 26S ribosomal RNA and 18S ribosomal RNA genes, partial sequence; and intergenic region Length = 2490 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| ||||| ||||||||||||||| Sbjct: 70 acgaatccgtgcgacgcggggctggatctcag 39
>emb|AJ009792.1|ICY9792 Imperata cylindrica 17S and 25S rRNA genes and intergenic spacer, isolate 2-1 Length = 1865 Score = 40.1 bits (20), Expect = 0.96 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 acgaatccgcgcgacatggggctggatctcag 88 ||||||||| | ||| |||||||||||||||| Sbjct: 48 acgaatccgtgtgacgtggggctggatctcag 17
>gb|AC109195.27| Mus musculus chromosome 15, clone RP24-212B11, complete sequence Length = 168270 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 20 ctacagcattcccagttct 38 ||||||||||||||||||| Sbjct: 85804 ctacagcattcccagttct 85822
>gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence Length = 1608198 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 38 ttactgtcctccttttgca 56 ||||||||||||||||||| Sbjct: 1588669 ttactgtcctccttttgca 1588687
>gb|AC159453.1| Trypanosoma brucei chromosome 5 clone RPCI93-5M21, complete sequence Length = 106046 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 38 ttactgtcctccttttgca 56 ||||||||||||||||||| Sbjct: 86517 ttactgtcctccttttgca 86535
>gb|AC163676.4| Mus musculus BAC clone RP24-81A22 from chromosome 3, complete sequence Length = 223760 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 8 caggaatctacactacagc 26 ||||||||||||||||||| Sbjct: 167390 caggaatctacactacagc 167408
>gb|AC132863.8| Mus musculus chromosome 15, clone RP24-388K7, complete sequence Length = 210979 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 21 tacagcattcccagttctt 39 ||||||||||||||||||| Sbjct: 142188 tacagcattcccagttctt 142170
>ref|XM_960705.1| Neurospora crassa OR74A hypothetical protein (NCU00658.1) partial mRNA Length = 12024 Score = 38.2 bits (19), Expect = 3.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 29 tcccagttcttactgtcctcctt 51 |||||| |||||||||||||||| Sbjct: 9545 tcccagctcttactgtcctcctt 9523
>gb|AC131593.16| Mus musculus chromosome 3, clone RP24-566M9, complete sequence Length = 143352 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 8 caggaatctacactacagc 26 ||||||||||||||||||| Sbjct: 62041 caggaatctacactacagc 62059
>ref|XM_324837.1| Neurospora crassa OR74A hypothetical protein (NCU00658.1) partial mRNA Length = 12024 Score = 38.2 bits (19), Expect = 3.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 29 tcccagttcttactgtcctcctt 51 |||||| |||||||||||||||| Sbjct: 9545 tcccagctcttactgtcctcctt 9523
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 24 agcattcccagttcttact 42 ||||||||||||||||||| Sbjct: 1059589 agcattcccagttcttact 1059607
>gb|AC138548.8| Mus musculus chromosome 3, clone RP24-210N9, complete sequence Length = 155964 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 8 caggaatctacactacagc 26 ||||||||||||||||||| Sbjct: 17123 caggaatctacactacagc 17105
>gb|CP000284.1| Methylobacillus flagellatus KT, complete genome Length = 2971517 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 65 gcgcgacatggggctggat 83 ||||||||||||||||||| Sbjct: 317377 gcgcgacatggggctggat 317359
>gb|DQ397629.1| Cenarchaeum symbiosum clone C01B12, complete sequence Length = 34772 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 69 gacatggggctggatctca 87 ||||||||||||||||||| Sbjct: 5120 gacatggggctggatctca 5138
>gb|DQ397587.1| Cenarchaeum symbiosum clone C05B02, complete sequence Length = 39977 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 69 gacatggggctggatctca 87 ||||||||||||||||||| Sbjct: 5875 gacatggggctggatctca 5857
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 24 agcattcccagttcttact 42 ||||||||||||||||||| Sbjct: 1059587 agcattcccagttcttact 1059605
>gb|AC118980.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1263H11, complete sequence Length = 126827 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 24 agcattcccagttcttact 42 ||||||||||||||||||| Sbjct: 79804 agcattcccagttcttact 79822
>gb|AC131299.11| Mus musculus chromosome 15, clone RP23-335O2, complete sequence Length = 215708 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 21 tacagcattcccagttctt 39 ||||||||||||||||||| Sbjct: 18473 tacagcattcccagttctt 18455 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 578,878 Number of Sequences: 3902068 Number of extensions: 578878 Number of successful extensions: 37825 Number of sequences better than 10.0: 44 Number of HSP's better than 10.0 without gapping: 44 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 37735 Number of HSP's gapped (non-prelim): 90 length of query: 89 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 68 effective length of database: 17,151,101,840 effective search space: 1166274925120 effective search space used: 1166274925120 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)