>gb|AE009162.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 188
            of 256 of the complete sequence
          Length = 10134

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ccatttcggtgagtttcacgc 206
            |||||||||||||||||||||
Sbjct: 2099 ccatttcggtgagtttcacgc 2079

>gb|BC070490.1| Homo sapiens cDNA clone IMAGE:6138765, **** WARNING: chimeric clone
           ****
          Length = 1365

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 295 accgcctgcctccgtggatgg 315
           |||||||||||||||||||||
Sbjct: 549 accgcctgcctccgtggatgg 569

>gb|AC010043.7| Drosophila melanogaster 3L BAC RP98-12K4 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 184657

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 186    ccatttcggtgagtttcacgc 206
              |||||||||||||||||||||
Sbjct: 146150 ccatttcggtgagtttcacgc 146130

>gb|AC010107.7| Drosophila melanogaster 3L BAC RP98-2B1 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 181063

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 186    ccatttcggtgagtttcacgc 206
              |||||||||||||||||||||
Sbjct: 148745 ccatttcggtgagtttcacgc 148765

>gb|DQ167756.1| Drosophila simulans putative Laminin B2 (LanB2) gene, exons 7 through
            9 and partial cds
          Length = 2098

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ccatttcggtgagtttcacgc 206
            |||||||||||||||||||||
Sbjct: 1961 ccatttcggtgagtttcacgc 1941

>gb|DQ167754.1| Drosophila erecta putative Laminin B2 (LanB2) gene, exons 7 through 9
            and partial cds
          Length = 2079

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ccatttcggtgagtttcacgc 206
            |||||||||||||||||||||
Sbjct: 1951 ccatttcggtgagtttcacgc 1931

>gb|AC110743.4| Homo sapiens chromosome 18, clone CTD-3153M21, complete sequence
          Length = 78507

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 295   accgcctgcctccgtggatgg 315
             |||||||||||||||||||||
Sbjct: 45256 accgcctgcctccgtggatgg 45276

>ref|NM_079282.1| Drosophila melanogaster Laminin B2 CG3322-RA (LanB2), mRNA
          Length = 5757

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ccatttcggtgagtttcacgc 206
            |||||||||||||||||||||
Sbjct: 4760 ccatttcggtgagtttcacgc 4740

>gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome
          Length = 2841581

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 186     ccatttcggtgagtttcacgc 206
               |||||||||||||||||||||
Sbjct: 2082991 ccatttcggtgagtttcacgc 2082971

>gb|BT021394.1| Drosophila melanogaster LD15803 full insert cDNA
          Length = 5755

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ccatttcggtgagtttcacgc 206
            |||||||||||||||||||||
Sbjct: 4740 ccatttcggtgagtttcacgc 4720

>gb|AE003551.3| Drosophila melanogaster chromosome 3L, section 34 of 83 of the complete
              sequence
          Length = 285860

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 186    ccatttcggtgagtttcacgc 206
              |||||||||||||||||||||
Sbjct: 145949 ccatttcggtgagtttcacgc 145929

>gb|M58417.1|DROLAMB2A Drosophila melanogaster laminin B2 gene, complete cds
          Length = 11464

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 186   ccatttcggtgagtttcacgc 206
             |||||||||||||||||||||
Sbjct: 10100 ccatttcggtgagtttcacgc 10080

>gb|M25063.1|DROLAMB2 Drosophila mRNA for laminin B2 chain
          Length = 5737

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ccatttcggtgagtttcacgc 206
            |||||||||||||||||||||
Sbjct: 4740 ccatttcggtgagtttcacgc 4720

>ref|NM_115269.3| Arabidopsis thaliana kinase AT3G54090 mRNA, complete cds
          Length = 1588

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 382  gatggaacataaacttattctttc 405
            |||||||||||||||| |||||||
Sbjct: 1427 gatggaacataaacttgttctttc 1404

>gb|AC121603.4| Mus musculus BAC clone RP23-310D9 from 18, complete sequence
          Length = 195555

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 98     tgccatgactgctgcctgca 117
              ||||||||||||||||||||
Sbjct: 175042 tgccatgactgctgcctgca 175023

>emb|AL132957.1|ATF24B22 Arabidopsis thaliana DNA chromosome 3, BAC clone F24B22
          Length = 100285

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 382   gatggaacataaacttattctttc 405
             |||||||||||||||| |||||||
Sbjct: 14927 gatggaacataaacttgttctttc 14904

>gb|AY128817.1| Arabidopsis thaliana fructokinase-like protein (At3g54090) mRNA,
            complete cds
          Length = 1474

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 382  gatggaacataaacttattctttc 405
            |||||||||||||||| |||||||
Sbjct: 1406 gatggaacataaacttgttctttc 1383

>gb|AY093161.1| Arabidopsis thaliana fructokinase-like protein (At3g54090) mRNA,
            complete cds
          Length = 1534

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 382  gatggaacataaacttattctttc 405
            |||||||||||||||| |||||||
Sbjct: 1427 gatggaacataaacttgttctttc 1404

>gb|AC008105.32| Homo sapiens chromosome 17, clone CTD-2020K17, complete sequence
          Length = 96875

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 132   agtcttcctctcatgccagg 151
             ||||||||||||||||||||
Sbjct: 88719 agtcttcctctcatgccagg 88738

>emb|BX822350.1|CNS0A5ZK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB30ZA06 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1503

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 382  gatggaacataaacttattctttc 405
            |||||||||||||||| |||||||
Sbjct: 1421 gatggaacataaacttgttctttc 1398

>emb|BX824609.1|CNS0A5QO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH5ZB04 of Hormone Treated Callus of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1481

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 382  gatggaacataaacttattctttc 405
            |||||||||||||||| |||||||
Sbjct: 1371 gatggaacataaacttgttctttc 1348

>emb|BX824482.1|CNS0A5K3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH50ZH02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 308

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 382 gatggaacataaacttattctttc 405
           |||||||||||||||| |||||||
Sbjct: 184 gatggaacataaacttgttctttc 161


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,000,884
Number of Sequences: 3902068
Number of extensions: 3000884
Number of successful extensions: 49100
Number of sequences better than 10.0: 22
Number of HSP's better than 10.0 without gapping: 22
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49062
Number of HSP's gapped (non-prelim): 38
length of query: 451
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 429
effective length of database: 17,147,199,772
effective search space: 7356148702188
effective search space used: 7356148702188
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)