ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast17a07
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC129323.6| Mus musculus BAC clone RP23-237M15 from 9, comple... 46 0.038
2gb|AC127309.4| Mus musculus BAC clone RP23-296L9 from 9, complet... 46 0.038
3gb|AE016753.1| Mus musculus chromosome 10 high-growth region, se... 42 0.60
4gb|AC153366.7| Mus musculus 10 BAC RP23-243B24 (Roswell Park Can... 42 0.60
5gb|AC162522.6| Mus musculus chromosome 8, clone RP23-314A15, com... 40 2.4
6gb|AC022062.10| Mus musculus chromosome 5, clone RP23-57P23, com... 40 2.4
7emb|BX950226.13| Zebrafish DNA sequence from clone CH211-105P23 ... 40 2.4
8gb|AC132386.3| Mus musculus BAC clone RP23-438O22 from chromosom... 40 2.4
9emb|AL162412.11| Human DNA sequence from clone RP11-109D9 on chr... 40 2.4
10gb|AC158898.7| Mus musculus chromosome 8, clone RP23-153P23, com... 40 2.4
11gb|AC158955.2| Mus musculus chromosome 15, clone RP23-22C17, com... 40 2.4
12gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 40 2.4
13gb|AC124768.4| Homo sapiens BAC clone RP11-1188G23 from 2, compl... 40 2.4
14gb|AC120373.10| Mus musculus chromosome 15, clone RP24-512O2, co... 40 2.4
15gb|CP000084.1| Candidatus Pelagibacter ubique HTCC1062, complete... 40 2.4
16ref|NM_212430.1| Eremothecium gossypii AFR745Wp (AFR745W), mRNA 40 2.4
17emb|AL627236.11| Mouse DNA sequence from clone RP23-384G12 on ch... 40 2.4
18gb|AC005600.1| Homo sapiens chromosome 16, P1 clone 109-9G (LANL... 38 9.3
19ref|XM_960269.1| Neurospora crassa OR74A hypothetical protein ( ... 38 9.3
20ref|XM_330162.1| Neurospora crassa OR74A hypothetical protein ( ... 38 9.3
21ref|XM_657517.1| Aspergillus nidulans FGSC A4 hypothetical prote... 38 9.3
22gb|AC093513.3| Homo sapiens chromosome 16 clone CTD-2517G10, com... 38 9.3
23gb|AC007528.5| Homo sapiens 12 BAC RP11-473N11 (Roswell Park Can... 38 9.3
24gb|AC146854.19| Medicago truncatula clone mth2-10i14, complete s... 38 9.3
25emb|Z99129.1|HS425C14 Human DNA sequence from clone RP3-425C14 o... 38 9.3
26emb|AL365361.12| Human DNA sequence from clone RP11-284N8 on chr... 38 9.3
27emb|AL356791.9| Human DNA sequence from clone RP11-80I3 on chrom... 38 9.3
28emb|AL121834.20|HSJ509I19 Human DNA sequence from clone RP3-509I... 38 9.3
29gb|AC161001.4| Mus musculus BAC clone RP23-30A18 from chromosome... 38 9.3
30emb|AL389891.1|NCB7F18 Neurospora crassa DNA linkage group I BAC... 38 9.3
31gb|AC107030.3| Homo sapiens 3 BAC RP11-603J22 (Roswell Park Canc... 38 9.3
32ref|NM_214094.2| Sus scrofa P protein (OCA2), mRNA 38 9.3
33gb|AY095536.3| Sus scrofa P protein mRNA, complete cds 38 9.3
34gb|AC136286.30| Medicago truncatula clone mth2-6c9, complete seq... 38 9.3
35emb|BX571698.15| Zebrafish DNA sequence from clone DKEYP-121E10 ... 38 9.3
36gb|AY028967.1| Drosophila virilis fruitless female-specific (fru... 38 9.3
37gb|AC022068.6| Homo sapiens chromosome 8, clone RP11-523C15, com... 38 9.3
38gb|AC090875.9| Homo sapiens chromosome 8, clone RP11-724H22, com... 38 9.3
39gb|AC154295.2| Mus musculus BAC clone RP23-431G3 from chromosome... 38 9.3
40gb|AC017015.4|AC017015 Homo sapiens BAC clone RP11-142L1 from 3,... 38 9.3
41gb|AC104596.4| Homo sapiens BAC clone RP11-54P19 from 4, complet... 38 9.3
42gb|AC146266.4| Pan troglodytes BAC clone RP43-30L11 from chromos... 38 9.3
43gb|AC022173.7|AC022173 Homo sapiens chromosome 7 clone RP11-29B3... 38 9.3
44gb|M98046.1|SYNPCS19X pCS19 Cloning vector (URA3) gene, (cI) gen... 38 9.3
45dbj|AP000421.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 38 9.3
46gb|AC009263.6|AC009263 Homo sapiens clone RP11-377B19 from 7q31.... 38 9.3
47dbj|AP006565.1| Homo sapiens genomic DNA, chromosome 18 clone:RP... 38 9.3
48dbj|AP006507.2| Homo sapiens genomic DNA, chromosome 18p clone:C... 38 9.3
49gb|AC122222.6| Mus musculus BAC clone RP23-128D11 from 7, comple... 38 9.3
50gb|CP000009.1| Gluconobacter oxydans 621H, complete genome 38 9.3
51emb|X07464.1|SCPHO80 Yeast PHO80 gene for trans-acting factor fo... 38 9.3
52gb|AE017321.1| Wolbachia endosymbiont strain TRS of Brugia malay... 38 9.3
53gb|AF058825.1|AF058825 Arabidopsis thaliana BAC F7N22 38 9.3
54emb|CT025551.9| Mouse DNA sequence from clone RP23-414I10 on chr... 38 9.3
55gb|AC140790.3| Gallus gallus BAC clone TAM32-50D18 from chromoso... 38 9.3
56emb|AL606925.16| Mouse DNA sequence from clone RP23-12J1 on chro... 38 9.3
57dbj|AB016243.1| Homo sapiens gene for regulatory factor 2 of sod... 38 9.3 
>gb|AC129323.6| Mus musculus BAC clone RP23-237M15 from 9, complete sequence
          Length = 170293

 Score = 46.1 bits (23), Expect = 0.038
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 85     aaatatctaaaccaaactatgcaaaag 111
              ||||||||||| |||||||||||||||
Sbjct: 147126 aaatatctaaaacaaactatgcaaaag 147152
to top
>gb|AC127309.4| Mus musculus BAC clone RP23-296L9 from 9, complete sequence
          Length = 188083

 Score = 46.1 bits (23), Expect = 0.038
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 85    aaatatctaaaccaaactatgcaaaag 111
             ||||||||||| |||||||||||||||
Sbjct: 13223 aaatatctaaaacaaactatgcaaaag 13249
to top
>gb|AE016753.1| Mus musculus chromosome 10 high-growth region, section 1 of 2 of the
              complete sequence
          Length = 350029

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 124    caaagtgggaagcaacaaagg 144
              |||||||||||||||||||||
Sbjct: 215842 caaagtgggaagcaacaaagg 215862
to top
>gb|AC153366.7| Mus musculus 10 BAC RP23-243B24 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 184707

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 124    caaagtgggaagcaacaaagg 144
              |||||||||||||||||||||
Sbjct: 112057 caaagtgggaagcaacaaagg 112037
to top
>gb|AC162522.6| Mus musculus chromosome 8, clone RP23-314A15, complete sequence
          Length = 187888

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 120    ttgacaaagtgggaagcaac 139
              ||||||||||||||||||||
Sbjct: 180956 ttgacaaagtgggaagcaac 180975
to top
>gb|AC022062.10| Mus musculus chromosome 5, clone RP23-57P23, complete sequence
          Length = 235363

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 166    tcacttccttcccctgccct 185
              ||||||||||||||||||||
Sbjct: 160671 tcacttccttcccctgccct 160690
to top
>emb|BX950226.13| Zebrafish DNA sequence from clone CH211-105P23 in linkage group 7,
              complete sequence
          Length = 174681

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 59     aagtaatgagagacagcatgatga 82
              ||||||||||| ||||||||||||
Sbjct: 107558 aagtaatgagaaacagcatgatga 107581
to top
>gb|AC132386.3| Mus musculus BAC clone RP23-438O22 from chromosome 5, complete sequence
          Length = 170182

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 166    tcacttccttcccctgccct 185
              ||||||||||||||||||||
Sbjct: 154940 tcacttccttcccctgccct 154921
to top
>emb|AL162412.11| Human DNA sequence from clone RP11-109D9 on chromosome 9 Contains the 5'
              end of the APBA1 gene for myloid beta (A4) precursor
              protein-binding, family A, member 1 (X11), two novel genes,
              the 5' end of a novel gene possible ortholog of mouse RIKEN
              cDNA 1700028P14 gene and two CpG islands, complete sequence
          Length = 189277

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 7      caagcaaaactttccatttgttct 30
              ||||||||| ||||||||||||||
Sbjct: 147220 caagcaaaagtttccatttgttct 147197
to top
>gb|AC158898.7| Mus musculus chromosome 8, clone RP23-153P23, complete sequence
          Length = 212598

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 120    ttgacaaagtgggaagcaac 139
              ||||||||||||||||||||
Sbjct: 164114 ttgacaaagtgggaagcaac 164095
to top
>gb|AC158955.2| Mus musculus chromosome 15, clone RP23-22C17, complete sequence
          Length = 256999

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 170    ttccttcccctgcccttgct 189
              ||||||||||||||||||||
Sbjct: 199384 ttccttcccctgcccttgct 199403
to top
>gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VI,
               complete sequence
          Length = 1813164

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 63      aatgagagacagcatgatga 82
               ||||||||||||||||||||
Sbjct: 1805282 aatgagagacagcatgatga 1805301
to top
>gb|AC124768.4| Homo sapiens BAC clone RP11-1188G23 from 2, complete sequence
          Length = 95291

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 157   gcttgatcttcacttccttc 176
             ||||||||||||||||||||
Sbjct: 13944 gcttgatcttcacttccttc 13925
to top
>gb|AC120373.10| Mus musculus chromosome 15, clone RP24-512O2, complete sequence
          Length = 159741

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 170    ttccttcccctgcccttgct 189
              ||||||||||||||||||||
Sbjct: 120060 ttccttcccctgcccttgct 120041
to top
>gb|CP000084.1| Candidatus Pelagibacter ubique HTCC1062, complete genome
          Length = 1308759

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 58     caagtaatgagagacagcatgatgatcaaata 89
              |||| ||||||||||| ||||||| |||||||
Sbjct: 502134 caagaaatgagagacatcatgatgttcaaata 502103
to top
>ref|NM_212430.1| Eremothecium gossypii AFR745Wp (AFR745W), mRNA
          Length = 3057

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 63   aatgagagacagcatgatga 82
            ||||||||||||||||||||
Sbjct: 2227 aatgagagacagcatgatga 2246
to top
>emb|AL627236.11| Mouse DNA sequence from clone RP23-384G12 on chromosome 4, complete
             sequence
          Length = 201752

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 166   tcacttccttcccctgccct 185
             ||||||||||||||||||||
Sbjct: 95908 tcacttccttcccctgccct 95889
to top
>gb|AC005600.1| Homo sapiens chromosome 16, P1 clone 109-9G (LANL), complete sequence
          Length = 79586

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 171  tccttcccctgcccttgct 189
            |||||||||||||||||||
Sbjct: 7188 tccttcccctgcccttgct 7206
to top
>ref|XM_960269.1| Neurospora crassa OR74A hypothetical protein ( hypothetical protein
            B7F18.110 [imported] - Neurospora crassa OR74A )
            (NCU02975.1) partial mRNA
          Length = 1878

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 162  atcttcacttccttcccct 180
            |||||||||||||||||||
Sbjct: 1583 atcttcacttccttcccct 1565
to top
>ref|XM_330162.1| Neurospora crassa OR74A hypothetical protein ( hypothetical protein
            B7F18.110 [imported] - Neurospora crassa OR74A )
            (NCU02975.1) partial mRNA
          Length = 1878

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 162  atcttcacttccttcccct 180
            |||||||||||||||||||
Sbjct: 1583 atcttcacttccttcccct 1565
to top
>ref|XM_657517.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN5005.2), mRNA
          Length = 1587

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 169 cttccttcccctgcccttg 187
           |||||||||||||||||||
Sbjct: 247 cttccttcccctgcccttg 229
to top
>gb|AC093513.3| Homo sapiens chromosome 16 clone CTD-2517G10, complete sequence
          Length = 72483

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 171   tccttcccctgcccttgct 189
             |||||||||||||||||||
Sbjct: 60672 tccttcccctgcccttgct 60654
to top
>gb|AC007528.5| Homo sapiens 12 BAC RP11-473N11 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 188451

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 18     ttccatttgttctgtggca 36
              |||||||||||||||||||
Sbjct: 153206 ttccatttgttctgtggca 153224
to top
>gb|AC146854.19| Medicago truncatula clone mth2-10i14, complete sequence
          Length = 116179

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 108    aaaggatctcaattgacaaagtg 130
              |||||||||||| ||||||||||
Sbjct: 109833 aaaggatctcaaatgacaaagtg 109811
to top
>emb|Z99129.1|HS425C14 Human DNA sequence from clone RP3-425C14 on chromosome 6q22 Contains the
              3' end of the HSF2 gene for  Heat Shock Transcription
              Factor 2 and the 3' end of a novel gene for KIAA1253
              protein (similar to tumor differentially expressed TDE1),
              complete sequence
          Length = 160203

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 47     aacatgaacagcaagtaat 65
              |||||||||||||||||||
Sbjct: 119330 aacatgaacagcaagtaat 119348
to top
>emb|AL365361.12| Human DNA sequence from clone RP11-284N8 on chromosome 1 Contains the
             KCNA2 gene for a potassium voltage-gated channel from the
             shaker-related subfamily member 2, the KCNA3 gene for a
             potassium voltage-gated channel from the shaker-related
             subfamily member 3 and two CpG islands, complete sequence
          Length = 193182

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 59    aagtaatgagagacagcatgatg 81
             ||||||| |||||||||||||||
Sbjct: 98097 aagtaatcagagacagcatgatg 98075
to top
>emb|AL356791.9| Human DNA sequence from clone RP11-80I3 on chromosome 9, complete
             sequence
          Length = 101157

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 164   cttcacttccttcccctgccctt 186
             |||| ||||||||||||||||||
Sbjct: 54219 cttcccttccttcccctgccctt 54197
to top
>emb|AL121834.20|HSJ509I19 Human DNA sequence from clone RP3-509I19 on chromosome 6q23.1-24.1
             Contains a novel gene (includes DKFZP586D0623), the gene
             for a novel protein similar to mouse f-box only protein 16
             (Fbxo16) (Fbx16), a novel 7 transmembrane receptor
             (rhodopsin family) pseudogene similar to CCRL1, a novel
             gene, a suppressor of mif two 3 homolog 2 (yeast) (SMT3H2)
             pseudogene, the REPS1 gene for RALBP1 associated Eps
             domain containing 1 and two CpG islands, complete sequence
          Length = 178159

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 162   atcttcacttccttcccct 180
             |||||||||||||||||||
Sbjct: 46958 atcttcacttccttcccct 46976
to top
>gb|AC161001.4| Mus musculus BAC clone RP23-30A18 from chromosome 14, complete sequence
          Length = 215474

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 29    ctgtggcagtaagtataca 47
             |||||||||||||||||||
Sbjct: 68243 ctgtggcagtaagtataca 68261
to top
>emb|AL389891.1|NCB7F18 Neurospora crassa DNA linkage group I BAC clone B7F18
          Length = 71088

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 162   atcttcacttccttcccct 180
             |||||||||||||||||||
Sbjct: 21876 atcttcacttccttcccct 21894
to top
>gb|AC107030.3| Homo sapiens 3 BAC RP11-603J22 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 171343

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 107   aaaaggatctcaattgacaaagt 129
             ||||||||||||| |||||||||
Sbjct: 14852 aaaaggatctcaactgacaaagt 14874
to top
>ref|NM_214094.2| Sus scrofa P protein (OCA2), mRNA
          Length = 3267

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 63   aatgagagacagcatgatgatca 85
            ||||||| |||||||||||||||
Sbjct: 1456 aatgagacacagcatgatgatca 1434
to top
>gb|AY095536.3| Sus scrofa P protein mRNA, complete cds
          Length = 3267

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 63   aatgagagacagcatgatgatca 85
            ||||||| |||||||||||||||
Sbjct: 1456 aatgagacacagcatgatgatca 1434
to top
>gb|AC136286.30| Medicago truncatula clone mth2-6c9, complete sequence
          Length = 127568

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 108   aaaggatctcaattgacaaagtg 130
             |||||||||||| ||||||||||
Sbjct: 74458 aaaggatctcaaatgacaaagtg 74480
to top
>emb|BX571698.15| Zebrafish DNA sequence from clone DKEYP-121E10 in linkage group 24,
             complete sequence
          Length = 168886

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 63    aatgagagacagcatgatg 81
             |||||||||||||||||||
Sbjct: 39479 aatgagagacagcatgatg 39461
to top
>gb|AY028967.1| Drosophila virilis fruitless female-specific (fru) mRNA, partial
            sequence, alternatively spliced
          Length = 2889

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 85   aaatatctaaaccaaacta 103
            |||||||||||||||||||
Sbjct: 1361 aaatatctaaaccaaacta 1379
to top
>gb|AC022068.6| Homo sapiens chromosome 8, clone RP11-523C15, complete sequence
          Length = 202043

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 163  tcttcacttccttcccctg 181
            |||||||||||||||||||
Sbjct: 1730 tcttcacttccttcccctg 1748
to top
>gb|AC090875.9| Homo sapiens chromosome 8, clone RP11-724H22, complete sequence
          Length = 165505

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 163    tcttcacttccttcccctg 181
              |||||||||||||||||||
Sbjct: 155050 tcttcacttccttcccctg 155068
to top
>gb|AC154295.2| Mus musculus BAC clone RP23-431G3 from chromosome 9, complete sequence
          Length = 197751

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 20    ccatttgttctgtggcagt 38
             |||||||||||||||||||
Sbjct: 82317 ccatttgttctgtggcagt 82299
to top
>gb|AC017015.4|AC017015 Homo sapiens BAC clone RP11-142L1 from 3, complete sequence
          Length = 163509

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 107    aaaaggatctcaattgacaaagt 129
              ||||||||||||| |||||||||
Sbjct: 101353 aaaaggatctcaactgacaaagt 101375
to top
>gb|AC104596.4| Homo sapiens BAC clone RP11-54P19 from 4, complete sequence
          Length = 168591

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 27    ttctgtggcagtaagtata 45
             |||||||||||||||||||
Sbjct: 37204 ttctgtggcagtaagtata 37186
to top
>gb|AC146266.4| Pan troglodytes BAC clone RP43-30L11 from chromosome 7, complete
             sequence
          Length = 187603

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 167   cacttccttcccctgccct 185
             |||||||||||||||||||
Sbjct: 98263 cacttccttcccctgccct 98281
to top
>gb|AC022173.7|AC022173 Homo sapiens chromosome 7 clone RP11-29B3, complete sequence
          Length = 155136

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 167   cacttccttcccctgccct 185
             |||||||||||||||||||
Sbjct: 22427 cacttccttcccctgccct 22409
to top
>gb|M98046.1|SYNPCS19X pCS19 Cloning vector (URA3) gene, (cI) gene, (Tet) gene complete cds,
            (Amp) gene
          Length = 9344

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 9    agcaaaactttccatttgt 27
            |||||||||||||||||||
Sbjct: 2702 agcaaaactttccatttgt 2720
to top
>dbj|AP000421.1| Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:T13C12
          Length = 72800

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 82    atcaaatatctaaaccaaa 100
             |||||||||||||||||||
Sbjct: 38624 atcaaatatctaaaccaaa 38606
to top
>gb|AC009263.6|AC009263 Homo sapiens clone RP11-377B19 from 7q31.3, complete sequence
          Length = 182502

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 167   cacttccttcccctgccct 185
             |||||||||||||||||||
Sbjct: 62948 cacttccttcccctgccct 62966
to top
>dbj|AP006565.1| Homo sapiens genomic DNA, chromosome 18 clone:RP11-1157N02_B, complete
             sequence
          Length = 93824

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 97    caaactatgcaaaaggatc 115
             |||||||||||||||||||
Sbjct: 22396 caaactatgcaaaaggatc 22378
to top
>dbj|AP006507.2| Homo sapiens genomic DNA, chromosome 18p clone:CMF18-039G23, complete
             sequence
          Length = 37716

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 97    caaactatgcaaaaggatc 115
             |||||||||||||||||||
Sbjct: 36938 caaactatgcaaaaggatc 36920
to top
>gb|AC122222.6| Mus musculus BAC clone RP23-128D11 from 7, complete sequence
          Length = 212225

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 86     aatatctaaaccaaactat 104
              |||||||||||||||||||
Sbjct: 107967 aatatctaaaccaaactat 107985
to top
>gb|CP000009.1| Gluconobacter oxydans 621H, complete genome
          Length = 2702173

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 9      agcaaaactttccatttgt 27
              |||||||||||||||||||
Sbjct: 223905 agcaaaactttccatttgt 223923
to top
>emb|X07464.1|SCPHO80 Yeast PHO80 gene for trans-acting factor for repression of acid
            phosphatase
          Length = 1353

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 9    agcaaaactttccatttgt 27
            |||||||||||||||||||
Sbjct: 1281 agcaaaactttccatttgt 1299
to top
>gb|AE017321.1| Wolbachia endosymbiont strain TRS of Brugia malayi, complete genome
          Length = 1080084

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 39     aagtatacaacatgaacag 57
              |||||||||||||||||||
Sbjct: 860527 aagtatacaacatgaacag 860545
to top
>gb|AF058825.1|AF058825 Arabidopsis thaliana BAC F7N22
          Length = 110157

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 82  atcaaatatctaaaccaaa 100
           |||||||||||||||||||
Sbjct: 670 atcaaatatctaaaccaaa 688
to top
>emb|CT025551.9| Mouse DNA sequence from clone RP23-414I10 on chromosome 13, complete
              sequence
          Length = 196737

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 109    aaggatctcaattgacaaagtgg 131
              ||||||||||||| |||||||||
Sbjct: 164577 aaggatctcaattcacaaagtgg 164555
to top
>gb|AC140790.3| Gallus gallus BAC clone TAM32-50D18 from chromosome ul, complete
             sequence
          Length = 176981

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 171   tccttcccctgcccttgct 189
             |||||||||||||||||||
Sbjct: 79418 tccttcccctgcccttgct 79400
to top
>emb|AL606925.16| Mouse DNA sequence from clone RP23-12J1 on chromosome 4, complete
             sequence
          Length = 239244

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 20    ccatttgttctgtggcagtaagt 42
             |||||||| ||||||||||||||
Sbjct: 99954 ccatttgtactgtggcagtaagt 99932
to top
>dbj|AB016243.1| Homo sapiens gene for regulatory factor 2 of sodium/hydrogen
            exchanger isoform A3, complete cds
          Length = 14728

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 171  tccttcccctgcccttgct 189
            |||||||||||||||||||
Sbjct: 5409 tccttcccctgcccttgct 5427


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,145,468
Number of Sequences: 3902068
Number of extensions: 2145468
Number of successful extensions: 166774
Number of sequences better than 10.0: 57
Number of HSP's better than 10.0 without gapping: 57
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 166614
Number of HSP's gapped (non-prelim): 160
length of query: 189
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 167
effective length of database: 17,147,199,772
effective search space: 2863582361924
effective search space used: 2863582361924
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top