| Clone Name | rbast17e02 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_517590.1| PREDICTED: Pan troglodytes similar to FAT gene product (LOC461671), mRNA Length = 8879 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 75 aaggaactaacatggctggt 94 |||||||||||||||||||| Sbjct: 1670 aaggaactaacatggctggt 1689
>ref|XM_585004.2| PREDICTED: Bos taurus similar to FAT tumor suppressor 1 precursor, transcript variant 1 (LOC508251), mRNA Length = 14923 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 75 aaggaactaacatggctggt 94 |||||||||||||||||||| Sbjct: 5529 aaggaactaacatggctggt 5548
>ref|XM_874825.1| PREDICTED: Bos taurus similar to FAT tumor suppressor 1 precursor, transcript variant 3 (LOC508251), mRNA Length = 15031 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 75 aaggaactaacatggctggt 94 |||||||||||||||||||| Sbjct: 5529 aaggaactaacatggctggt 5548
>ref|XM_864984.1| PREDICTED: Bos taurus similar to FAT tumor suppressor 1 precursor, transcript variant 2 (LOC508251), mRNA Length = 14929 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 75 aaggaactaacatggctggt 94 |||||||||||||||||||| Sbjct: 5529 aaggaactaacatggctggt 5548
>ref|NM_005245.3| Homo sapiens FAT tumor suppressor homolog 1 (Drosophila) (FAT), mRNA Length = 14773 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 75 aaggaactaacatggctggt 94 |||||||||||||||||||| Sbjct: 5401 aaggaactaacatggctggt 5420
>ref|XM_532835.2| PREDICTED: Canis familiaris similar to FAT tumor suppressor 1 precursor (LOC475621), mRNA Length = 14079 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 75 aaggaactaacatggctggt 94 |||||||||||||||||||| Sbjct: 5213 aaggaactaacatggctggt 5232
>emb|X87241.1|HSHFATPRO H.sapiens mRNA for hFat protein Length = 14756 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 75 aaggaactaacatggctggt 94 |||||||||||||||||||| Sbjct: 5408 aaggaactaacatggctggt 5427
>gb|AC110761.3| Homo sapiens BAC clone RP11-45C13 from 4, complete sequence Length = 153458 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 75 aaggaactaacatggctggt 94 |||||||||||||||||||| Sbjct: 122178 aaggaactaacatggctggt 122159
>gb|CP000282.1| Saccharophagus degradans 2-40, complete genome Length = 5057531 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 214 atcgccttgatgatttcttg 233 |||||||||||||||||||| Sbjct: 2863343 atcgccttgatgatttcttg 2863324
>dbj|AP006878.1| Thermococcus kodakarensis KOD1 DNA, complete genome Length = 2088737 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 161 atctactggtcatgaggcgg 180 |||||||||||||||||||| Sbjct: 586881 atctactggtcatgaggcgg 586862 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,405,829 Number of Sequences: 3902068 Number of extensions: 1405829 Number of successful extensions: 27122 Number of sequences better than 10.0: 10 Number of HSP's better than 10.0 without gapping: 10 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 27103 Number of HSP's gapped (non-prelim): 19 length of query: 239 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 217 effective length of database: 17,147,199,772 effective search space: 3720942350524 effective search space used: 3720942350524 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)