>emb|AL513523.33| Human DNA sequence from clone RP11-216N14 on chromosome 1 Contains a
             survival of motor neuron protein interacting protein 1
             pseudogene (SIP1), a novel gene (FLJ21919), two novel
             genes, a novel gene, the SLC27A3 gene for solute carrier
             family 27 (fatty acid transporter), member 3, a pseudogene
             similar to part of putative neuronal cell adhesion
             molecule (PUNC), the 3' end of the gene for transcription
             repressor p66 beta component of the MeCP1 complex
             (P66beta), a adipose differentiation-related protein
             (ADFP) pseudogene and a CpG island, complete sequence
          Length = 150166

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 118   acaccccatcttaaaaaaca 137
             ||||||||||||||||||||
Sbjct: 38424 acaccccatcttaaaaaaca 38405

>emb|AL356796.16| Human DNA sequence from clone RP11-82I1 on chromosome 9 Contains the 3'
             end of a novel gene (FLJ11985, MGC11337) (KIAA0870), the
             ORM1 gene for orosomucoid 1 (AGP1, AGP-A), the ORM2 gene
             for orosomucoid 2 (AGP2, AGP-B) and the gene for AT-hook
             transcription factor AKNA, complete sequence
          Length = 125673

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 112   atctcaacaccccatcttaaaaaa 135
             ||||||| ||||||||||||||||
Sbjct: 28298 atctcaagaccccatcttaaaaaa 28321

>emb|AL354743.33| Human DNA sequence from clone RP4-785P20 on chromosome 1p36.23-36.33
             Contains the 3' end of the PRDM16 gene for PR domain
             containing 16 and two CpG islands, complete sequence
          Length = 140572

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    tgctcattttcgtttgataa 30
             ||||||||||||||||||||
Sbjct: 79687 tgctcattttcgtttgataa 79668

>dbj|BS000230.1| Pan troglodytes chromosome 22 clone:PTB-105H12, map 22, complete
              sequences
          Length = 242704

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 116    caacaccccatcttaaaaaa 135
              ||||||||||||||||||||
Sbjct: 168450 caacaccccatcttaaaaaa 168469

>dbj|AP001748.1| Homo sapiens genomic DNA, chromosome 21q, section 92/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 116   caacaccccatcttaaaaaa 135
             ||||||||||||||||||||
Sbjct: 15091 caacaccccatcttaaaaaa 15110

>dbj|AP001629.1| Homo sapiens genomic DNA, chromosome 21, clone:KB1405B7, MX1-D21S171
            region, complete sequence
          Length = 89436

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 116  caacaccccatcttaaaaaa 135
            ||||||||||||||||||||
Sbjct: 9230 caacaccccatcttaaaaaa 9249

>dbj|AB039887.1| Homo sapiens WDR4 gene for WD repeat protein, complete cds
          Length = 45000

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 116   caacaccccatcttaaaaaa 135
             ||||||||||||||||||||
Sbjct: 25295 caacaccccatcttaaaaaa 25276


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,827,949
Number of Sequences: 3902068
Number of extensions: 1827949
Number of successful extensions: 118725
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 118708
Number of HSP's gapped (non-prelim): 17
length of query: 215
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 193
effective length of database: 17,147,199,772
effective search space: 3309409555996
effective search space used: 3309409555996
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)