>emb|AL021917.4|HS45P21 Human DNA sequence from clone RP1-45P21 on chromosome 6p21.3-22.2
              Contains the H4FA gene for H4 histone family member A, a
              histone H3 pseudogene, the BTN3A2, BTN2A2, BTN3A1, BTN2A3
              and BTN3A3 genes for butyrophilins 3A1, 2 and 3 and 2A2 and
              3. Contains ESTs, STSs, GSSs and CpG islands, complete
              sequence
          Length = 170001

 Score = 42.1 bits (21), Expect = 0.99
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 114    ccctgccagctaaattctcacactt 138
              |||||||||||||||||| ||||||
Sbjct: 140338 ccctgccagctaaattcttacactt 140314

>gb|AC154505.3| Mus musculus BAC clone RP24-92J14 from chromosome 13, complete sequence
          Length = 199707

 Score = 42.1 bits (21), Expect = 0.99
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 98     cagcctcacagagggcccctg 118
              |||||||||||||||||||||
Sbjct: 141853 cagcctcacagagggcccctg 141873

>gb|AC169703.1| Rhesus Macaque  BAC CH250-14E24 (Children's Hospital Oakland Research
              Institute Rhesus macaque Adult Male BAC Library) complete
              sequence
          Length = 161972

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 178    atgtaaagaagggggaatct 197
              ||||||||||||||||||||
Sbjct: 106831 atgtaaagaagggggaatct 106850

>emb|AL935187.13| Zebrafish DNA sequence from clone DKEY-97C7 in linkage group 4 Contains
              part of the gene for a novel protein similar to vertebrate
              atrophin-1 interacting protein (AIP1) and a CpG island,
              complete sequence
          Length = 263517

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 231    gtccatcattactggatcaa 250
              ||||||||||||||||||||
Sbjct: 226334 gtccatcattactggatcaa 226353

>emb|BX470114.6| Zebrafish DNA sequence from clone CH211-168G7 in linkage group 4,
             complete sequence
          Length = 138545

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 231   gtccatcattactggatcaa 250
             ||||||||||||||||||||
Sbjct: 90023 gtccatcattactggatcaa 90042


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,284,375
Number of Sequences: 3902068
Number of extensions: 2284375
Number of successful extensions: 33878
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33871
Number of HSP's gapped (non-prelim): 7
length of query: 297
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 275
effective length of database: 17,147,199,772
effective search space: 4715479937300
effective search space used: 4715479937300
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)