>gb|AC131722.4| Mus musculus BAC clone RP23-143M5 from chromosome 9, complete sequence
          Length = 228144

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 217    catttctggagcacctccctcctc 240
              |||||||||||||||||| |||||
Sbjct: 203991 catttctggagcacctccttcctc 204014

>gb|AC124397.5| Mus musculus BAC clone RP24-348J16 from chromosome 13, complete
             sequence
          Length = 191713

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 232   tccctcctcccttatgcacc 251
             ||||||||||||||||||||
Sbjct: 41207 tccctcctcccttatgcacc 41226

>emb|AL445430.15| Human DNA sequence from clone RP11-716O23 on chromosome 6 Contains one
             or two novel genes, a repressor of protein-kinase
             (interferon-inducible double stranded RNA dependent
             inhibitor) (P58 repressor) (PRKRIR) pseudogene and a CpG
             island, complete sequence
          Length = 127862

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 48    gccttcacccatgttgtttc 67
             ||||||||||||||||||||
Sbjct: 32777 gccttcacccatgttgtttc 32758

>emb|AL355310.20| Human DNA sequence from clone RP5-1160K1 on chromosome 1 Contains the
             GPR61 gene for G protein-coupled receptor 61, the GNAI3
             gene for guanine nucleotide binding protein (G protein)
             alpha inhibiting activity polypeptide 3, two novel genes,
             the GNAT2 gene for guanine nucleotide binding protein (G
             protein) alpha transducing activity polypeptide 2, the
             AMPD2 gene for adenosine monophosphate deaminase 2
             (isoform L) and the 5' end of a ribosomal protein L7
             (RPL7) pseudogene, complete sequence
          Length = 112911

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 213   acaccatttctggagcacctccct 236
             |||| |||||||||||||||||||
Sbjct: 93656 acacaatttctggagcacctccct 93679

>emb|AL121985.13|HSA404F10 Human DNA sequence from clone RP11-404F10 on chromosome 1q23.1-24.1
             Contains the 5' end of the SLAMF1 gene for signaling
             lymphocytic activation molecule family member 1, a SET
             translocation (myeloid leukemia-associated) (SET)
             pseudogene, a novel gene, the CD48 gene for CD48 antigen
             (B-cell membrane protein), the SLAMF7 gene for SLAM family
             member 7 and the 5' end of the LY9 gene for lymphocyte
             antigen 9, complete sequence
          Length = 195976

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 214   caccatttctggagcacctc 233
             ||||||||||||||||||||
Sbjct: 32893 caccatttctggagcacctc 32874

>gb|AC092859.26| Pan troglodytes clone rp43-111m15, complete sequence
          Length = 175281

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 213   acaccatttctggagcacctccct 236
             |||| |||||||||||||||||||
Sbjct: 52909 acacaatttctggagcacctccct 52886

>dbj|AP007154.1| Aspergillus oryzae RIB40 genomic DNA, SC001
          Length = 2005935

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 61      ttgtttcgggtttgagagag 80
               ||||||||||||||||||||
Sbjct: 1559544 ttgtttcgggtttgagagag 1559525

>dbj|AP003923.1| Mus musculus genomic DNA, chromosome 2, clone:B478c13, complete
             sequence
          Length = 171634

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 77    agagaggaccgcagggcagc 96
             ||||||||||||||||||||
Sbjct: 72681 agagaggaccgcagggcagc 72662

>gb|AC153359.4| Mus musculus BAC clone RP23-477I1 from chromosome 9, complete sequence
          Length = 195269

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 217    catttctggagcacctccctcctc 240
              |||||||||||||||||| |||||
Sbjct: 128918 catttctggagcacctccttcctc 128895

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 223      tggagcacctccctcctcccttat 246
                |||||| |||||||||||||||||
Sbjct: 14393142 tggagcccctccctcctcccttat 14393119

>emb|AL929021.13| Mouse DNA sequence from clone RP23-89H14 on chromosome 2, complete
             sequence
          Length = 181549

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 77    agagaggaccgcagggcagc 96
             ||||||||||||||||||||
Sbjct: 86360 agagaggaccgcagggcagc 86379

>dbj|AP003574.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0526E12
          Length = 150872

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 223    tggagcacctccctcctcccttat 246
              |||||| |||||||||||||||||
Sbjct: 121017 tggagcccctccctcctcccttat 120994

>dbj|AP005858.1| Mus musculus genomic DNA, chromosome 2 clone:B478C13, complete sequence
          Length = 174714

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 77    agagaggaccgcagggcagc 96
             ||||||||||||||||||||
Sbjct: 72681 agagaggaccgcagggcagc 72662


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,864,802
Number of Sequences: 3902068
Number of extensions: 2864802
Number of successful extensions: 49271
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49225
Number of HSP's gapped (non-prelim): 46
length of query: 342
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 320
effective length of database: 17,147,199,772
effective search space: 5487103927040
effective search space used: 5487103927040
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)