ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast17b03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|BX571771.5| Zebrafish DNA sequence from clone CH211-160F8 in... 44 0.24
2dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.24
3gb|AC018693.8| Homo sapiens BAC clone RP11-555N21 from 2, comple... 44 0.24
4emb|BX640583.7| Zebrafish DNA sequence from clone CH211-186C22 i... 44 0.24
5gb|AC092833.4| Homo sapiens BAC clone RP13-490C19 from 2, comple... 44 0.24
6dbj|AP004085.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.24
7gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 42 0.93
8gb|AC107224.2| Oryza sativa (japonica cultivar-group) chromosome... 42 0.93
9emb|CR735124.10| Zebrafish DNA sequence from clone CH211-186G12 ... 42 0.93
10gb|AC114322.2| Homo sapiens chromosome 5 clone RP11-74D3, comple... 42 0.93
11gb|AC114945.2| Homo sapiens chromosome 5 clone CTD-2604I2, compl... 42 0.93
12gb|AC074133.5| Homo sapiens chromosome 5 clone CTD-2278B20, comp... 42 0.93
13dbj|AK146569.1| Mus musculus 17 days embryo heart cDNA, RIKEN fu... 42 0.93
14dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 42 0.93
15emb|BX247875.6| Zebrafish DNA sequence from clone CH211-201N18, ... 42 0.93
16gb|AC124566.5| Mus musculus BAC clone RP23-144N15 from 7, comple... 42 0.93
17gb|AC150393.2| Branchiostoma floridae clone CH302-13E12, complet... 40 3.7
18gb|AY692077.1| Plantago lanceolata 18S ribosomal RNA gene, parti... 40 3.7
19gb|AC162693.5| Mus musculus chromosome 15, clone RP24-89G21, com... 40 3.7
20gb|AC026866.8| Homo sapiens BAC clone RP11-420P20 from 7, comple... 40 3.7
21gb|AC123872.4| Mus musculus BAC clone RP23-254P8 from 2, complet... 40 3.7
22gb|AC004009.1| Homo sapiens PAC clone RP5-1103I5 from 7, complet... 40 3.7
23gb|AC140949.1| Pan troglodytes BAC clone RP43-168N2 from 7, comp... 40 3.7
24gb|AC021028.12| Homo sapiens chromosome 10 clone RP11-137H2, com... 40 3.7
25gb|AC120496.2| Genomic sequence for Sorghum bicolor, clone SBBBc... 40 3.7
26gb|AY101899.1| Plantago leiopetala 18S ribosomal RNA gene, parti... 40 3.7
27gb|AY101898.1| Plantago lanceolata 18S ribosomal RNA gene, parti... 40 3.7
28emb|AL691481.15| Mouse DNA sequence from clone RP23-173C3 on chr... 40 3.7
29ref|NM_204810.1| Gallus gallus leukocyte cell derived chemotaxin... 40 3.7
30dbj|AK140902.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 40 3.7
31dbj|AK157660.1| Mus musculus activated spleen cDNA, RIKEN full-l... 40 3.7
32gb|AC158999.2| Mus musculus BAC clone RP24-201N16 from chromosom... 40 3.7
33gb|AF313036.1|AF313036 Plantago lanceolata 18S ribosomal RNA gen... 40 3.7
34ref|XM_624083.1| PREDICTED: Apis mellifera similar to ENSANGP000... 40 3.7
35gb|AC021667.21|AC021667 Mus musculus, clone RP23-304J12, complet... 40 3.7
36gb|AC009376.7| Drosophila melanogaster 3 BAC RPCI98-1D4 (Roswell... 40 3.7
37gb|CP000033.1| Lactobacillus acidophilus NCFM, complete genome 40 3.7
38emb|AJ548985.1|PLE548985 Plantago leiopetala partial 18S rRNA ge... 40 3.7
39emb|AJ548984.1|PLA548984 Plantago lanceolata partial 18S rRNA ge... 40 3.7
40gb|AF027380.1|AF027380 Gallus gallus chondromodulin-I precursor ... 40 3.7
41gb|AF138280.1|AF138280 Gallus gallus chondromodulin-I mRNA, comp... 40 3.7
42gb|AE003516.4| Drosophila melanogaster chromosome 3L, section 69... 40 3.7
43emb|AL928587.7| Mouse DNA sequence from clone RP23-282M14 on chr... 40 3.7

>emb|BX571771.5| Zebrafish DNA sequence from clone CH211-160F8 in linkage group 21,
             complete sequence
          Length = 162245

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 195   ataattacttcaatgcacaaca 216
             ||||||||||||||||||||||
Sbjct: 70951 ataattacttcaatgcacaaca 70972



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 224     aaaataatgcattttcactggc 245
               ||||||||||||||||||||||
Sbjct: 6273026 aaaataatgcattttcactggc 6273047



to top

>gb|AC018693.8| Homo sapiens BAC clone RP11-555N21 from 2, complete sequence
          Length = 164125

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 170   tatcatggagagtacatatataagaa 195
             ||||||||||||||||||| ||||||
Sbjct: 37436 tatcatggagagtacatatttaagaa 37411



to top

>emb|BX640583.7| Zebrafish DNA sequence from clone CH211-186C22 in linkage group 21,
             complete sequence
          Length = 130141

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 195   ataattacttcaatgcacaaca 216
             ||||||||||||||||||||||
Sbjct: 62150 ataattacttcaatgcacaaca 62129



to top

>gb|AC092833.4| Homo sapiens BAC clone RP13-490C19 from 2, complete sequence
          Length = 143506

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 170   tatcatggagagtacatatataagaa 195
             ||||||||||||||||||| ||||||
Sbjct: 43203 tatcatggagagtacatatttaagaa 43178



to top

>dbj|AP004085.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1267_F10
          Length = 162669

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 224   aaaataatgcattttcactggc 245
             ||||||||||||||||||||||
Sbjct: 70413 aaaataatgcattttcactggc 70434



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 225    aaataatgcattttcactggc 245
              |||||||||||||||||||||
Sbjct: 367761 aaataatgcattttcactggc 367781



to top

>gb|AC107224.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0009C08, complete sequence
          Length = 137033

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 225   aaataatgcattttcactggc 245
             |||||||||||||||||||||
Sbjct: 95289 aaataatgcattttcactggc 95309



to top

>emb|CR735124.10| Zebrafish DNA sequence from clone CH211-186G12 in linkage group 21,
             complete sequence
          Length = 149968

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 71    ataatgtaaaagacagacagtttag 95
             ||||||||||| |||||||||||||
Sbjct: 20069 ataatgtaaaatacagacagtttag 20045



to top

>gb|AC114322.2| Homo sapiens chromosome 5 clone RP11-74D3, complete sequence
          Length = 133348

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   acaacaatgttctaaaataat 231
             |||||||||||||||||||||
Sbjct: 27026 acaacaatgttctaaaataat 27046



to top

>gb|AC114945.2| Homo sapiens chromosome 5 clone CTD-2604I2, complete sequence
          Length = 129575

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 211  acaacaatgttctaaaataat 231
            |||||||||||||||||||||
Sbjct: 9175 acaacaatgttctaaaataat 9155



to top

>gb|AC074133.5| Homo sapiens chromosome 5 clone CTD-2278B20, complete sequence
          Length = 75852

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 185   atatataagaataattacttcaatg 209
             |||||||||||||||||||| ||||
Sbjct: 35167 atatataagaataattactttaatg 35143



to top

>dbj|AK146569.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched
            library, clone:I920028E17 product:integrin alpha M, full
            insert sequence
          Length = 3753

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 246  tctttgtttatctttgggagccaaa 270
            ||||||||| |||||||||||||||
Sbjct: 3347 tctttgtttgtctttgggagccaaa 3323



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3,
              complete sequence
          Length = 36192742

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 225    aaataatgcattttcactggc 245
              |||||||||||||||||||||
Sbjct: 367759 aaataatgcattttcactggc 367779



to top

>emb|BX247875.6| Zebrafish DNA sequence from clone CH211-201N18, complete sequence
          Length = 213093

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 214    acaatgttctaaaataatgca 234
              |||||||||||||||||||||
Sbjct: 192329 acaatgttctaaaataatgca 192309



to top

>gb|AC124566.5| Mus musculus BAC clone RP23-144N15 from 7, complete sequence
          Length = 181231

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 246    tctttgtttatctttgggagccaaa 270
              ||||||||| |||||||||||||||
Sbjct: 161349 tctttgtttgtctttgggagccaaa 161373



to top

>gb|AC150393.2| Branchiostoma floridae clone CH302-13E12, complete sequence
          Length = 207808

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 20    ttactgcagtaagttttgtcccca 43
             |||||||||| |||||||||||||
Sbjct: 93657 ttactgcagtcagttttgtcccca 93634



to top

>gb|AY692077.1| Plantago lanceolata 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 25S ribosomal RNA gene, partial sequence
          Length = 706

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 261 gggagccaaaggggcaacga 280
           ||||||||||||||||||||
Sbjct: 237 gggagccaaaggggcaacga 218



to top

>gb|AC162693.5| Mus musculus chromosome 15, clone RP24-89G21, complete sequence
          Length = 159813

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 167    ttgtatcatggagagtacatatat 190
              |||||| |||||||||||||||||
Sbjct: 140771 ttgtataatggagagtacatatat 140748



to top

>gb|AC026866.8| Homo sapiens BAC clone RP11-420P20 from 7, complete sequence
          Length = 179438

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 185  atatataagaataattactt 204
            ||||||||||||||||||||
Sbjct: 8360 atatataagaataattactt 8341



to top

>gb|AC123872.4| Mus musculus BAC clone RP23-254P8 from 2, complete sequence
          Length = 185953

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 182 tacatatataagaataatta 201
           ||||||||||||||||||||
Sbjct: 370 tacatatataagaataatta 389



to top

>gb|AC004009.1| Homo sapiens PAC clone RP5-1103I5 from 7, complete sequence
          Length = 80765

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 209   gcacaacaatgttctaaaataatg 232
             |||||||||| |||||||||||||
Sbjct: 32085 gcacaacaatcttctaaaataatg 32062



to top

>gb|AC140949.1| Pan troglodytes BAC clone RP43-168N2 from 7, complete sequence
          Length = 193777

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 185    atatataagaataattactt 204
              ||||||||||||||||||||
Sbjct: 131763 atatataagaataattactt 131744



to top

>gb|AC021028.12| Homo sapiens chromosome 10 clone RP11-137H2, complete sequence
          Length = 161803

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 184    catatataagaataattact 203
              ||||||||||||||||||||
Sbjct: 124390 catatataagaataattact 124371



to top

>gb|AC120496.2| Genomic sequence for Sorghum bicolor, clone SBBBc0267M07, complete
            sequence
          Length = 120132

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 66   aaagaataatgtaaaagaca 85
            ||||||||||||||||||||
Sbjct: 6318 aaagaataatgtaaaagaca 6299



to top

>gb|AY101899.1| Plantago leiopetala 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequences;
           and 28S ribosomal RNA gene, partial sequence
          Length = 777

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 261 gggagccaaaggggcaacga 280
           ||||||||||||||||||||
Sbjct: 296 gggagccaaaggggcaacga 277



to top

>gb|AY101898.1| Plantago lanceolata 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequences;
           and 28S ribosomal RNA gene, partial sequence
          Length = 753

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 261 gggagccaaaggggcaacga 280
           ||||||||||||||||||||
Sbjct: 283 gggagccaaaggggcaacga 264



to top

>emb|AL691481.15| Mouse DNA sequence from clone RP23-173C3 on chromosome 4 Contains a
              non-neuron enolase 1 alpha  (Eno1) pseudogene, a
              mitochondrial H+ transporting ATP synthase F0 complex
              subunit d (Atp5h) pseudogene and a CpG island, complete
              sequence
          Length = 230127

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 66     aaagaataatgtaaaagaca 85
              ||||||||||||||||||||
Sbjct: 166514 aaagaataatgtaaaagaca 166533



to top

>ref|NM_204810.1| Gallus gallus leukocyte cell derived chemotaxin 1 (LECT1), mRNA
          Length = 2751

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 245 ctctttgtttatctttggga 264
           ||||||||||||||||||||
Sbjct: 634 ctctttgtttatctttggga 615



to top

>dbj|AK140902.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
            library, clone:C130064H22 product:unclassifiable, full
            insert sequence
          Length = 4637

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 182  tacatatataagaataatta 201
            ||||||||||||||||||||
Sbjct: 2585 tacatatataagaataatta 2604



to top

>dbj|AK157660.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830230E13 product:unclassifiable, full
            insert sequence
          Length = 2334

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 66   aaagaataatgtaaaagaca 85
            ||||||||||||||||||||
Sbjct: 1960 aaagaataatgtaaaagaca 1941



to top

>gb|AC158999.2| Mus musculus BAC clone RP24-201N16 from chromosome 9, complete sequence
          Length = 169860

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 64     tgaaagaataatgtaaaaga 83
              ||||||||||||||||||||
Sbjct: 144920 tgaaagaataatgtaaaaga 144901



to top

>gb|AF313036.1|AF313036 Plantago lanceolata 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 735

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 261 gggagccaaaggggcaacga 280
           ||||||||||||||||||||
Sbjct: 301 gggagccaaaggggcaacga 282



to top

>ref|XM_624083.1| PREDICTED: Apis mellifera similar to ENSANGP00000010559
          (LOC551695), mRNA
          Length = 792

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 62 tgtgaaagaataatgtaaaa 81
          ||||||||||||||||||||
Sbjct: 53 tgtgaaagaataatgtaaaa 34



to top

>gb|AC021667.21|AC021667 Mus musculus, clone RP23-304J12, complete sequence
          Length = 203106

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 167    ttgtatcatggagagtacatatat 190
              |||||| |||||||||||||||||
Sbjct: 155863 ttgtataatggagagtacatatat 155886



to top

>gb|AC009376.7| Drosophila melanogaster 3 BAC RPCI98-1D4 (Roswell Park Cancer Institute
             Human PAC library) complete sequence
          Length = 183948

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 101   ccaaaaatactcggtgtttt 120
             ||||||||||||||||||||
Sbjct: 47843 ccaaaaatactcggtgtttt 47824



to top

>gb|CP000033.1| Lactobacillus acidophilus NCFM, complete genome
          Length = 1993564

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 189    ataagaataattacttcaat 208
              ||||||||||||||||||||
Sbjct: 317215 ataagaataattacttcaat 317234



to top

>emb|AJ548985.1|PLE548985 Plantago leiopetala partial 18S rRNA gene, 5.8S rRNA gene, partial
           28S rRNA gene, ITS1 and ITS2, specimen voucher Hoggard
           RK #418
          Length = 772

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 261 gggagccaaaggggcaacga 280
           ||||||||||||||||||||
Sbjct: 295 gggagccaaaggggcaacga 276



to top

>emb|AJ548984.1|PLA548984 Plantago lanceolata partial 18S rRNA gene, 5.8S rRNA gene, partial
           28S rRNA gene, ITS1 and ITS2, specimen voucher Hoggard
           RK #414
          Length = 789

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 261 gggagccaaaggggcaacga 280
           ||||||||||||||||||||
Sbjct: 299 gggagccaaaggggcaacga 280



to top

>gb|AF027380.1|AF027380 Gallus gallus chondromodulin-I precursor (ChM-I) mRNA, complete cds
          Length = 2749

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 245 ctctttgtttatctttggga 264
           ||||||||||||||||||||
Sbjct: 633 ctctttgtttatctttggga 614



to top

>gb|AF138280.1|AF138280 Gallus gallus chondromodulin-I mRNA, complete cds
          Length = 2751

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 245 ctctttgtttatctttggga 264
           ||||||||||||||||||||
Sbjct: 634 ctctttgtttatctttggga 615



to top

>gb|AE003516.4| Drosophila melanogaster chromosome 3L, section 69 of 83 of the complete
              sequence
          Length = 305312

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 101    ccaaaaatactcggtgtttt 120
              ||||||||||||||||||||
Sbjct: 123711 ccaaaaatactcggtgtttt 123730



to top

>emb|AL928587.7| Mouse DNA sequence from clone RP23-282M14 on chromosome 2, complete
              sequence
          Length = 218618

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 182    tacatatataagaataatta 201
              ||||||||||||||||||||
Sbjct: 100459 tacatatataagaataatta 100440


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,326,815
Number of Sequences: 3902068
Number of extensions: 3326815
Number of successful extensions: 67658
Number of sequences better than 10.0: 43
Number of HSP's better than 10.0 without gapping: 43
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 67525
Number of HSP's gapped (non-prelim): 133
length of query: 283
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 261
effective length of database: 17,147,199,772
effective search space: 4475419140492
effective search space used: 4475419140492
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top