>ref|XM_517590.1| PREDICTED: Pan troglodytes similar to FAT gene product (LOC461671),
            mRNA
          Length = 8879

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 75   aaggaactaacatggctggt 94
            ||||||||||||||||||||
Sbjct: 1670 aaggaactaacatggctggt 1689

>ref|XM_585004.2| PREDICTED: Bos taurus similar to FAT tumor suppressor 1 precursor,
            transcript variant 1 (LOC508251), mRNA
          Length = 14923

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 75   aaggaactaacatggctggt 94
            ||||||||||||||||||||
Sbjct: 5529 aaggaactaacatggctggt 5548

>ref|XM_874825.1| PREDICTED: Bos taurus similar to FAT tumor suppressor 1 precursor,
            transcript variant 3 (LOC508251), mRNA
          Length = 15031

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 75   aaggaactaacatggctggt 94
            ||||||||||||||||||||
Sbjct: 5529 aaggaactaacatggctggt 5548

>ref|XM_864984.1| PREDICTED: Bos taurus similar to FAT tumor suppressor 1 precursor,
            transcript variant 2 (LOC508251), mRNA
          Length = 14929

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 75   aaggaactaacatggctggt 94
            ||||||||||||||||||||
Sbjct: 5529 aaggaactaacatggctggt 5548

>ref|NM_005245.3| Homo sapiens FAT tumor suppressor homolog 1 (Drosophila) (FAT), mRNA
          Length = 14773

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 75   aaggaactaacatggctggt 94
            ||||||||||||||||||||
Sbjct: 5401 aaggaactaacatggctggt 5420

>ref|XM_532835.2| PREDICTED: Canis familiaris similar to FAT tumor suppressor 1
            precursor (LOC475621), mRNA
          Length = 14079

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 75   aaggaactaacatggctggt 94
            ||||||||||||||||||||
Sbjct: 5213 aaggaactaacatggctggt 5232

>emb|X87241.1|HSHFATPRO H.sapiens mRNA for hFat protein
          Length = 14756

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 75   aaggaactaacatggctggt 94
            ||||||||||||||||||||
Sbjct: 5408 aaggaactaacatggctggt 5427

>gb|AC110761.3| Homo sapiens BAC clone RP11-45C13 from 4, complete sequence
          Length = 153458

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 75     aaggaactaacatggctggt 94
              ||||||||||||||||||||
Sbjct: 122178 aaggaactaacatggctggt 122159

>gb|CP000282.1| Saccharophagus degradans 2-40, complete genome
          Length = 5057531

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 214     atcgccttgatgatttcttg 233
               ||||||||||||||||||||
Sbjct: 2863343 atcgccttgatgatttcttg 2863324

>dbj|AP006878.1| Thermococcus kodakarensis KOD1 DNA, complete genome
          Length = 2088737

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 161    atctactggtcatgaggcgg 180
              ||||||||||||||||||||
Sbjct: 586881 atctactggtcatgaggcgg 586862


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,405,829
Number of Sequences: 3902068
Number of extensions: 1405829
Number of successful extensions: 27122
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27103
Number of HSP's gapped (non-prelim): 19
length of query: 239
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 217
effective length of database: 17,147,199,772
effective search space: 3720942350524
effective search space used: 3720942350524
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)