ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast13h03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_515031.1| PREDICTED: Pan troglodytes similar to sushi dom... 42 0.90
2gb|BC033107.1| Homo sapiens sushi domain containing 2, mRNA (cDN... 42 0.90
3ref|NM_019601.3| Homo sapiens sushi domain containing 2 (SUSD2),... 42 0.90
4emb|Z92546.2|HS65A6 Human DNA sequence from clone CTA-65A6 on ch... 42 0.90
5dbj|AK126105.1| Homo sapiens cDNA FLJ44117 fis, clone TESTI4046903 42 0.90
6gb|AC093572.18| Pan troglodytes clone rp43-25g23, complete sequence 42 0.90
7dbj|AK026431.1| Homo sapiens cDNA: FLJ22778 fis, clone KAIA1714 42 0.90
8dbj|AP000353.2| Homo sapiens genomic DNA, chromosome 22q11.2, IG... 42 0.90
9gb|AC140279.4| Mus musculus BAC clone RP23-338N10 from chromosom... 40 3.5
10ref|NM_006772.1| Homo sapiens synaptic Ras GTPase activating pro... 40 3.5
11gb|AC163023.4| Mus musculus chromosome 3, clone RP24-247E19, com... 40 3.5
12gb|AC117256.4| Mus musculus BAC clone RP24-483G23 from chromosom... 40 3.5
13emb|BX088650.9| Human DNA sequence from clone DASS-97D12 on chro... 40 3.5
14emb|AL662799.16| Human DNA sequence from clone XXbac-294E21 on c... 40 3.5
15emb|AL391379.12| Human DNA sequence from clone RP13-171J5 on chr... 40 3.5
16emb|AL050332.15|HSDJ570F3 Human DNA sequence from clone RP4-570F... 40 3.5
17dbj|AK094225.1| Homo sapiens cDNA FLJ36906 fis, clone BRACE20037... 40 3.5
18dbj|AB067525.2| Homo sapiens mRNA for KIAA1938 protein, partial cds 40 3.5
19gb|AC145744.3| Mus musculus BAC clone RP24-142P6 from 16, comple... 40 3.5
20emb|AL713634.1|HSM802956 Homo sapiens mRNA; cDNA DKFZp761G1421 (... 40 3.5

>ref|XM_515031.1| PREDICTED: Pan troglodytes similar to sushi domain containing 2;
            Sushi domain (SCR repeat) containing (LOC458710), mRNA
          Length = 2454

 Score = 42.1 bits (21), Expect = 0.90
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 66   acaatggctacagcctggacggggcagag 94
            |||| ||||||||||||| ||||||||||
Sbjct: 2261 acaacggctacagcctggccggggcagag 2289



to top

>gb|BC033107.1| Homo sapiens sushi domain containing 2, mRNA (cDNA clone MGC:45695
            IMAGE:5457186), complete cds
          Length = 3201

 Score = 42.1 bits (21), Expect = 0.90
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 66   acaatggctacagcctggacggggcagag 94
            |||| ||||||||||||| ||||||||||
Sbjct: 2299 acaacggctacagcctggccggggcagag 2327



to top

>ref|NM_019601.3| Homo sapiens sushi domain containing 2 (SUSD2), mRNA
          Length = 3201

 Score = 42.1 bits (21), Expect = 0.90
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 66   acaatggctacagcctggacggggcagag 94
            |||| ||||||||||||| ||||||||||
Sbjct: 2299 acaacggctacagcctggccggggcagag 2327



to top

>emb|Z92546.2|HS65A6 Human DNA sequence from clone CTA-65A6 on chromosome 22q11-12 Contains
             the 3' part of the gene for the ortholog of rat CAIN
             (KIAA0330), the gene for a novel Sushi domain (SCR repeat)
             containing protein similar to Mucins, ESTs, an STS, GSSs
             and two putative CpG islands, complete sequence
          Length = 73511

 Score = 42.1 bits (21), Expect = 0.90
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 66    acaatggctacagcctggacggggcagag 94
             |||| ||||||||||||| ||||||||||
Sbjct: 18856 acaacggctacagcctggccggggcagag 18828



to top

>dbj|AK126105.1| Homo sapiens cDNA FLJ44117 fis, clone TESTI4046903
          Length = 4938

 Score = 42.1 bits (21), Expect = 0.90
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 66   acaatggctacagcctggacggggcagag 94
            |||| ||||||||||||| ||||||||||
Sbjct: 4054 acaacggctacagcctggccggggcagag 4082



to top

>gb|AC093572.18| Pan troglodytes clone rp43-25g23, complete sequence
          Length = 195652

 Score = 42.1 bits (21), Expect = 0.90
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 66     acaatggctacagcctggacggggcagag 94
              |||| ||||||||||||| ||||||||||
Sbjct: 127508 acaacggctacagcctggccggggcagag 127480



to top

>dbj|AK026431.1| Homo sapiens cDNA: FLJ22778 fis, clone KAIA1714
          Length = 2723

 Score = 42.1 bits (21), Expect = 0.90
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 66   acaatggctacagcctggacggggcagag 94
            |||| ||||||||||||| ||||||||||
Sbjct: 2317 acaacggctacagcctggccggggcagag 2345



to top

>dbj|AP000353.2| Homo sapiens genomic DNA, chromosome 22q11.2, IGLL region,
             clone:KB318B8
          Length = 123828

 Score = 42.1 bits (21), Expect = 0.90
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 66    acaatggctacagcctggacggggcagag 94
             |||| ||||||||||||| ||||||||||
Sbjct: 86341 acaacggctacagcctggccggggcagag 86369



to top

>gb|AC140279.4| Mus musculus BAC clone RP23-338N10 from chromosome 16, complete
             sequence
          Length = 211002

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 253   ttgacctggttgcaacatgg 272
             ||||||||||||||||||||
Sbjct: 49118 ttgacctggttgcaacatgg 49099



to top

>ref|NM_006772.1| Homo sapiens synaptic Ras GTPase activating protein 1 homolog (rat)
            (SYNGAP1), mRNA
          Length = 6010

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    gggccaactcacagcacatt 20
            ||||||||||||||||||||
Sbjct: 1846 gggccaactcacagcacatt 1827



to top

>gb|AC163023.4| Mus musculus chromosome 3, clone RP24-247E19, complete sequence
          Length = 166206

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 201   tgaatgatcttacaacagtt 220
             ||||||||||||||||||||
Sbjct: 14913 tgaatgatcttacaacagtt 14894



to top

>gb|AC117256.4| Mus musculus BAC clone RP24-483G23 from chromosome 16, complete
             sequence
          Length = 167118

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 253   ttgacctggttgcaacatgg 272
             ||||||||||||||||||||
Sbjct: 43631 ttgacctggttgcaacatgg 43650



to top

>emb|BX088650.9| Human DNA sequence from clone DASS-97D12 on chromosome 6, complete
             sequence
          Length = 92518

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 1     gggccaactcacagcacatt 20
             ||||||||||||||||||||
Sbjct: 50868 gggccaactcacagcacatt 50849



to top

>emb|AL662799.16| Human DNA sequence from clone XXbac-294E21 on chromosome 6 contains the
             gene for a novel protein similar to lysophospholipase II
             (LYPLA2), the KNSL2 gene for kinesin-like 2, the PHF1 gene
             for PHD finger protein 1, the gene for divalent cation
             tolerant protein CUTA, the SYNGAP1 gene for synaptic Ras
             GTPase activating protein 1 homolog and five CpG islands,
             complete sequence
          Length = 136021

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 1     gggccaactcacagcacatt 20
             ||||||||||||||||||||
Sbjct: 91263 gggccaactcacagcacatt 91244



to top

>emb|AL391379.12| Human DNA sequence from clone RP13-171J5 on chromosome X Contains a CpG
             island, complete sequence
          Length = 116800

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 59    atttcaaacaatggctacag 78
             ||||||||||||||||||||
Sbjct: 12105 atttcaaacaatggctacag 12086



to top

>emb|AL050332.15|HSDJ570F3 Human DNA sequence from clone RP4-570F3 on chromosome 6 Contains the
            5' end of the SYNGAP1 gene for synaptic Ras GTPase
            activating protein 1 homolog (rat), gene LOC51596 for
            divalent cation tolerant protein CUTA or brain
            acetylcholinesterase putative membrane anchor, the PHF1
            gene for PHD finger protein 1, the KNSL2 gene for
            kinesin-like protein 2, a ribosomal protein L12
            pseudogene (RPL12P1), a lysophospholipase II (LYPLA2)
            pseudogene and four CpG islands, complete sequence
          Length = 94770

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 1    gggccaactcacagcacatt 20
            ||||||||||||||||||||
Sbjct: 6735 gggccaactcacagcacatt 6754



to top

>dbj|AK094225.1| Homo sapiens cDNA FLJ36906 fis, clone BRACE2003788, highly similar to
            Rattus norvegicus synaptic ras GTPase-activating protein
            p135 SynGAP mRNA
          Length = 2061

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    gggccaactcacagcacatt 20
            ||||||||||||||||||||
Sbjct: 1846 gggccaactcacagcacatt 1827



to top

>dbj|AB067525.2| Homo sapiens mRNA for KIAA1938 protein, partial cds
          Length = 9768

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    gggccaactcacagcacatt 20
            ||||||||||||||||||||
Sbjct: 1752 gggccaactcacagcacatt 1733



to top

>gb|AC145744.3| Mus musculus BAC clone RP24-142P6 from 16, complete sequence
          Length = 207240

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 253   ttgacctggttgcaacatgg 272
             ||||||||||||||||||||
Sbjct: 56968 ttgacctggttgcaacatgg 56987



to top

>emb|AL713634.1|HSM802956 Homo sapiens mRNA; cDNA DKFZp761G1421 (from clone DKFZp761G1421)
          Length = 4699

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 1   gggccaactcacagcacatt 20
           ||||||||||||||||||||
Sbjct: 502 gggccaactcacagcacatt 483


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,801,771
Number of Sequences: 3902068
Number of extensions: 1801771
Number of successful extensions: 33415
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33392
Number of HSP's gapped (non-prelim): 23
length of query: 272
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 250
effective length of database: 17,147,199,772
effective search space: 4286799943000
effective search space used: 4286799943000
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top