| Clone Name | rbast16c03 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY857762.1| Triticum monococcum peroxidase 8 (POX8) mRNA, complete cds Length = 1282 Score = 111 bits (56), Expect = 1e-21 Identities = 92/104 (88%) Strand = Plus / Minus Query: 134 agtataggcgcgaacggacaccgactagccagcacgcccgtgcattggcattcaagcacg 193 |||||| | |||||||||||||||| |||||||||||||||||||| ||||||||| ||| Sbjct: 1201 agtatacgtgcgaacggacaccgaccagccagcacgcccgtgcattcgcattcaaggacg 1142 Query: 194 cacacatcaggccatggcgaccttgtcgtgcgagcccgggcggc 237 || ||||||| || |||||||||| |||| |||||||| |||| Sbjct: 1141 catacatcagcccttggcgaccttatcgtcggagcccggtcggc 1098
>gb|AC168204.1| Medicago truncatula chromosome 7 BAC clone mth2-64h15, complete sequence Length = 45758 Score = 42.1 bits (21), Expect = 0.77 Identities = 21/21 (100%) Strand = Plus / Plus Query: 32 ttattatttttgctcaattaa 52 ||||||||||||||||||||| Sbjct: 12268 ttattatttttgctcaattaa 12288
>gb|AC136974.11| Medicago truncatula clone mth2-22e9, complete sequence Length = 124037 Score = 42.1 bits (21), Expect = 0.77 Identities = 21/21 (100%) Strand = Plus / Minus Query: 32 ttattatttttgctcaattaa 52 ||||||||||||||||||||| Sbjct: 11525 ttattatttttgctcaattaa 11505
>gb|AC105137.17| Homo sapiens chromosome 15, clone CTD-2562G15, complete sequence Length = 178059 Score = 42.1 bits (21), Expect = 0.77 Identities = 21/21 (100%) Strand = Plus / Minus Query: 36 tatttttgctcaattaacaac 56 ||||||||||||||||||||| Sbjct: 79311 tatttttgctcaattaacaac 79291
>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence Length = 3809201 Score = 42.1 bits (21), Expect = 0.77 Identities = 21/21 (100%) Strand = Plus / Minus Query: 187 aagcacgcacacatcaggcca 207 ||||||||||||||||||||| Sbjct: 3726479 aagcacgcacacatcaggcca 3726459
>ref|XM_670697.1| Plasmodium berghei strain ANKA hypothetical protein (PB103910.00.0) partial mRNA Length = 3190 Score = 40.1 bits (20), Expect = 3.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 31 attattatttttgctcaatt 50 |||||||||||||||||||| Sbjct: 1392 attattatttttgctcaatt 1373
>gb|AC182808.1| Gasterosteus aculeatus clone VMRC28-105K03, complete sequence Length = 124886 Score = 40.1 bits (20), Expect = 3.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 ccatcggaaagggcatttca 98 |||||||||||||||||||| Sbjct: 120343 ccatcggaaagggcatttca 120324
>gb|AC113326.9| Mus musculus chromosome 1, clone RP23-454G7, complete sequence Length = 192734 Score = 40.1 bits (20), Expect = 3.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 catgccacattattattttt 42 |||||||||||||||||||| Sbjct: 105697 catgccacattattattttt 105716
>gb|AC139040.8| Mus musculus chromosome 19, clone RP23-292H20, complete sequence Length = 206197 Score = 40.1 bits (20), Expect = 3.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 60 aacacttgtacaagatggac 79 |||||||||||||||||||| Sbjct: 49033 aacacttgtacaagatggac 49052 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,412,195 Number of Sequences: 3902068 Number of extensions: 2412195 Number of successful extensions: 43466 Number of sequences better than 10.0: 9 Number of HSP's better than 10.0 without gapping: 9 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 43448 Number of HSP's gapped (non-prelim): 18 length of query: 237 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 215 effective length of database: 17,147,199,772 effective search space: 3686647950980 effective search space used: 3686647950980 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)