ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast17f05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|CP000001.1| Bacillus cereus E33L, complete genome 42 0.59
2emb|BX640437.1| Bordetella bronchiseptica strain RB50, complete ... 40 2.3
3emb|BX914217.19| Zebrafish DNA sequence from clone DKEY-175H14 i... 40 2.3
4gb|AC152505.2| Pan troglodytes BAC clone RP43-113N22 from chromo... 40 2.3
5gb|AY220127.1| Mus musculus osteopontin gene, promoter region an... 40 2.3
6gb|AC012668.13| Homo sapiens BAC clone RP11-458D8 from 2, comple... 40 2.3
7gb|AC099637.7| Mus musculus chromosome 1, clone RP24-257C20, com... 38 9.2
8ref|XM_524908.1| PREDICTED: Pan troglodytes LOC469525 (LOC469525... 38 9.2
9gb|AC136641.3| Mus musculus BAC clone RP23-313G19 from chromosom... 38 9.2
10gb|AC131669.3| Mus musculus BAC clone RP23-307E9 from chromosome... 38 9.2
11gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 compl... 38 9.2
12ref|NM_001004476.1| Homo sapiens olfactory receptor, family 10, ... 38 9.2
13gb|AC166290.7| Mus musculus BAC RP23-14P17 (Roswell Park Cancer... 38 9.2
14gb|AF411018.1| Neurospora crassa suppressor of ascus dominance R... 38 9.2
15gb|AF339501.1| Pichia angusta alpha-COP-like protein (OPU27) gen... 38 9.2
16emb|AJ699420.1| Gallus gallus mRNA for alpha-2,8-sialyltransfera... 38 9.2
17emb|AL450332.19| Human DNA sequence from clone RP11-138M12 on ch... 38 9.2
18emb|AL356108.12| Human DNA sequence from clone RP11-149J18 on ch... 38 9.2
19emb|AL136097.10| Human DNA sequence from clone RP11-62C3 on chro... 38 9.2
20emb|AL121986.12|HSBA101J8 Human DNA sequence from clone RP11-101... 38 9.2
21emb|AL732462.20| Mouse DNA sequence from clone RP23-132J5 on chr... 38 9.2
22ref|NM_001001746.1| Gallus gallus ST8 alpha-N-acetyl-neuraminide... 38 9.2
23gb|AC116648.4| Homo sapiens BAC clone RP11-764M6 from 4, complet... 38 9.2
24gb|AC007518.32| Mus musculus chromosome , clone CT7-345D4, compl... 38 9.2
25gb|AC013477.7| Homo sapiens BAC clone RP11-559F19 from 4, comple... 38 9.2
26dbj|AK158926.1| Mus musculus visual cortex cDNA, RIKEN full-leng... 38 9.2
27tpg|BK004363.1| TPA: TPA_exp: Homo sapiens olfactory receptor OR... 38 9.2
28tpg|BK001432.1| TPA: TPA_exp: Homo sapiens SULT1C3 (SULT1C3) gen... 38 9.2
29gb|AC019100.4| Homo sapiens BAC clone RP11-443K8 from 2, complet... 38 9.2
30gb|AC153619.5| Mus musculus 6 BAC RP23-365G1 (Roswell Park Cance... 38 9.2
31gb|AE015924.1| Porphyromonas gingivalis W83, complete genome 38 9.2
32dbj|AP002532.1| Homo sapiens genomic DNA, chromosome 1q22-q23, C... 38 9.2
33dbj|AB045358.1| Homo sapiens genomic DNA, chromosome 1q22-q23, c... 38 9.2
34dbj|AB065642.1| Homo sapiens gene for seven transmembrane helix ... 38 9.2

>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 42.1 bits (21), Expect = 0.59
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 17      cttcatcttgaataaacatta 37
               |||||||||||||||||||||
Sbjct: 3805514 cttcatcttgaataaacatta 3805534



to top

>emb|BX640437.1| Bordetella bronchiseptica strain RB50, complete genome; segment 1/16
          Length = 347356

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 123    gcaccggctcgcgaaaacgc 142
              ||||||||||||||||||||
Sbjct: 282211 gcaccggctcgcgaaaacgc 282230



to top

>emb|BX914217.19| Zebrafish DNA sequence from clone DKEY-175H14 in linkage group 18,
             complete sequence
          Length = 133981

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 16    tcttcatcttgaataaacat 35
             ||||||||||||||||||||
Sbjct: 50191 tcttcatcttgaataaacat 50172



to top

>gb|AC152505.2| Pan troglodytes BAC clone RP43-113N22 from chromosome 7, complete
             sequence
          Length = 219580

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 8     tccatcactcttcatcttga 27
             ||||||||||||||||||||
Sbjct: 87847 tccatcactcttcatcttga 87828



to top

>gb|AY220127.1| Mus musculus osteopontin gene, promoter region and 5' UTR
          Length = 5521

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 6    agtccatcactcttcatctt 25
            ||||||||||||||||||||
Sbjct: 2210 agtccatcactcttcatctt 2191



to top

>gb|AC012668.13| Homo sapiens BAC clone RP11-458D8 from 2, complete sequence
          Length = 192396

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 17     cttcatcttgaataaacattacat 40
              |||| |||||||||||||||||||
Sbjct: 151003 cttcctcttgaataaacattacat 150980



to top

>gb|AC099637.7| Mus musculus chromosome 1, clone RP24-257C20, complete sequence
          Length = 169573

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 25    tgaataaacattacatggt 43
             |||||||||||||||||||
Sbjct: 64232 tgaataaacattacatggt 64214



to top

>ref|XM_524908.1| PREDICTED: Pan troglodytes LOC469525 (LOC469525), mRNA
          Length = 1449

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 106 gttatgatcgttacatagc 124
           |||||||||||||||||||
Sbjct: 356 gttatgatcgttacatagc 374



to top

>gb|AC136641.3| Mus musculus BAC clone RP23-313G19 from chromosome 7, complete sequence
          Length = 215208

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 145    gggagaatagatagctcgctact 167
              |||||||||||||||| ||||||
Sbjct: 210092 gggagaatagatagctagctact 210070



to top

>gb|AC131669.3| Mus musculus BAC clone RP23-307E9 from chromosome 7, complete sequence
          Length = 189956

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 145   gggagaatagatagctcgctact 167
             |||||||||||||||| ||||||
Sbjct: 45670 gggagaatagatagctagctact 45648



to top

>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome
          Length = 6397126

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 54      accacaaactgctcactcg 72
               |||||||||||||||||||
Sbjct: 4110724 accacaaactgctcactcg 4110742



to top

>ref|NM_001004476.1| Homo sapiens olfactory receptor, family 10, subfamily K, member 2
           (OR10K2), mRNA
          Length = 939

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 106 gttatgatcgttacatagc 124
           |||||||||||||||||||
Sbjct: 356 gttatgatcgttacatagc 374



to top

>gb|AC166290.7| Mus musculus  BAC RP23-14P17 (Roswell Park Cancer Institute (C57BL/6J
            Female) Mouse BAC Library) complete sequence
          Length = 242055

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 18   ttcatcttgaataaacatt 36
            |||||||||||||||||||
Sbjct: 1084 ttcatcttgaataaacatt 1102



to top

>gb|AF411018.1| Neurospora crassa suppressor of ascus dominance RIP154 mutant (Sad-1)
            gene, complete sequence
          Length = 6204

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 73   gaaaaacactgcccaagtc 91
            |||||||||||||||||||
Sbjct: 2913 gaaaaacactgcccaagtc 2895



to top

>gb|AF339501.1| Pichia angusta alpha-COP-like protein (OPU27) gene, complete cds
          Length = 4075

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 16  tcttcatcttgaataaaca 34
           |||||||||||||||||||
Sbjct: 179 tcttcatcttgaataaaca 161



to top

>emb|AJ699420.1| Gallus gallus mRNA for alpha-2,8-sialyltransferase (SIAT8C gene)
          Length = 1128

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 21  atcttgaataaacattaca 39
           |||||||||||||||||||
Sbjct: 445 atcttgaataaacattaca 463



to top

>emb|AL450332.19| Human DNA sequence from clone RP11-138M12 on chromosome 6 Contains part
             of a novel gene, complete sequence
          Length = 174678

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 8     tccatcactcttcatcttgaata 30
             |||| ||||||||||||||||||
Sbjct: 29626 tccaacactcttcatcttgaata 29648



to top

>emb|AL356108.12| Human DNA sequence from clone RP11-149J18 on chromosome 1 Contains part
             of a novel gene and a glutaminyl-tRNA synthase
             (glutamine-hydrolyzing)-like 1 (QRSL1) pseudogene,
             complete sequence
          Length = 162347

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 84    cccaagtcaagatcaaaat 102
             |||||||||||||||||||
Sbjct: 23497 cccaagtcaagatcaaaat 23479



to top

>emb|AL136097.10| Human DNA sequence from clone RP11-62C3 on chromosome 9q22.1-22.33
             Contains a novel pseudogene, a novel gene, the IARS gene
             for isoleucine-tRNA synthetase, the  gene for a novel
             protein (FLJ20736), the 5' end of a novel gene, a UPF0183
             protein pseudogene, the NOL8 gene for nucleolar protein 8
             and three CpG islands, complete sequence
          Length = 193488

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 17    cttcatcttgaataaacat 35
             |||||||||||||||||||
Sbjct: 31713 cttcatcttgaataaacat 31731



to top

>emb|AL121986.12|HSBA101J8 Human DNA sequence from clone RP11-101J8 on chromosome 1q21.2-22 Contains
              the CD1A gene for CD1A antigen, a polypeptide, a
              high-mobility group nucleosome binding domain 1 (HMGN1)
              pseudogene, the CD1C gene for CD1C antigen, c polypeptide,
              the CD1B gene for CD1B antigen, b polypeptide, the CD1E
              gene for CD1E antigen, e polypeptide, the OR10T2 gene for
              olfactory receptor, family 10, subfamily T, member 2 and
              the OR10K2 gene for olfactory receptor, family 10,
              subfamily K, member 2, complete sequence
          Length = 168753

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 106    gttatgatcgttacatagc 124
              |||||||||||||||||||
Sbjct: 166926 gttatgatcgttacatagc 166908



to top

>emb|AL732462.20| Mouse DNA sequence from clone RP23-132J5 on chromosome 1, complete
             sequence
          Length = 91356

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 25    tgaataaacattacatggt 43
             |||||||||||||||||||
Sbjct: 30405 tgaataaacattacatggt 30387



to top

>ref|NM_001001746.1| Gallus gallus ST8 alpha-N-acetyl-neuraminide
           alpha-2,8-sialyltransferase 3 (ST8SIA3), mRNA
          Length = 1128

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 21  atcttgaataaacattaca 39
           |||||||||||||||||||
Sbjct: 445 atcttgaataaacattaca 463



to top

>gb|AC116648.4| Homo sapiens BAC clone RP11-764M6 from 4, complete sequence
          Length = 130445

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 168  ggtcaaaaattactctcac 186
            |||||||||||||||||||
Sbjct: 1826 ggtcaaaaattactctcac 1808



to top

>gb|AC007518.32| Mus musculus chromosome , clone CT7-345D4, complete sequence
          Length = 193714

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 18    ttcatcttgaataaacatt 36
             |||||||||||||||||||
Sbjct: 79370 ttcatcttgaataaacatt 79388



to top

>gb|AC013477.7| Homo sapiens BAC clone RP11-559F19 from 4, complete sequence
          Length = 182092

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 168    ggtcaaaaattactctcac 186
              |||||||||||||||||||
Sbjct: 181918 ggtcaaaaattactctcac 181900



to top

>dbj|AK158926.1| Mus musculus visual cortex cDNA, RIKEN full-length enriched library,
            clone:K530010E06 product:unclassifiable, full insert
            sequence
          Length = 3983

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 18   ttcatcttgaataaacatt 36
            |||||||||||||||||||
Sbjct: 3366 ttcatcttgaataaacatt 3384



to top

>tpg|BK004363.1| TPA: TPA_exp: Homo sapiens olfactory receptor OR1-4 gene, complete
           cds
          Length = 939

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 106 gttatgatcgttacatagc 124
           |||||||||||||||||||
Sbjct: 356 gttatgatcgttacatagc 374



to top

>tpg|BK001432.1| TPA: TPA_exp: Homo sapiens SULT1C3 (SULT1C3) gene, complete cds,
             alternatively spliced
          Length = 23501

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 28    ataaacattacatggtgtc 46
             |||||||||||||||||||
Sbjct: 12518 ataaacattacatggtgtc 12536



to top

>gb|AC019100.4| Homo sapiens BAC clone RP11-443K8 from 2, complete sequence
          Length = 213475

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 28     ataaacattacatggtgtc 46
              |||||||||||||||||||
Sbjct: 107770 ataaacattacatggtgtc 107788



to top

>gb|AC153619.5| Mus musculus 6 BAC RP23-365G1 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 116250

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 18    ttcatcttgaataaacatt 36
             |||||||||||||||||||
Sbjct: 93332 ttcatcttgaataaacatt 93350



to top

>gb|AE015924.1| Porphyromonas gingivalis W83, complete genome
          Length = 2343476

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 8       tccatcactcttcatcttg 26
               |||||||||||||||||||
Sbjct: 1633589 tccatcactcttcatcttg 1633571



to top

>dbj|AP002532.1| Homo sapiens genomic DNA, chromosome 1q22-q23, CD1 region, section 1/4
          Length = 300000

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 106    gttatgatcgttacatagc 124
              |||||||||||||||||||
Sbjct: 245656 gttatgatcgttacatagc 245638



to top

>dbj|AB045358.1| Homo sapiens genomic DNA, chromosome 1q22-q23, clone:893n23, complete
              sequence
          Length = 118264

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 106    gttatgatcgttacatagc 124
              |||||||||||||||||||
Sbjct: 113529 gttatgatcgttacatagc 113511



to top

>dbj|AB065642.1| Homo sapiens gene for seven transmembrane helix receptor, complete
           cds, isolate:CBRC7TM_205
          Length = 2084

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 106 gttatgatcgttacatagc 124
           |||||||||||||||||||
Sbjct: 556 gttatgatcgttacatagc 574


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,331,545
Number of Sequences: 3902068
Number of extensions: 1331545
Number of successful extensions: 83127
Number of sequences better than 10.0: 34
Number of HSP's better than 10.0 without gapping: 34
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 83009
Number of HSP's gapped (non-prelim): 118
length of query: 187
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 165
effective length of database: 17,147,199,772
effective search space: 2829287962380
effective search space used: 2829287962380
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top