>dbj|AP006148.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT41D09, TM0304,
              complete sequence
          Length = 114776

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 64     aactcatgaaagaaaattgc 83
              ||||||||||||||||||||
Sbjct: 101724 aactcatgaaagaaaattgc 101705

>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome
          Length = 5650368

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 19      tggaagtactcaagtcttc 37
               |||||||||||||||||||
Sbjct: 3752392 tggaagtactcaagtcttc 3752410

>emb|CR339052.6| Zebrafish DNA sequence from clone CH211-218E6 in linkage group 10,
             complete sequence
          Length = 127879

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    ctcatgaaagaaaattgcg 84
             |||||||||||||||||||
Sbjct: 62667 ctcatgaaagaaaattgcg 62685

>gb|AC124487.3| Mus musculus BAC clone RP23-452B18 from chromosome 19, complete
             sequence
          Length = 195185

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 60    gtggaactcatgaaagaaa 78
             |||||||||||||||||||
Sbjct: 89241 gtggaactcatgaaagaaa 89259

>emb|AL121900.26|HSBA379J5 Human DNA sequence from clone RP11-379J5 on chromosome 20 Contains the 3'
              end of the SEC23B gene for Sec23 (S. cerevisiae) homolog B,
              two novel genes, the 5' end of the HARS2 gene for
              histidyl-tRNA synthetase 2, a pseudogene similar to part of
              homeobox proteins and two CpG islands, complete sequence
          Length = 149933

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 62     ggaactcatgaaagaaaat 80
              |||||||||||||||||||
Sbjct: 138327 ggaactcatgaaagaaaat 138309

>emb|X58791.1|VHLUXAB V.harveyi luxA and luxB genes for luciferase alpha and beta subunits
          Length = 2403

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 10   gcatttatatggaagtact 28
            |||||||||||||||||||
Sbjct: 2282 gcatttatatggaagtact 2300

>emb|BX537292.5| Zebrafish DNA sequence from clone CH211-213E17 in linkage group 10,
              complete sequence
          Length = 189446

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 66     ctcatgaaagaaaattgcg 84
              |||||||||||||||||||
Sbjct: 185945 ctcatgaaagaaaattgcg 185927

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 4        catcatgcatttatatgga 22
                |||||||||||||||||||
Sbjct: 14589954 catcatgcatttatatgga 14589972

>dbj|AP005093.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1294_G06
          Length = 115468

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 4     catcatgcatttatatgga 22
             |||||||||||||||||||
Sbjct: 88243 catcatgcatttatatgga 88261

>dbj|AP005397.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0643D11
          Length = 137525

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 4     catcatgcatttatatgga 22
             |||||||||||||||||||
Sbjct: 11621 catcatgcatttatatgga 11639

>gb|AC165281.2| Mus musculus BAC clone RP24-502H6 from chromosome 13, complete sequence
          Length = 225816

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 30    aagtcttcaccactacact 48
             |||||||||||||||||||
Sbjct: 97801 aagtcttcaccactacact 97819


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 958,461
Number of Sequences: 3902068
Number of extensions: 958461
Number of successful extensions: 67987
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 67936
Number of HSP's gapped (non-prelim): 51
length of query: 106
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 85
effective length of database: 17,151,101,840
effective search space: 1457843656400
effective search space used: 1457843656400
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)